LookUp List Information

List: AnalytewithUnitperMatrix

AnalyteName	AnalyteDescr	CASNumber	pHab_Unit	Water_Unit	Sediment_Unit	Tox_Unit	Fish_Unit	Bivalve_Unit	Group1	Group2	Group3	Group4	Group5	Group6
6-Pack Ring	6-Pack Ring	0	pieces						Debris	Trash	Plastics	FoodService
AccesstoWaterbody_BikePath	AccesstoWaterbody_BikePath	0	none						Habitat	Debris
AccesstoWaterbody_Fence	AccesstoWaterbody_Fence	0	none						Habitat	Debris
AccesstoWaterbody_HeavyVegetation	AccesstoWaterbody_HeavyVegetation	0	none						Habitat	Debris
AccesstoWaterbody_ParkingLot	AccesstoWaterbody_ParkingLot	0	none						Habitat	Debris
AccesstoWaterbody_PicnicArea	AccesstoWaterbody_PicnicArea	0	none						Habitat	Debris
AccesstoWaterbody_RestrictedAccessMaintenanceRoad	AccesstoWaterbody_RestrictedAccessMaintenanceRoad	0	none						Habitat	Debris
AccesstoWaterbody_Roadway	AccesstoWaterbody_Roadway	0	none						Habitat	Debris
AccesstoWaterbody_Walkway	AccesstoWaterbody_Walkway	0	none						Habitat	Debris
Accumulation	Accumulation using Trash Protocol	0	score						Trash
Acenaphthene	Acenaphthene	83329		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH	Endocrine Disruptors
Acenaphthene-d10(Surrogate)	Surrogate: Acenaphthene-d10	15067262		% recovery	ng/g dw		ng/g ww	ng/g dw	Organics	PAHs	SVOCs	LMW_PAH	Endocrine Disruptors
Acenaphthenes, C1-	C1-Acenaphthenes	0		ng/L					Organics	PAHs
Acenaphthylene	Acenaphthylene	208968		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH
Acenaphthylene-d8(IsoDilAnalogue)	Isotope Dilution Analogue: Acenaphthylene-d8	93951974		% recovery					Organics	PAHs	IDA
Acenaphthylene-d8(Surrogate)	Surrogate: Acenaphthylene-d8	208968		% recovery	% recovery		% recovery	% recovery	Organics	PAH
Acetaminophen	Acetaminophen	0		ng/L			ng/g ww	ng/g dw	Organics
Acetaminophen(Surrogate)	Surrogate: Acetaminophen	0					% recovery	% recovery	Organics
Acetamiprid	Acetamiprid	135410207		ug/L	ng/g dw				Organics	Pesticides	Insecticides
Acetone	Acetone	67641		ug/L					Organics	VOCs
Acibenzolar-S-methyl	Acibenzolar-S-methyl	135158542		ng/L					Organics	Pesticides	Fungicides
Acid Neutralizing Capacity	Acid Neutralizing Capacity (ANC)	0		ueq/L					Inorganics	Conventionals
Acid Volatile Sulfides	Acid Volatile Sulfides (AVS)	0			umol/g				Inorganics	Conventionals
Acifluorfen	Acifluorfen	50594666		ug/L					Organics	Herbicides
Acrolein	Acrolein	107028		ug/L					Organics	Pesticides	Herbicides
Acrylonitrile	Acrylonitrile	0		ug/L					Organics
Aesthetic Condition	Aesthetic Condition	0	none						Habitat	Debris
AFDM_Algae	Ash Free Dry Mass primarily of Algae but other items may be weighed	0		mg/m3					Inorganics	Conventionals
Age	Age	0					yr		Tissue
Age Diversity and Natural Regeneration Metric	Metric assesses the age diversity and natural regeneration potential of woody species in the riparian and channel zones (excluding low-flow).	0	score						Habitat
Age_Pond	Age (in years) of the pond if it is created	0	yr						Habitat
Alachlor	Alachlor (Lasso)	15972608		ug/L	ng/g dw				Organics	Herbicides	Endocrine Disruptors
Aldicarb	Aldicarb	116063		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Carbamates	Insecticides
Aldicarb Sulfone	Aldicarb Sulfone	1646884		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Carbamates	Insecticides
Aldicarb Sulfoxide	Aldicarb Sulfoxide	1646873		ug/L					Organics	Pesticides	Pest-Carbamates	Insecticides
Aldrin	Aldrin	309002		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Endocrine Disruptors
Aldrin(Surrogate)	Surrogate: Aldrin	309002		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides
Aldrin-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Aldrin-13C12	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA
Algae Cover	Percent of stream's water surface upstream of sample location estimated to be covered with algae	0	%						FieldObservations	Habitat
Algae Cover Filamentous	Percent of stream's water surface upstream of sample location estimated to be covered with filamentous algae	0	%						FieldObservations	Habitat
Algae-attached	Percent of substrate in wetted channel upstream of sample location estimated to be covered with Algae-attached	0	%						FieldObservations	Habitat
Algae-floating Mats	Percent of stream's water surface upstream of sample location estimated to be covered with Algae-floating Mats	0	%						FieldObservations	Habitat
Algal Cover Periphyton	Percent of substrate in wetted channel upstream of sample location estimated to be covered with periphyton [living community attached to substrate including algae (not green filamentous type), aquatic mosses, fungi, diatoms & sessile invertebrates]	0	%						FieldObservations	Habitat
Alkalinity as CaCO3	Alkalinity as CaCO3	471341		mg/L					Inorganics	Conventionals	WaterQualityMeasurements	Habitat
Allethrin	Allethrin	584792		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Alpha Linolenic Acid	Alpha Linolenic Acid	0					mg/100g ww	mg/100g dw	Organics	Omega Fatty Acid
Aluminum	Aluminum	7429905		ug/L	ug/g dw		ug/g ww	ug/g dw	Inorganics	TraceElements	Metals
Aluminum Foil	Aluminum Foil	0	pieces						Debris	Trash	Non-Plastics	Metal
Aluminum, Organic Monomeric	Organic Monomeric Aluminum (Organic Reactive)	0		ug/L					Inorganics	TraceElements	Metals
Aluminum, Total Monomeric	Total Monomeric Aluminum (Organic + Inorganic Reactive)	0		ug/L					Inorganics	TraceElements	Metals
Aluminum/Steel Can	Aluminum/Steel Can	0	pieces						Debris	Trash	Non-Plastics	Metal
Ametryn	Ametryn	834128		ug/L					Organics	Pesticides	Pest-Triazines	Herbicides
Aminocarb	Aminocarb	2032599		ug/L					Organics	Pesticides	Pest-Carbamates	Insecticides
Aminopyralid	Aminopyralid	150114719		ug/L					Organics
Ammonia as N	Ammonia as N	7664417		ug/L	mg/Kg ww				Inorganics	Conventionals	Nutrients
Ammonia as N, Unionized	Unionized Ammonia as N	7664417		mg/L					Inorganics	Conventional	Nutrients	WaterQualityMeasurements
Ammonia as NH3	Ammonia as NH3	7664417		mg/L					Inorganics	Conventionals	Nutrients	WaterQualityMeasurements
Ammonia as NH3, Unionized	Unionized Ammonia as NH3	7664417		mg/L					Inorganics	Conventionals	Nutrients	WaterQualityMeasurements
Ammonium as N	Ammonium as N (NH4)	0		mg/L					Inorganics	Conventionals	Nutrients
Amoxicillin	Amoxicillin	26787780		ng/L
AMPA	Aminomethyl Phosphonic Acid (AMPA)	1066519		ug/L					Organics	Pesticides	Herbicides
AMPA(Surrogate)	Surrogate: Aminomethyl Phosphonic Acid (AMPA)	77521290		% recovery					Organics
Anatoxin-A	Anatoxin-A	64285069		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins
Angling Pressure	Angling Pressure	0	none						Habitat
Anilazine	Anilazine	101053		ug/L					Organics	Pesticides	Fungicides
Aniline	Aniline (Aminobenzene)(Phenylamine)	0		ug/L					Organics	SVOCs
AnimalPresence	describes presence of animals which may include tracks, scat, sounds or physical presence	0	none						FieldObservations	Habitat
Anthracene	Anthracene	120127		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH	Endocrine Disruptors
Anthracene-d10(IsoDilAnalogue)	Isotope Dilution Analogue: Anthracene-d10	1719068		% recovery					Organics		IDA
Anthracene-d10(Surrogate)	Surrogate: Anthracene-d10	120127		% recovery					Organics	PAHs	SVOCs	LMW_PAH	Endocrine Disruptors
Anthropogenic Alt Channel Modification SubMetric	Metric assesses the impact of anthropogenic alterations based on channel modification	0	score						Habitat
Anthropogenic Alt Hydromodification SubMetric	Metric assesses the impact of anthropogenic alterations based on hydromodification and Channel Evolution Models (CEMS)	0	score						Habitat
Anthropogenic Alterations to Channel Morph Metric	Metric assesses the impact of anthropogenic alterations to channel morphology through hydromodification and channel modification. Metric is an average of the two previous submetrics.	0	score						Habitat
Antimony	Antimony	7440360		ug/L	ug/g dw		ug/g ww	ug/g dw	Inorganics	Metals	Metalloids
Appliance	Appliance	0	pieces						Debris	Trash	Non-Plastics	Large
AquaticLife	AquaticLife using Trash Protocol	0	score						Trash
Arachidonic	Arachidonic	0					mg/100g ww	mg/100g dw	Organics	Omega Fatty Acid
Area	Area	0	m2						Tissue	Habitat
Arsenic	Arsenic	7440382		ug/L	ug/g dw		ug/g ww	ug/g dw	Inorganics	TraceElements	Metals	Metalloids
Arsenic, Inorganic	Inorganic Arsenic	7440382					ug/g ww	ug/g dw	Inorganics	TraceElements	Metals
Asbestos, Total	Total Asbestos	0		mf/L					Inorganics	Conventionals
Ash Free Dry Mass	Ash-Free Dry Mass (AFDM, AFDW)	0		g/m2					Inorganics	Conventionals	Benthic
Aspon	Aspon	3244904		ug/L					Organics	Pesticides	Pest-OPs	Insecticides
Atenolol	Atenolol	29122687		ng/L					Organics	PPCPs
Atorvastatin	Atorvastatin	134523005		ng/L					Organics	PPCPs
Atraton	Atraton	1610179		ug/L					Organics	Pesticides	Pest-Triazines	Herbicides
Atrazine	Atrazine	1912249		ug/L	ng/g dw				Organics	Pesticides	Pest-Triazines	Herbicides	Endocrine Disruptors
Atrazine-13C3(Surrogate)	Surrogate: Atrazine-13C3	0		% recovery					Organics	Pesticides	Pest-Triazines
Atrazine-d5(Surrogate)	Surrogate: Atrazine-d5	163165751		% recovery					Organics	Pesticides	Pest-Triazines	Herbicides	Endocrine Disruptors
Atrazine-Desisopropyl-2-Hydroxy	Atrazine-Desisopropyl-2-Hydroxy	7313544		ug/L					Organics	Omega Fatty Acid
Autopart	Autopart	0	pieces						Debris	Trash	Non-Plastics	Metal
Avian_GFD	Avian_GFD	0		copies/100 mL					Microbiological
Azinphos Ethyl	Azinphos Ethyl	2642719		ug/L					Organics	Pesticides	Pest-OPs	Insecticides
Azinphos Methyl	Azinphos Methyl (Guthion)	86500		ug/L	ng/g dw				Organics	Pesticides	Pest-OPs	Insecticides
Azinphos Methyl oxon	Azinphos Methyl oxon	0		ng/L					Organics	Pesticides
Azithromycin	Azithromycin	0		ng/L			ng/g ww	ng/g dw	Organics
Azobenzene	Azobenzene (Diphenyl Diimide)	0		ug/L					Organics	SVOCs
Azoxystrobin	Azoxystrobin	131860338		ug/L					Organics	Fungicides
Back Water	Back Water present	0	none						Habitat
Bacteroidales, Cow	Cow Bacteroidales	0		gc/mL					Microbiological	Pathogens	Conventional
Bacteroidales, Dog	Dog Bacteroidales	0		gc/mL	copies/g dw				Microbiological	Pathogens	Conventional
Bacteroidales, Horse	Horse Bacteroidales	0		none					Microbiological	Pathogens	Conventional
Bacteroidales, Human	Human Bacteroidales	0		gc/mL	copies/g dw				Microbiological	Pathogens	Conventional
Bacteroidales, Human (BacH)	Human Bacteroidales Marker BacH	0		gc/mL					Microbiological	Pathogens	Conventional
Bacteroidales, Human (HF183/BacR287)	Human Bacteroidales, Assay name: HF183/BacR287, 5'-ATCATGAGTTCACATGTCCG-3', 5'-CTTCCTCTCAGAACCCCTATCC-3'	0		copies/100 mL					Microbiological
Bacteroidales, Human (HF183/BFDrev)	Human Bacteroidales, Assay name: HF183/BFDrev, 5' ATCATGAGTTCACATGTCCG 3', 5' CGTAGGAGTTTGGACCGTGT 3'	0		gc/mL					Microbiological	Pathogens	Conventional
Bacteroidales, Universal	Universal Bacteroidales	0		gc/mL					Microbiological	Pathogens	Conventional
Bacteroidales, Universal (UniB)	Universal Bacteroidales, Assay name: UniB, 5' GGGGTTCTGAGAGGAAGGT 3', 5' CCGTCATCCTTCACGCTACT 3'	0		copies/100 mL					Microbiological	Pathogens	Conventional
Bag, Large/Retail	Bag, Large/Retail	0	pieces						Debris	Trash	Plastics	Bags/Packaging
Bag, Pet Waste	Bag, Pet Waste	0	pieces						Debris	Trash	Plastics	Bags/Packaging
Bag, Single Use Plastic	Bag, Single Use Plastic	0	pieces						Debris	Trash	Plastics	Bags/Packaging
Bag, Takeout	Bag, Takeout	0	pieces						Debris	Trash	Plastics	Bags/Packaging
Bags/Packaging	Bags/Packaging	0	L						Debris	Trash	Plastics
Balloon, Latex	Balloon, Latex	0	pieces						Debris	Trash	Plastics	Miscellaneous
Balloon, Mylar	Balloon, Mylar	0	pieces						Debris	Trash	Plastics	Miscellaneous
Bandage/Bandaid	Bandage/Bandaid	0	pieces						Debris	Trash	Plastics	Miscellaneous
Bank Angle	Bank Angle	0	none						Habitat
Bank Cover	Bank Cover	0	none						Habitat
Bank Stability	Bank Stability (score zone 5m up and 5m downstream of transect between bankfull - wetted width)	0	none						Habitat
Bankfull Height	Bankfull Height	0	m						Habitat
Bankfull Width	Bankfull Width	0	m						Habitat
Bankfull Width Reach	Visual estimate of the average bankfull width of the reach	0	m						Habitat
Bar Present	Bar Present	0	none						Habitat
Bar Width	Bar Width	0	m						Habitat
Barban	Barban	101279		ug/L					Organics	Pesticides	Pest-Carbamates	Herbicides
Barban(Surrogate)	Surrogate: Barban	101279		% recovery					Organics	Pesticides	Pest-Carbamates
Barium	Barium	7440393		ug/L	ug/g dw		ug/g ww	ug/g dw	Inorganics	Metals
Barometric Pressure	Barometric Pressure	0							Habitat
Batteries, Large	Batteries, Large	0	pieces						Debris	Trash	Non-Plastics	Toxic
Batteries, Small	Batteries, Small	0	pieces						Debris	Trash	Non-Plastics	Toxic
Battery Voltage	Battery Voltage	0							FieldMeasure
Bearing	Bearing	0	degrees						Habitat
BeaufortScale	BeaufortScale	0	none						FieldObservations	Habitat
Beaver Flow Modifications	Beaver Flow Modifications	0	none						Habitat
Beaver Signs	Beaver Signs	0	none						Habitat
Bendiocarb	Bendiocarb	22781233		ug/L					Organics	Pesticides	Pest-Carbamates
Benfluralin	Benfluralin	1861401		ug/L					Organics	Pesticides	Herbicides
Benomyl	Benomyl	17804352		ug/L					Organics	Pesticides	Pest-Carbamates	Endocrine Disruptors	Fungicides	Nematocides
Bensulfuron Methyl	Bensulfuron Methyl	83055996		ug/L					Organics	Pesticides	Pest-Carbamates
Bensulide	Bensulide	741582		ug/L					Organics	Pesticides	Herbicides
Bentazon	Bentazon	25057890		ug/L					Organics	Pesticides	Pest-Carbamates
Benz(a)anthracene	Benz(a)anthracene	56553		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors
Benz(a)anthracene-d12(IsoDilAnalogue)	Isotope Dilution Analogue: Benz(a)anthracene-d12	1718532		% recovery					Organics	PAH	IDA
Benz(a)anthracene-d12(Surrogate)	Surrogate: Benz(a)anthracene-d12	1718532		% recovery	% recovery		ng/g ww	ng/g dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors
Benz(a)anthracenes/Chrysenes, C1-	C1-Benz(a)anthracenes/Chrysenes	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs
Benz(a)anthracenes/Chrysenes, C2-	C2-Benz(a)anthracenes/Chrysenes	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs
Benz(a)anthracenes/Chrysenes, C3-	C3-Benz(a)anthracenes/Chrysenes	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs
Benz(a)anthracenes/Chrysenes, C4-	C4-Benz(a)anthracenes/Chrysenes	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs
Benz(e)pyrene-d12(Surrogate)	Surrogate: Benz(e)pyrene-d12	205440820		% recovery	% recovery				Organics	PAHs	Semi-VOAs
Benzene	Benzene	71432		ug/L					Organics	VOCs	MTBE_BTEX
Benzidine	Benzidine	0		ug/L					Organics
Benzo(a)fluoranthene	Benzo(a)fluoranthene	203338		ug/L	ng/g dw				Organics	PAHs	SVOCs
Benzo(a)pyrene	Benzo(a)pyrene	50328		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors
Benzo(a)pyrene-d12(IsoDilAnalogue)	Isotope Dilution Analogue: Benzo(a)pyrene-d12	63466717		% recovery					Organics	PAHs	IDA
Benzo(a)pyrene-d12(Surrogate)	Surrogate: Benzo(a)pyrene-d12	50328		% recovery	% recovery		% recovery	% recovery	Organics	PAH
Benzo(b)fluoranthene	Benzo(b)fluoranthene	205992		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors
Benzo(b)fluoranthene-d12(IsoDilAnalogue)	Isotope Dilution Analogue: Benzo(b)fluoranthene-d12	93951985		% recovery					Organics	PAHs	IDA
Benzo(b)fluoranthene-d12(Surrogate)	Surrogate: Benzo(b)fluoranthene-d12	93951985		% recovery	% recovery		% recovery	% recovery	Organics	PAH
Benzo(e)pyrene	Benzo(e)pyrene	192972		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors
Benzo(e)pyrene-d12(Surrogate)	Surrogate: Benzo(e)pyrene-d12	205440820		% recovery	% recovery				Organics	PAHs	SVOCs
Benzo(g,h,i)perylene	Benzo(g,h,i)perylene	191242		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors
Benzo(g,h,i)perylene-d12(IsoDilAnalogue)	Isotope Dilution Analogue: Benzo(g,h,i)perylene-d12	93951667		% recovery					Organics	PAHs	IDA
Benzo(g,h,i)perylene-d12(Surrogate)	Surrogate: Benzo(g,h,i)perylene-d12	93951667		% recovery	% recovery		ng/g ww	ng/g dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors
Benzo(j/k)fluoranthene	Benzo(j)fluoranthene/Benzo(k)fluoranthene	0		ng/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors
Benzo(k)fluoranthene	Benzo(k)fluoranthene	207089		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors
Benzo(k)fluoranthene-d12(IsoDilAnalogue)	Isotope Dilution Analogue: Benzo(k)fluoranthene-d12	93952013		% recovery					Organics	PAHs	IDA
Benzo(k)fluoranthene-d12(Surrogate)	Surrogate: Benzo(k)fluoranthene-d12	0		% recovery	% recovery		% recovery	% recovery	Organics
Benzofluoranthenes/Benzopyrenes, C1-	C1-Benzofluoranthenes/Benzopyrenes	0		ng/L					Organics	PAHs
Benzofluoranthenes/Benzopyrenes, C2-	C2-Benzofluoranthenes/Benzopyrenes	0		ng/L					Organics	PAHs
Benzoic acid	Benzoic acid	0		ug/L					Organics	SVOCs
Benzothiophene	Benzothiophene	95158		ng/L					Organics	PAHs
Benzothiophene, C1-	C1-Benzothiophene	0		ng/L					Organics	PAHs
Benzothiophene, C2-	C2-Benzothiophene	0		ng/L					Organics	PAHs
Benzothiophene, C3-	C3-Benzothiophene	0		ng/L					Organics	PAHs
Benzyl Alcohol	Benzyl Alcohol	0		ug/L					Organics	SVOCs
Beryllium	Beryllium	7440417		ug/L	ug/g dw		ug/g ww	ug/g dw	Inorganics	Metals
Bicarbonate	Bicarbonate	71523		mg/L					Inorganics	Conventionals
Bifenox	Bifenox	42576023		ug/L					Organics	Pesticides	Herbicides
Bifenthrin	Bifenthrin	82657043		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Biodegradable, Other	Biodegradable, Other	0	pieces						Debris	Natural	Non-Plastics	Biodegradable
Biomass (wt/orig indiv)	Biomass (weight/original individual)	0				mg/ind			Toxicity
Biphenyl	Biphenyl	92524		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH
Biphenyl-d10(IsoDilAnalogue)	Isotope Dilution Analogue: Biphenyl-d10	1486017		% recovery					Organics	PAHs	IDA
Biphenyl-d10(Surrogate)	Surrogate: Biphenyl-d10	1486017		% recovery	% recovery		ng/g ww	ng/g dw	Organics	PAHs	SVOCs
Biphenyls, C1-	C1-Biphenyls	0		ng/L					Organics	PAHs
Biphenyls, C2-	C2-Biphenyls	0		ng/L					Organics	PAHs
Bis(2-chloroethoxy)methane	Bis(2-chloroethoxy)methane	111911		ug/L					Organics	SVOCs
Bis(2-chloroethyl)ether	Bis(2-chloroethyl)ether	111444		ug/L					Organics	SVOCs
Bis(2-chloroisopropyl) ether	Bis(2-chloroisopropyl) ether	39638329		ug/L					Organics	SVOCs
Bis(2-ethylhexyl)adipate	Bis(2-ethylhexyl)adipate	0		ug/L					Organics
Bis(2-ethylhexyl)phthalate	Bis(2-ethylhexyl)phthalate	117817		ug/L	ug/kg				Organics	SVOCs	Endocrine Disruptors
Bisphenol A	Bisphenol A	0		ng/L
Bisphenol A-d16(IsoDilAnalogue)	Isotope Dilution Analogue: Bisphenol A-d16	96210876		% recovery					Organics		IDA
Bispyribac Sodium	Bispyribac Sodium	125401925		ug/L					Organics	Pesticides	Herbicides
Blue-Green Algae Phycocyanin	Blue-Green Algae Phycocyanin (BGA-PC)	0		ug/L					WaterQualityMeasurements
BOD	Biochemical Oxygen Demand (BOD) - 5 day test	0		mg/L					Inorganics	Conventionals
Bolstar	Bolstar (Sulprofos)	35400432		ug/L	ug/g dw				Organics	Pesticides	Pest-OPs	Insecticides
Boron	Boron	7440428		ug/L					Inorganics	Conventionals	Metals	Metalloids
Boscalid	Boscalid	188425856		ug/L					Organics	Fungicides
Bottle Cap, Metal	Bottle Cap, Metal	0	pieces						Debris	Trash	Non-Plastics	Metal
Bottle Cap, Plastic	Bottle Cap, Plastic	0	pieces						Debris	Trash	Plastics	FoodService
Bottle, Beach	Bottle, Beach	0	pieces						Debris	Trash	Plastics	Toxic
Bottle, Cleaning	Bottle, Cleaning	0	pieces						Debris	Trash	Plastics	Toxic
Bottle, Glass	Bottle, Glass	0	pieces						Debris	Trash	Non-Plastics	Household
Bottle, Shampoo	Bottle, Shampoo	0	pieces						Debris	Trash	Plastics	Household
Bottle, Soda	Bottle, Soda	0	pieces						Debris	Trash	Plastics	FoodService
Bottle, Sport	Bottle, Sport	0	pieces						Debris	Trash	Plastics	FoodService
Bottle, Water	Bottle, Water	0	pieces						Debris	Trash	Plastics	FoodService
Brick	Brick	0	pieces						Debris	Trash	Non-Plastics	Construction
Bridge	Bridge	0	none						Habitat	Debris
Bridge Fence	Bridge Fence	0	none						Habitat	Debris
Bridge Fence Height	Bridge Fence Height	0	m						Habitat	Debris
Bridges, Culverts	Bridges, Culverts	0	none						Habitat
Bromacil	Bromacil	314409		ug/L					Organics	Pesticides	Pest-Carbamates	Herbicides
Bromide	Bromide	24959679		ug/L					Inorganics	Conventionals	Nutrients
Bromo-3,5-dimethylphenyl-N-methylcarbamate, 4-(Surrogate)	Surrogate: 4-Bromo-3,5-dimethylphenyl-N-methylcarbamate (BDMC)	672991		% recovery					Organics	Pesticides	Pest-OCHs
Bromobenzene	Bromobenzene (Phenyl Bromide)	108861		ug/L					Organics	VOCs
Bromochloromethane	Bromochloromethane	74975		ug/L					Organics	VOCs
Bromodichloromethane	Bromodichloromethane (Dichlorobromomethane)	75274		ug/L					Organics	VOCs
Bromofluorobenzene, 4-	4-Bromofluorobenzene	460004		% recovery					Organics	VOCs
Bromofluorobenzene, 4-(Surrogate)	Surrogate: 4-Bromofluorobenzene	460004		% recovery					Organics	VOCs
Bromoform	Bromoform (Tribromomethane)	75252		ug/L					Organics	VOCs
Bromomethane	Bromomethane (Methyl Bromide)	74839		ug/L					Organics	VOCs
Bromophenyl Phenyl Ether, 4-	4-Bromophenyl Phenyl Ether	101553		ug/L					Organics	SVOCs
Bromuconazole	Bromuconazole	116255482		ng/L					Organics	Pesticides	Fungicides
Bulk Density	Bulk Density	0			g/cm3 ww
Butachlor	Butachlor	23184669		ug/L					Organics	Herbicides
Butanone, 2-	2-Butanone (Methyl Ethyl Ketone)	78933		ug/L					Organics	VOCs
Butralin	Butralin	33629479		ng/L					Organics	Pesticides	Herbicides
Butyl Benzyl Phthalate	Butyl Benzyl Phthalate	85687		ug/L	mg/Kg dw				Organics	SVOCs	Endocrine Disruptors
Butylate	Butylate	2008415		ug/L	ng/g dw				Organics	Pesticides	Pest-Carbamates
Butylbenzene, n-	n-Butylbenzene	104518		ug/L					Organics	VOCs
Butylbenzene, sec-	sec-Butylbenzene	135988		ug/L					Organics	VOCs
Butylbenzene, tert-	tert-Butylbenzene	98066		ug/L					Organics	VOCs
C. coli	Campylobactor coli	0		copies/100 mL					Microbiological
C. jejuni	Campylobactor jejuni	0		copies/100 mL					Microbiological
Cadmium	Cadmium	7440439		ug/L	umol/g		ug/g ww	ug/g dw	Inorganics	TraceElements	Metals
Caffeine	Caffeine	58082		ug/L			ng/g ww	ng/g dw	Organics	PPCPs
Caffeine-13C(Surrogate)	Surrogate: Caffeine-13C	202282982		% recovery			% recovery	% recovery	Organics	PPCPs
Calcium	Calcium	7440702		ug/L					Inorganics	Conventionals	Metals
Canopy Cover	Canopy Cover	0	none						Habitat
Captafol	Captafol	2425061		ug/L					Organics	Pesticides	Fungicides
Captan	Captan	133062		ug/L					Organics	Pesticides	Pest-Carbamates	Insecticides
Carbadox	Carbadox	6804075		ug/L			ng/g ww	ng/g dw	Organics	PPCPs
Carbamazepine	Carbamazepine	298464		ug/L			ng/g ww	ng/g dw	Organics	PPCPs
Carbamazepine(Surrogate)	Surrogate: Carbamazepine	0					% recovery	% recovery	Organics	Pesticides
Carbaryl	Carbaryl	63252		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Carbamates	Insecticides	Endocrine Disruptors
Carbazole(Surrogate)	Surrogate: Carbazole	86748		% recovery					Organics	Semi-VOAs
Carbendazim	Carbendazim	10605217		ng/L					Organics	Pesticides	Fungicides
Carbofuran	Carbofuran	1563662		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Carbamates	Insecticides	Nematocides
Carbon dioxide, free	Carbon dioxide, free	0		mg/L
Carbon Dioxide, total	Carbon Dioxide, total	0		mg/L
Carbon Disulfide	Carbon Disulfide	0		ug/L
Carbon Tetrachloride	Carbon Tetrachloride	56235		ug/L					Organics	VOCs
Carbon-13/Carbon-12 Ratio	Carbon-13/Carbon-12 Ratio	14762744		per mil					Radiochemistry
Carbon-14	Carbon-14	14762755		% modern					Radiochemistry
Carbon-14 Counting Error	Carbon-14 Counting Error	0		% modern					Radiochemisty
Carbonate	Carbonate	3812326		mg/L					Inorganics	Conventionals
Carbophenothion	Carbophenothion (Trithion)	786196		ug/L					Organics	Pesticides	Pest-OPs	Insecticides
Carfentrazone Ethyl	Carfentrazone Ethyl	128639021		ug/L					Organics	Pesticides
Cascade/Falls	Cascade/Falls	0	%						Habitat
Catellicoccus, Gull	Gull Catellicoccus	0		copies/100 mL	copies/g dw
CD/DVD	CD/DVD	0	pieces						Debris	Trash	Plastics	Household
CDOM	Colored Dissolved Organic Matter	0		ug/L
Cefotaxime	Cefotaxime	0					ng/g ww	ng/g dw	Organics
Ceramic Pot/Shard	Ceramic Pot/Shard	0	pieces						Debris	Trash	Non-Plastics	Household
Cerium	Cerium	7440451		ug/L					Inorganics
Channel Constraining Feature	Channel Constraining Feature	0	none						Habitat
Channel Constraint	Channel Constraint	0	none						Habitat
Channel Engineered	Channel has been modified/engineered	0	none						Habitat	FieldObservations
Channel Margin in Contact	Channel Margin in Contact	0	%						Habitat
Channel Pattern	Channel Pattern	0	none						Habitat
Channel Unit	Channel Unit	0	none						Habitat
Channel Width Reach	Channel width used to define reach	0	m						Habitat
Channelization	Channelization	0	none						Habitat
Chemical Treatment	Chemical Treatment	0	none						Habitat
Chloramben	Chloramben	0		ug/L
Chlorantraniliprole	Chlorantraniliprole	500008457		ng/L					Organics	Pesticides	Insecticides
Chlorate	Chlorate	14866683		ug/L					Inorganics	Conventionals	Nutrients
Chlordane	Chlordane, not otherwise specified	57749		ug/L	ug/Kg dw				Organics	Pesticides	Pest-OCHs
Chlordane, cis-	cis-Chlordane (alpha-Chlordane)	5103719		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Chlordanes
Chlordane, Technical	Chlordane, mixture of many related chemicals, of which 10 are major components	12789036		ug/L					Organics	Pesticides	Pest-OCHs
Chlordane, Total	Total Chlordane, sum of cis-chlordane and trans-chlordane	0		ug/L	ug/g dw
Chlordane, trans-	trans-Chlordane (gamma-Chlordane)	5103742		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Chlordanes
Chlordane, trans-(Surrogate)	Surrogate: trans-Chlordane (gamma-Chlordane)	5103742		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides	Pest-OCHs	Insecticides	Chlordanes
Chlordane-13C10, trans-(IsoDilAnalogue)	Isotope Dilution Analogue: trans-Chlordane-13C10 (gamma-Chlordane)	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA
Chlordene	Chlordene	3734483		ug/L					Organics	Pesticides	Pest-OCHs	Endocrine Disruptors
Chlordene, cis-	cis-Chlordene (alpha-Chlordene)	56534022		ug/L	ng/g dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OCHs	Endocrine Disruptors
Chlordene, trans-	trans-Chlordene (gamma-Chlordene)	56641384		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OCHs	Endocrine Disruptors
Chlorfenapyr	Chlorfenapyr	122453730		ug/L					Organics	Pesticides
Chlorfenvinphos	Chlorfenvinphos	470906		ug/L					Organics	Pesticides	Pest-OPs
Chloride	Chloride	16887006		mg/L					Inorganics	Conventionals	Nutrients
Chlorimuron Ethyl	Chlorimuron Ethyl	90982324		ug/L					Organics	SVOCs
Chlorine, Free	Free Chlorine	0		mg/L
Chlorine, Total Residual	Total Residual Chlorine	0		mg/L					WaterQualityMeasurements
Chlorite	Chlorite	14998277		ug/L					Inorganics	Conventionals	Nutrients
Chlormefos	Chlormefos	0		% recovery
Chloro-2-methylphenoxy) Butanoic Acid, 4-(4-	4-(4-Chloro-2-methylphenoxy) Butanoic Acid (MCPB)	94815		ug/L					Organics	SVOCs
Chloro-3-methylphenol, 4-	4-Chloro-3-methylphenol	59507		ug/L	mg/Kg dw				Organics	SVOCs	Phenols	Chlorinated Phenols	Germicides
Chloroaniline, 4-	4-Chloroaniline	106478		ug/L					Organics	SVOCs
Chlorobenzene	Chlorobenzene	108907		ug/L					Organics	VOCs
Chlorobenzilate	Chlorobenzilate	510156		ug/L					Organics	Pesticides
Chloroeicosafluoro-3-Oxaundecane-1-Sulfonic Acid, 11-	11-Chloroeicosafluoro-3-Oxaundecane-1-Sulfonic Acid	763051929		ng/L	ng/g dw		ng/g ww	ng/g dw
Chloroethane	Chlorethane (Ethyl Chloride)	75003		ug/L					Organics	VOCs
Chloroethyl Vinyl Ether, 2-	2-Chloroethyl Vinyl Ether	110758		ug/L					Organics	VOCs
Chloroform	Chloroform	67663		ug/L					Organics	VOCs	Insecticides
Chlorohexadecafluoro-3-Oxanonane-1-Sulfonic Acid, 9-	9-Chlorohexadecafluoro-3-Oxanonane-1-Sulfonic Acid	756426581		ng/L	ng/g dw		ng/g ww	ng/g dw
Chloromethane	Chloromethane (Methyl Chloride)	74873		ug/L					Organics	VOCs
Chloronaphthalene, 2-	2-Chloronaphthalene	91587		ug/L					Organics	SVOCs
Chloroneb(Surrogate)	Surrogate: Chloroneb	2675776		% recovery					Organics	Pesticides	Pest-OCHs	Fungicides
Chlorophenol, 2-	2-Chlorophenol	95578		ug/L	mg/Kg dw				Organics	SVOCs	Phenols	Chlorinated Phenols
Chlorophenyl Phenyl Ether, 4-	4-Chlorophenyl Phenyl Ether	7005723		ug/L					Organics	SVOCs
Chlorophenyl)-N'-methylurea, N-(4-	N-(4-Chlorophenyl)-N'-methylurea	5352885		ug/L					Organics	Herbicides
Chlorophyll a	Chlorophyll a	479618		ug/L					WaterQualityMeasurements	Conventionals	Benthic	WaterQualityMeasurements
Chlorophyll a & b	Chlorophyll a & b	0		ug/L					WaterQualityMeasurements
Chlorophyll b	Chlorophyll b	0		ug/L					WaterQualityMeasurements
Chlorophyll, Total	Total Chlorophyll	0		ug/L					WaterQualityMeasurements
ChlorophyllSampleVolume	Volume of material and liquid filtered to produce the chlorophyll a sample	0		mL					Habitat
Chloropicrin	Chloropicrin	76062		ug/L					Organics	Pesticides
Chlorothalonil	Chlorothalonil	1897456		ug/L					Organics	Pesticides	Pest-OCHs	Algaecides	Fungicides	Nematocides
Chlorotoluene, 2-	2-Chlorotoluene	95498		ug/L					Organics	VOCs
Chlorotoluene, 4-	4-Chlorotoluene	106434		ug/L					Organics	VOCs
Chloroxuron	Chloroxuron (Chloroxyfenidim) (Norex)	1982474		ug/L					Organics	Herbicides
Chloroxuron(Surrogate)	Surrogate: Chloroxuron (Chloroxyfenidim) (Norex)	0			% recovery				Organics
Chlorpropham	Chlorpropham	101213		ug/L					Organics	Pesticides	Pest-Carbamates	Herbicides
Chlorpyrifos	Chlorpyrifos	2921882		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OPs	Insecticides
Chlorpyrifos Methyl	Chlorpyrifos Methyl	5598130		ug/L	ng/g dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides
Chlorpyrifos Methyl(Surrogate)	Surrogate: Chlorpyrifos Methyl	5598130		% recovery					Organics	Pesticides	Pest-OPs	Insecticides
Chlorpyrifos oxon	Chlorpyrifos Oxon	5598152		ng/L					Organics	Pesticides	OrganophosphatePest.	Insecticides
Chlortetracycline	Chlortetracycline	57625		ug/L					Organics	PPCPs
Chromium	Chromium	7440473		ug/L	ug/g dw		ug/g ww	ug/g dw	Inorganics	TraceElements	Metals
Chromium III	Chromium III (Trivalent Chromium)	18540300		ug/L					Metal
Chromium VI	Chromium VI	18540299		ug/L					Metal
Chrysene	Chrysene	218019		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors
Chrysene/Triphenylene	Chrysene/Triphenylene (CAS #EDF-359)	0			ng/g dw				Organics	PAHs
Chrysene-d12(IsoDilAnalogue)	Isotope Dilution Analogue: Chrysene-d12	1719035		% recovery					Organics	PAHs	IDA
Chrysene-d12(Surrogate)	Surrogate: Chrysene-d12	1719035		% recovery	ng/g dw		% recovery	% recovery	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors
Chrysenes, C1-	C1-Chrysenes	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors
Chrysenes, C2-	C2-Chrysenes	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors
Chrysenes, C3-	C3-Chrysenes	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors
Chrysenes, C4-	C4-Chrysenes	0		ng/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors
Cigarette Box/Wrapper	Cigarette Box/Wrapper	0	pieces						Debris	Trash	Plastics	Miscellaneous
Cigarette Butt	Cigarette Butt	0	pieces						Debris	Trash	Plastics	Toxic
Cinerin-1	Cinerin-1	25402066		ug/L	ng/g dw				Organics	Pesticides	Pest-Pyrethroids
Cinerin-2	Cinerin-2 (Cinerin II)	121200		ug/L	ng/g dw				Organics	Pesticides	Pest-Pyrethroids
Ciodrin	Ciodrin (Crotoxyphos)	7700176		ug/L					Organics	Pesticides	Pest-OPs	Insecticides
Ciprofloxacin	Ciprofloxacin	0		ng/L			ng/g ww	ng/g dw	Organics
Ciprofloxacin-13C3-N15(Surrogate)	Surrogate: Ciprofloxacin-13C3-N15	0					% recovery	% recovery	Organics
Circumference	Circumference	0	m						Habitat
Clarithromycin	Clarithromycin	0					ng/g ww	ng/g dw	Organics
Clay	Clay	0		%	%				Inorganics	Conventionals	GrainSize
Clinafloxacin	Clinafloxacin	0					ng/g ww	ng/g dw	Organics
Clomazone	Clomazone (Dimethazone)	81777891		ug/L					Organics	Pesticides	Herbicides
Clostridiales, Human (LACHNO3)	Human Clostridiales, Assay Name: LACHNO3	0		copies/100mL
Clothianidin	Clothianidin	210880925		ug/L	ng/g dw				Organics	Pesticides	Insecticide
Clothianidin-d3(Surrogate)	Surrogate: Clothianidin-d3	0		% recovery	% recovery
Clothing, synthetic fabric	Clothing, synthetic fabric	0	pieces						Debris	Trash	Plastics	Household
CloudCover	Cloud cover at the time of sampling	0	%						Habitat
Cloxacillin	Cloxacillin	0					ng/g ww	ng/g dw	Organics
Cobalt	Cobalt	7697372		ug/L	ug/g dw		ug/g ww	ug/g dw	Inorganics	Metals
COD	Chemical Oxygen Demand (COD)	0		mg/L					Inorganics	Conventionals
Coliform, Fecal	Fecal Coliform	0		MPN/100 mL			MPN/g ww	MPN/g dw	Microbiological	Pathogens	Conventional
Coliform, Total	Total Coliform	0		MPN/100 mL	MPN/g dw		MPN/g ww	MPN/g dw	Microbiological	Pathogens	Conventional
CollSub_PlantDead	Algae collected from dead plant (including wood) substratum	0	none						Habitat
CollSub_PlantLive	Algae collected from live plant (including wood) substratum	0	none						Habitat
CollSub_Rock	Algae collected from rock (including concrete and consolidated sediment) substratum	0	none						Habitat
CollSub_SedSoft	Algae collected from soft sediment substratum	0	none						Habitat
Color	Color	0		none	none				FieldObservations	Habitat
Color, True	Color of water from which turbidity has been removed	0		CU					Inorganics	Conventionals
Commercial	Commercial	0	none						Habitat
Composition	Composition	0			none				FieldObservations	Habitat
Computer	Computer	0	pieces						Debris	Trash	Plastics	Non-Plastics	Toxic	Large
Concrete/Asphalt	Concrete/Asphalt	0	pieces						Debris	Trash	Non-Plastics	Construction
Construction	Construction	0	none						Habitat
Construction Other	Construction Other	0	pieces						Debris	Trash	Non-Plastics	Construction
Construction Wood/Pellets	Construction Wood/Pellets	0	pieces						Debris	Trash	Non-Plastics	Large
Container, Chemical	Container, Chemical	0	pieces						Debris	Trash	Plastics	Toxic
Container, Juice	Container, Juice	0	pieces						Debris	Trash	Plastics	FoodService
Container, Storage	Container, Storage	0	pieces						Debris	Trash	Plastics	Household
Container, Styrofoam	Container, Styrofoam	0	pieces						Debris	Trash	Plastics	FoodService
Copper	Copper	7440508		ug/L	umol/g		ug/g ww	ug/g dw	Inorganics	TraceElements	Metals
Cotinine	Cotinine	486566		ng/L					Organics	PPCPs
Coumaphos	Coumaphos	56724		ug/L	ng/g dw				Organics	Pesticides	Pest-OPs	Insecticides
CPOM	Coarse particulate organic matter	0	none						Habitat
Cropland	Cropland	0	none						Habitat
Cryptosporidium	Cryptosporidium	0		cysts/L					Microbiological	Pathogens	Conventional
Cup	Cup	0	pieces						Debris	Trash	Plastics	FoodService
Cup, Styrofoam	Cup, Styrofoam	0	pieces						Debris	Trash	Plastics	Bags/Packaging
Cup, Waxed Paper	Cup, Waxed Paper	0	pieces						Debris	Trash	Plastics	Non-Plastics	FoodService
Cyanazine	Cyanazine	21725452		ug/L					Organics	Pesticides	Pest-Triazines	Herbicides
Cyanide	Cyanide	57125		ug/L					Inorganics	Conventionals
Cyanobacteria	Potentially toxigenic (PTOX) genera of cyanobacteria	0		none
CyanotoxinSampleVolume	Volume of material and liquid in Cyanotoxin sample	0		mL					Habitat
Cyantraniliprole	Cyantraniliprole	736994631		ng/L					Organics	Pesticides	Insecticides
Cyazofamid	Cyazofamid	120116883		ng/L					Organics	Pesticides	Fungicides
Cycloate	Cycloate	1134232		ug/L	ng/g dw				Organics	Pesticides	Pest-Carbamates
Cyfluthrin, beta-	beta-Cyfluthrin	68359375		ug/L	ng/g dw				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Cyfluthrin, gamma-	gamma-Cyfluthrin	76703623			ng/g dw				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Cyfluthrin, Total	Total Cyfluthrin	68359375		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Cyfluthrin-1	Cyfluthrin peak 1	68359375		ug/L					Organics	Pesticides	Pest-Pyrethroids	Insecticides
Cyfluthrin-2	Cyfluthrin peak 2	68359375		ug/L					Organics	Pesticides	Pest-Pyrethroids	Insecticides
Cyfluthrin-3	Cyfluthrin peak 3	68359375		ug/L					Organics	Pesticides	Pest-Pyrethroids	Insecticides
Cyfluthrin-4	Cyfluthrin peak 4	68359375		ug/L					Organics	Pesticides	Pest-Pyrethroids	Insecticides
Cyhalofop-butyl	Cyhalofop-butyl	122008859		ug/L					Organics	Pesticides	Herbicides
Cyhalothrin	Cyhalothrin	86085858		ng/L	ug/Kg dw				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Cyhalothrin, gamma-	gamma-Cyhalothrin	76703623			ng/g dw				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Cyhalothrin, lambda-1	lambda-Cyhalothrin, peak 1 or Warrior-1	91465086		ug/L					Organics	Pesticides	Pest-Pyrethroids	Insecticides
Cyhalothrin, lambda-2	lambda-Cyhalothrin, peak 2 or Warrior-2	91465086		ug/L					Organics	Pesticides	Pest-Pyrethroids	Insecticides
Cyhalothrin, Total lambda-	Total lambda-Cyhalothrin, sum peaks 1 & 2	91465086		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Cyhalothrin-d6, Total lambda-(Surrogate)	Surrogate: Total lambda-Cyhalothrin-d6	0		% recovery					Organics	Pesticides
Cylindrospermopsin	Cylindrospermopsin	0		ug/L					Microbiological	Cyanotoxins
Cymene, p-	p-Cymene	0		ug/L
Cymoxanil	Cymoxanil	57966957		ng/L					Organics	Pesticides	Fungicides
Cypermethrin, Total	Total Cypermethrin, sum peaks 1,2,3 & 4	52315078		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Cypermethrin-1	Cypermethrin peak 1	67375308		ug/L	ng/g dw				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Cypermethrin-13C6(surrogate)	Surrogate: Cypermethrin-13C6	0		% recovery					Organics	Pesticides
Cypermethrin-2	Cypermethrin peak 2	65731842		ug/L	ng/g dw				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Cypermethrin-3	Cypermethrin peak 3	71697591		ug/L					Organics	Pesticides	Pest-Pyrethroids	Insecticides
Cypermethrin-4	Cypermethrin peak 4	52315078		ug/L					Organics	Pesticides	Pest-Pyrethroids	Insecticides
Cyproconazole	Cyproconazole	94361065		ng/L					Organics	Pesticides	Fungicides
Cyprodinil	Cyprodinil	121552612		ug/L					Organics	Pesticides	Fungicides
Dacthal	Dacthal	1861321		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs
Dams	Dams	0	none						Habitat
DBCE(Surrogate)	Surrogate: Dibutylchlorendate	1770805		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides	Pest-OCHs
DCBP(p,p')	p,p'-Dichlorobenzophenone (DCBP)	90982			ug/kg		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OCHs
DDD(o,p')	o,p'-DDD	53190		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	DDTs
DDD(o,p')(Surrogate)	Surrogate: o,p'-DDD	53190		% recovery					Organics	Pesticides	OrganochlorinePest.	Semi-VOAs	Insecticides	DDTs
DDD(p,p')	p,p'-DDD	72548		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	DDTs
DDD(p,p')(Surrogate)	Surrogate: p,p'-DDD	72548		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides	Pest-OCHs	Insecticides	DDTs
DDD-13C(p,p')(Surrogate)	Surrogate: p,p'-DDD-C13	0		% recovery					Organics	Pesticides
DDD-13C12(o,p')(IsoDilAnalogue)	Isotope Dilution Analogue: o,p'-DDD-13C12	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA
DDD-13C12(p,p')(IsoDilAnalogue)	Isotope Dilution Analogue: p,p'-DDD-13C12	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides	IDA
DDE(o,p')	o,p'-DDE	3424826		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	DDTs
DDE(o,p')(Surrogate)	Surrogate: o,p'-DDE	0		% recovery	% recovery		% recovery	% recovery	Organics
DDE(p,p')	p,p'-DDE	72559		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	DDTs
DDE(p,p')(Surrogate)	Surrogate: p,p'-DDE	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides
DDE-13C12(o,p')(IsoDilAnalogue)	Isotope Dilution Analogue: o,p'-DDE-13C12	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides	IDA
DDE-13C12(p,p')(IsoDilAnalogue)	Isotope Dilution Analogue: p,p'-DDE-13C12	201612502		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides	IDA
DDMU(p,p')	p,p'-DDMU	1022226		ug/L	ng/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	DDTs
DDT(o,p')	o,p'-DDT	789026		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	DDTs
DDT(o,p')(Surrogate)	Surrogate: o,p'-DDT	0		% recovery	% recovery		% recovery	% recovery	Organics
DDT(p,p')	p,p'-DDT	50293		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	DDTs
DDT(p,p')(Surrogate)	Surrogate: p,p'-DDT	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides
DDT-13C12(o,p')(IsoDilAnalogue)	Isotope Dilution Analogue: o,p'-DDT-13C12	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides	IDA
DDT-13C12(p,p')(IsoDilAnalogue)	Isotope Dilution Analogue: p,p'-DDT-13C12	104215841		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides	IDA
Dead Domestic Animals	Dead Domestic Animals	0	pieces						Debris	Trash	Non-Plastics	Marine Origin
DebrisLandUse_Commercial	DebrisLandUse_Commercial	0	none						Habitat	Debris
DebrisLandUse_Industrial	DebrisLandUse_Industrial	0	none						Habitat	Debris
DebrisLandUse_LimitedTimeParking	DebrisLandUse_LimitedTimeParking	0	none						Habitat	Debris
DebrisLandUse_OpenSpace	DebrisLandUse_OpenSpace	0	none						Habitat	Debris
DebrisLandUse_Park	DebrisLandUse_Park	0	none						Habitat	Debris
DebrisLandUse_ParkingLot	DebrisLandUse_ParkingLot	0	none						Habitat	Debris
DebrisLandUse_Residential	DebrisLandUse_Residential	0	none						Habitat	Debris
Decachlorobiphenyl(Surrogate)	Surrogate: Decachlorobiphenyl	2051243		% recovery					Organics	PCBs
Decafluorobiphenyl(Surrogate)	Surrogate: Decafluorobiphenyl	434902		% recovery					Organics	PAHs	SVOCs
Dehydronifedipine	Dehydronifedipine	0					ng/g ww	ng/g dw	Organics
Deltamethrin	Deltamethrin	52918635		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Deltamethrin/Tralomethrin	Deltamethrin/Tralomethrin	0		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Deltamethrin-d6, Total(Surrogate)	Surrogate: Total Deltamethrin-d6	0		% recovery					Organics
Demeton, Total	Total Demeton	0		ug/L	ng/g dw				Organics	Pesticides	Pest-Ops
Demeton-O	Demeton-O	0		ug/L					Organics
Demeton-s	Demeton-s	8065483		ug/L	ug/g dw				Organics	Pesticides	Pest-OPs	Insecticides
Density	Density of Sample	0		sigma-t					Habitat
Deposits	Deposits	0	none
Desethyl-Atrazine	Desethyl-Atrazine	6190654		ug/L					Organics	Pesticides	Pest-Triazines
Desethyl-desisopropyl-atrazine	Desethyl-desisopropyl-atrazine	3397624		ug/L					Organics	Pesticides	Pest-Triazines
Desisopropyl-Atrazine	Desisopropyl-Atrazine	1007289		ug/L					Organics	Pesticides	Pest-Triazines
Desmethyl-LR	Desmethyl-LR	120011667		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins
Desmethyl-RR	Desmethyl-RR	0		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins
Desmetryn	Desmetryn	1014693		ug/L					Organics	Pesticides	Pest-Triazines
Desthio-prothioconazole	Desthio-prothioconazole	120983644		ng/L					Organics	Pesticides	Fungicides
Detergent	Detergent	0		mg/L					FieldObservations	Habitat
Deuterium/Hydrogen Ratio	Deuterium/Hydrogen Ratio	7782390		per mil					Isotopes
Diazepam	Diazepam	439145		ng/L					Organics	PPCPs
Diazinon	Diazinon	333415		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OPs
Diazinon oxon	Diazinon oxon	0		ng/L					Organics	Pesticides
Dibenz(a,h)anthracene	Dibenz(a,h)anthracene	53703		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH
Dibenz(a,h)anthracene, C1-	C1-Dibenz(a,h)anthracene	0		ng/L					Organics	PAHs
Dibenz(a,h)anthracene, C2-	C2-Dibenz(a,h)anthracene	0		ng/L					Organics	PAHs
Dibenz(a,h)anthracene, C3-	C3-Dibenz(a,h)anthracene	0		ng/L					Organics	PAHs
Dibenz(a,h)anthracene-d14(IsoDilAnalogue)	Isotope Dilution Analogue: Dibenz(a,h)anthracene-d14	13250981		% recovery					Organics	PAHs	IDA
Dibenz(a,h)anthracene-d14(Surrogate)	Surrogate: Dibenz(a,h)anthracene-d14	53703		% recovery	% recovery		% recovery	% recovery	Organics	PAH
Dibenzofuran	Dibenzofuran	132649		ug/L					Organics	SVOCs	Insecticides
Dibenzothiophene	Dibenzothiophene	132650		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs
Dibenzothiophene-d8(IsoDilAnalogue)	Isotope Dilution Analogue: Dibenzothiophene-d8	33262292		% recovery					Organics	PAHs	IDA
Dibenzothiophene-d8(Surrogate)	Surrogate: Dibenzothiophene-d8	33262292		% recovery	% recovery				Organics	PAHs	SVOCs
Dibenzothiophenes, C1-	C1-Dibenzothiophenes	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs
Dibenzothiophenes, C2-	C2-Dibenzothiophenes	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs
Dibenzothiophenes, C3-	C3-Dibenzothiophenes	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs
Dibenzothiophenes, C4-	C4-Dibenzothiophenes	0		ng/L					Organics	PAHs
Dibromo-3-Chloropropane, 1,2-	1,2-Dibromo-3-Chloropropane (DBCP)	96128		ug/L					Organics	VOCs
Dibromo-4-hydroxybenzonitrile, 3,5-	3,5-Dibromo-4-hydroxybenzonitrile (Bromoxynil)	1689845		ug/L					Organics	SVOCs
Dibromobiphenyl, 4,4'-(Surrogate)	Surrogate: 4,4'-Dibromobiphenyl	92864		% recovery					Organics
Dibromochloromethane	Dibromochloromethane	124481		ug/L					Organics	VOCs
Dibromoethane, 1,2-	1,2-Dibromoethane	106934		ug/L					Organics	VOCs	Insecticides
Dibromofluoromethane(Surrogate)	Surrogate: Dibromofluoromethane	186857		% recovery					Organics	VOCs
Dibromomethane	Dibromomethane	74953		ug/L					Organics	VOCs
Dibromooctafluorobiphenyl, 4,4'-(Surrogate)	Surrogate: 4,4'-Dibromooctafluorobiphenyl (DBOFB)	10386842		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides	Pest-OCHs
Dibromooctafluorobiphenyl, 4,4'-(Surrogate)DB-608	Surrogate: 4,4-Dibromooctafluorobiphenyl run on column DB-608	10386842		% recovery	% recovery				Organics	Pesticides	Pest-OCHs
Dibromooctafluorobiphenyl, 4,4'-(Surrogate)HP-5	Surrogate: 4,4-Dibromooctafluorobiphenyl run on column HP-5	10386842		% recovery	% recovery				Organics	Pesticides	Pest-OCHs
Dibromopropane, 1,2-(Surrogate)	Surrogate: 1,2-Dibromopropane	78751		% recovery					Organics
Dibutylchlorendate(Surrogate)	Surrogate: Dibutylchlorendate (DBCE)	1770805		% recovery	% recovery				Organics	Pesticides	Pest-Pyrethroids
Dibutyltin as Sn	Dibutyltin as Sn (DBT)	683181		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Organotins	Biocide
Dicamba	Dicamba (2,5-Dichloro-6-methoxybenzoic Acid)	1918009		ug/L					Organics	Herbicides
Dichlofenthion	Dichlofenthion	97176		ug/L	ng/g dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides	Nematocides
Dichlofenthion(Surrogate)	Surrogate: Dichlofenthion	97176		% recovery					Organics	Pesticides
Dichlone	Dichlone	117806		ug/L					Organics	Pesticides	Fungicides
Dichloran	Dichloran (Botran) (Benzenamine, 2,6-dichloro-4-nitro-)	99309		ug/L	ug/Kg dw				Organics	Pesticides	Pyrethroid Pesticides
Dichloroacetate(Surrogate)	Surrogate: Dichloroacetate	0		% recovery					Organics
Dichloroaniline, 3,4-	3,4-Dichloroaniline	0		ug/L
Dichloroaniline, 3,5-	3,5-Dichloroaniline	626437		ng/L					Organics	Pesticides
Dichlorobenzenamine, 3,4-	3,4-Dichlorobenzenamine (3,4-DCA)	95761		ug/L					Organics	Pesticides
Dichlorobenzene, 1,2-	1,2-Dichlorobenzene	95501		ug/L	ug/Kg dw				Organics	VOCs	SVOCs	Herbicides
Dichlorobenzene, 1,3-	1,3-Dichlorobenzene	541731		ug/L	ug/Kg dw				Organics	VOCs	SVOCs	Insecticides
Dichlorobenzene, 1,4-	1,4-Dichlorobenzene	106467		ug/L	ug/Kg dw				Organics	VOCs	SVOCs	Insecticides
Dichlorobenzene-13C6,1,4-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,4-Dichlorobenzene-13C6	201595597			% recovery		% recovery	% recovery	Organics		IDA
Dichlorobenzene-d4, 1,2-(Surrogate)	Surrogate: 1,2-Dichlorobenzene-d4	0		% recovery					Organics
Dichlorobenzene-d4, 1,4-(Surrogate)	Surrogate: 1,4-Dichlorobenzene-d4	3855821		% recovery					Organics	VOCs	SVOCs	Insecticides
Dichlorobenzidine, 3,3'-	3,3'-Dichlorobenzidine	0		ug/L					Organics	SVOCs
Dichlorobenzoic Acid, 3,5-	3,5-Dichlorobenzoic Acid	0		ug/L
Dichlorobenzonitrile, 2,6-	2,6-Dichlorobenzonitrile (Dichlobenil)	1194656		ug/L					Organics	Pesticides	Herbicides
Dichlorodifluoromethane	Dichlorodifluoromethane	75718		ug/L					Organics	VOCs
Dichloroethane, 1,1-	1,1-Dichloroethane	75343		ug/L					Organics	VOCs
Dichloroethane, 1,2-	1,2-Dichloroethane	107062		ug/L					Organics	VOCs		Insecticides
Dichloroethane-d4, 1,2-(Surrogate)	Surrogate: 1,2-Dichloroethane-d4	17060070		% recovery					Organics	VOCs
Dichloroethylene, 1,1-	1,1-Dichloroethylene (1,1-Dichloroethene)	75354		ug/L					Organics	VOCs
Dichloroethylene, cis 1,2-	cis-1,2-Dichloroethylene (cis-1,2-Dichloroethene)	156592		ug/L					Organics	VOCs
Dichloroethylene, trans 1,2-	trans-1,2-Dichloroethylene (trans-1,2-Dichloroethene)	156605		ug/L					Organics	VOCs
Dichlorophenol, 2,4-	2,4-Dichlorophenol	120832		ug/L	mg/Kg dw				Organics	SVOCs	Phenols	Chlorinated Phenols
Dichlorophenol, 2,6-	2,6-Dichlorophenol	0		ug/L	mg/Kg dw
Dichlorophenoxyacetic Acid, 2,3-(Surrogate)	Surrogate: 2,3-Dichlorophenoxyacetic Acid (2,3-D)	2976741		% recovery					Organics
Dichlorophenoxyacetic Acid, 2,4-	2,4-Dichlorophenoxyacetic Acid (2,4-D)	94757		ug/L					Organics	Herbicides
Dichlorophenoxybutyric Acid Methyl Ester, 2,4-	2,4-Dichlorophenoxybutyric Acid Methyl Ester (2,4-DB Methyl Ester)	0		ug/L					Organics	Herbicides
Dichlorophenoxybutyric Acid, 2,4-	2,4-Dichlorophenoxybutyric Acid (2,4-DB)	94826		ug/L					Organics	Herbicides
Dichlorophenyl Urea, 3,4-	3,4-Dichlorophenyl Urea (DCPU)	2327028		ug/L					Organics	Pesticides
Dichlorophenyl-3-methyl Urea, 3,4-	3,4-Dichlorophenyl-3-methyl Urea (DCPMU)	3567622		ug/L					Organics	Pesticides
Dichlorophenylacetic Acid, 2,4- (Surrogate)	Surrogate: 2,4-Dichlorophenylacetic Acid	19719289		% recovery					Organics	Herbicides
Dichloroprop	Dichlorprop (2-(2,4-Dichlorophenoxy)propanoic Acid)	120365		ug/L					Organics	Herbicides
Dichloropropane, 1,2-	1,2-Dichloropropane	78875		ug/L					Organics	VOCs	Insecticides	Nematocides
Dichloropropane, 1,3-	1,3-Dichloropropane	142289		ug/L					Organics	VOCs
Dichloropropane, 2,2-	2,2-Dichloropropane	594207		ug/L					Organics	VOCs
Dichloropropene, 1,1-	1,1-Dichloropropene	563586		ug/L					Organics	VOCs
Dichloropropene, 1,3-	1,3-Dichloropropene	0		ug/L
Dichloropropene, cis 1,3-	cis-1,3-Dichloropropene	10061015		ug/L					Organics	VOCs
Dichloropropene, Total 1,3-	Total 1,3-Dichloropropene	0		ug/L					Organics	VOCs
Dichloropropene, trans 1,3-	trans-1,3-Dichloropropene	10061026		ug/L					Organics	VOCs
Dichloropropionic Acid, 2,2-	2,2-Dichloropropionic Acid (Dalapon)	75990		ug/L					Organics	Herbicides
Dichloro-pyridine-2-carboxylic Acid, 3,6-	3,6-Dichloro-pyridine-2-carboxylic Acid (Clopyralid)	1702176		ug/L					Organics	Herbicides
Dichlorvos	Dichlorvos	62737		ug/L	ug/g dw				Organics	Pesticides	Pest-OPs	Insecticides
Diclofenac	Diclofenac (2-(2-(2,6-Dichlorophenylamino)phenyl)acetic Acid)	0		ng/L
Dicofol	Dicofol	115322		ug/L	ug/Kg dw				Organics	Pesticides	Pest-OCHs
Dicrotophos	Dicrotophos	141662		ug/L					Organics	Pesticides	Pest-OPs	Insecticides
Dieldrin	Dieldrin	60571		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Endocrine Disruptors
Dieldrin(Surrogate)	Surrogate: Dieldrin	0		% recovery	% recovery		% recovery	% recovery	Organics
Dieldrin-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Dieldrin-13C12	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides	IDA
Diesel Fuel	Diesel Fuel	0		ug/L					Organics
Diethatyl-Ethyl	Diethatyl-Ethyl	38727558		ug/L	ng/g dw				Organics	Pesticides	Herbicides
Diethyl phthalate	Diethyl phthalate	84662		ug/L	ug/kg				Organics	SVOCs
Diethyl-3-methyl-benzamide, N,N-	N,N-Diethyl-3-methyl-benzamide	134623		ng/L					Organics	PPCPs
Difenoconazole	Difenoconazole	119446683		ng/L					Organics	Pesticides	Fungicides
Diflubenzuron	Diflubenzuron (Difluron)	35367385		ug/L					Organics	Pesticides
Difluoro-2,2',3,4,4'-Pentabromodiphenyl Ether, 5,6-(Surrogate)	Surrogate: 5,6-Difluoro-2,2',3,4,4'-Pentabromodiphenyl Ether	886748330			% recovery				Organics	PBDEs
Difluoro-2,2,3,3,4,5,5,6-Octabromodiphenyl Ether 4,6-(Surrogate)	Surrogate: 4,6-Difluoro-2,2,3,3,4,5,5,6-Octabromodiphenyl Ether	0			% recovery				Organics	PBDEs
Digoxigenin	Digoxigenin	0					ng/g ww	ng/g dw	Organics
Digoxin	Digoxin	0					ng/g ww	ng/g dw	Organics
Diisopropyl Ether	Diisopropyl Ether	108203		ug/L					Organics	SVOCs
Diltiazem	Diltiazem	0					ng/g ww	ng/g dw	Organics
Dimethoate	Dimethoate	60515		ug/L	ng/g dw				Organics	Pesticides	Pest-OPs	Insecticides	Nematocides
Dimethomorph	Dimethomorph	110488705		ng/L					Organics	Pesticides	Fungicides
Dimethyl Phthalate	Dimethyl Phthalate	131113		ug/L	ug/kg				Organics	SVOCs
Dimethyl-2-nitrobenzene, 1,3-	1,3-Dimethyl-2-nitrobenzene	0		ug/L					Organics
Dimethyl-2-nitrobenzene, 1,3-(Surrogate)	Surrogate: 1,3-Dimethyl-2-nitrobenzene (2,6-Dimethylnitrobenzene)	81209		ug/L					Organics	VOCs
Dimethylchrysene, 5,9-	5,9-Dimethylchrysene	0		ng/L					Organics	PAHs
Dimethyldibenzothiophene, 2,4-	2,4-Dimethyldibenzothiophene	0		ng/L					Organics	PAHs
Dimethyldibenzothiophene, 4,6-	4,6-Dimethyldibenzothiophene	1207121		ng/L					Organics	PAHs
Dimethylfluorene, 1,7-	1,7-Dimethylfluorene	442660		ng/L					Organics	PAHs
Dimethylnaphthalene, 1,2-	1,2-Dimethylnaphthalene	0		ng/L					Organics	SVOCs
Dimethylnaphthalene, 2,6-	2,6-Dimethylnaphthalene	581420		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH
Dimethylnaphthalene, 2,6-(Surrogate)	Surrogate: 2,6-Dimethylnaphthalene	0		% recovery	% recovery		% recovery	% recovery	Organics
Dimethylnaphthalene-d12, 2,6-(IsoDilAnalogue)	Isotope Dilution Analogue: 2,6-Dimethylnaphthalene-d12	350820121		% recovery					Organics	PAHs	IDA
Dimethylnaphthalene-d12, 2,6-(Surrogate)	Surrogate: 2,6-Dimethylnaphthalene-d12	581420		% recovery			% recovery	% recovery	Organics
Dimethylphenanthrene, 1,5/1,7-	1,5-Dimethylphenanthrene/1,7-Dimethylphenanthrene	0		ng/L					Organics	PAHs
Dimethylphenanthrene, 1,7-	1,7-Dimethylphenanthrene	483874		ng/L					Organics	PAHs
Dimethylphenanthrene, 1,8-	1,8-Dimethylphenanthrene	7372874		ng/L					Organics	PAHs
Dimethylphenanthrene, 2,6-	2,6-Dimethylphenanthrene	0		ng/L					Organics	PAHs
Dimethylphenanthrene, 3,6-	3,6-Dimethylphenanthrene	1576676		ug/L	ng/g dw		ng/g ww	ng/g dw	Organics	PAHs	SVOCs	LMW_PAH
Dimethylphenol, 2,4-	2,4-Dimethylphenol	105679		ug/L	mg/Kg dw				Organics	SVOCs	Phenols	non-Chlorinated Phenols
Dimethylxanthine, 1,7-	Dimethylxanthine, 1,7-	0					ng/g ww	ng/g dw	Organics
Di-n-butyl Phthalate	Di-n-butyl Phthalate	84742		ug/L	ug/kg				Organics	SVOCs	Endocrine Disruptors
Dinitro-2-methylphenol, 4,6-	4,6-Dinitro-2-methylphenol	534521		ug/L	mg/Kg dw				Organics	SVOCs	Phenols	non-Chlorinated Phenols	Nitrophenols
Dinitrophenol, 2,4-	2,4-Dinitrophenol	51285		ug/L	mg/Kg dw				Organics	SVOCs	Phenols	non-Chlorinated Phenols	Nitrophenols
Dinitrotoluene, 2,4-	2,4-Dinitrotoluene	121142		ug/L	ug/kg				Organics	SVOCs
Dinitrotoluene, 2,6-	2,6-Dinitrotoluene	606202		ug/L	ug/kg				Organics	SVOCs
Di-n-octyl Phthalate	Di-n-octyl Phthalate	117840		ug/L	ug/kg				Organics	SVOCs
Dinoseb	Dinoseb (2,4-Dinitro-6-sec-butylphenol)	88857		ug/L					Organics	Herbicides
Dinotefuran	Dinotefuran	165252700		ug/L	ng/g dw				Organics	Pesticides	Insecticides
Dioxa-3H-Perfluorononanoate Acid, 4,8-	4,8-Dioxa-3H-Perfluorononanote Acid (ADONA)	919005144		ng/L	ng/g dw		ng/g ww	ng/g dw
Dioxane, 1,4-	1,4-Dioxane	0		ug/L
Dioxathion	Dioxathion	87342		ug/L	ng/g dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides
Diphenamid	Diphenamid	957517		ug/L					Organics	Pesticides	Herbicides
Diphenamid(Surrogate)	Surrogate: Diphenamid	957517		% recovery					Organics	Pesticides
Diphenhydramine	Diphenhydramine	0					ng/g ww	ng/g dw	Organics
Diphenylamine	Diphenylamine	122394		ug/L					Organics	Pesticides
Diphenylhydrazine, 1,2-	1,2-Diphenylhydrazine	0		ug/L					Organics
Dipropetryn	Dipropetryn	4147517		ug/L					Organics	Pesticides	Pest-Triazines
Diquat	Diquat	7440620		ug/L					Organics	Pesticides
Discharge	Discharge from a calculation	0		ft/s					WaterQualityMeasurements
DischargeMeasurementMethod	Method used to collect discharge (velocity) measurement	0	none						WaterQualityMeasurements
DischargeMeasurementRating	Code qualifying the stream discharge measurement quality in relation to the actual flow	0	none						WaterQualityMeasurements
Dissolved Inorganic Carbon	Dissolved Inorganic Carbon (DIC)	0		mg/L					Inorganics	Conventionals
Dissolved Organic Carbon	Dissolved Organic Carbon (DOC)	0		mg/L					Inorganics	Conventionals
Distance from Bank	Distance from Bank	0	m						Habitat
Distance to Bankfull	Distance from the wetted edge to the Bankfull mark	0	m						Habitat
Distance, Float	Float distance of observed object	0	m						Habitat
Distance, Sampled	Distance sampled within a given waterbody	0	m						Habitat
Disulfoton	Disulfoton	298044		ug/L	ug/g dw				Organics	Pesticides	Pest-OPs	Insecticides
Dithiopyr	Dithiopyr	97886458		ng/L					Organics	Pesticides	Herbicides
Diuron	Diuron	330541		ug/L					Organics	Pesticides	Pest-Carbamates	Herbicides
Diuron-d6(Surrogate)	Surrogate: Diuron-d6	1007536675		% recovery					Organics	Pesticides	Pest-Carbamates	Herbicides
Docosahexaenoic Acid	Docosahexaenoic Acid	6217545					mg/100g ww	mg/100g dw	Organics	Omega Fatty Acid
Docosapentaenoic Acid	Docosapentaenoic Acid	0					mg/100g ww	mg/100g dw	Organics	Omega Fatty Acid
Dodine	Dodine	2439103		ug/L					Organics	Pesticides	Fungicides
Dog_DG37	Dog_DG37	0		copies/100 mL					Microbiological
Dominant Benthic Substrate	Dominant Benthic Substrate - Specific to EMAP BA	0	none						Habitat
Dominant Land Use	Dominant Land Use	0	none						Habitat
DominantSubstrate	DominantSubstrate	0	none						FieldObservations	Habitat
Domoic Acid	Domoic Acid	14277975		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins
Doxycycline	Doxycycline	564250		ug/L					Organics	PPCPs
Dredging	Dredging	0	none						Habitat
Dry	Dry	0	none						Habitat
Dry Weight	Dry Weight	0			%				Tissue
Dumping	Dumping using Trash Protocol	0	score						Trash
E. coli	Escherichia coli	0		MPN/100 mL	MPN/g dw				Microbiological	Pathogens	Conventional
E. Coli O157:H7	Escherichia Coli O157:H7 strain	0		none					Microbiological	Pathogens	Conventional
Eicosapentaenoate	Eicosapentaenoate	0					mg/100g ww	mg/100g dw	Organics	Omega Fatty Acid
ElectricalConductivity	Electrical Conductivity	0		uS/cm					WaterQualityMeasurements	Conventionals
Elevation Difference	Elevation Difference	0	cm						Habitat
Embeddedness	Embeddedness	0	%						Habitat
End Time	Time (hh:mm) when a given event ended	0	none						Habitat
Endosulfan I	Endosulfan I (alpha-Endosulfan)	959988		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Endosulfans
Endosulfan I(Surrogate)	Surrogate: Endosulfan I (alpha-Endosulfan)	0		% recovery	% recovery		% recovery	% recovery	Organics
Endosulfan I-13C9(IsoDilAnalogue)	Isotope Dilution Analogue: Endosulfan I-13C9	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides	IDA
Endosulfan I-d4(Surrogate)	Surrogate: Endosulfan I-d4	0		% recovery					Organics	Pesticides
Endosulfan II	Endosulfan II (beta-Endosulfan)	33213659		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Endosulfans
Endosulfan II(Surrogate)	Surrogate: Endosulfan II (beta-Endosulfan)	0		% recovery	% recovery		% recovery	% recovery	Organics
Endosulfan II-13C9(IsoDilAnalogue)	Isotope Dilution Analogue: Endosulfan II-13C9	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides	IDA
Endosulfan II-d4(Surrogate)	Surrogate: Endosulfan II-d4	0		% recovery					Organics	Pesticides
Endosulfan Sulfate	Endosulfan Sulfate	1031078		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Endosulfans
Endosulfan Sulfate-13C9(IsoDilAnalogue)	Isotope Dilution Analogue: Endosulfan Sulfate-13C9	0			% recovery						IDA
Endrin	Endrin	72208		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Endrins
Endrin Aldehyde	Endrin Aldehyde	7421934		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Endrins
Endrin Aldehyde(Surrogate)	Surrogate: Endrin Aldehyde	0			% recovery				Organics
Endrin Aldehyde-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Endrin Aldehyde-13C12	0			% recovery				Organics	Pesticides	IDA
Endrin Ketone	Endrin Ketone	53494705		ug/L	ug/Kg ww		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OCHs	Insecticides	Endrins
Endrin Ketone-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Endrin Ketone-13C12	53494705			% recovery				Organics	Pesticides	IDA
Endrin(Surrogate)	Surrogate: Endrin	0		% recovery	% recovery		% recovery	% recovery	Organics
Endrin-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Endrin-13C12	72208		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides	IDA
Enrofloxacin	Enrofloxacin	0					ng/g ww	ng/g dw	Organics
Enterococcus	Enterococcus	0		TSC/100mL	MPN/g dw		MPN/g ww	MPN/g dw	Microbiological	Pathogens	Conventional
Enterovirus	Enterovirus	0		copies/100 mL					Microbiological
EPN	EPN	2104645		ug/L					Organics	Pesticides	Pest-OPs	Insecticides
EPN(Surrogate)	Surrogate: EPN	2104645		% recovery					Organics	Pesticides	OrganophosphatePest.	Semi-VOAs	Insecticides	Endrins
EPTC	EPTC	759944		ug/L	ng/g dw				Organics	Pesticides	Herbicides
EPTC(Surrogate)	Surrogate: EPTC	759944		% recovery					Organics	Pesticides	Herbicides
Erythromycin-H2O	Erythromycin-H2O	0		ug/L			ng/g ww	ng/g dw	Organics	PPCPs
Erythromycin-H2O-13C2(Surrogate)	Surrogate: Erythromycin-H2O-13C2	0					% recovery	% recovery	Organics
Esfenvalerate	Esfenvalerate	66230044		ug/L	ug/Kg dw				Organics
Esfenvalerate/Fenvalerate, Total	Total Esfenvalerate/Fenvalerate, sum peaks 1 & 2	51630581		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Esfenvalerate/Fenvalerate-1	Esfenvalerate/Fenvalerate peak 1	51630581		ug/L	ng/g dw				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Esfenvalerate/Fenvalerate-2	Esfenvalerate/Fenvalerate peak 2	66230404		ug/L	ng/g dw				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Esfenvalerate-d6, Total(Surrogate)	Surrogate: Total Esfenvalerate-d6, sum peaks 1 & 2	0		% recovery	% recovery				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Esfenvalerate-d6-1(Surrogate)	Surrogate: Esfenvalerate-d6 peak 1	0		% recovery	% recovery				Organics	Pesticides	Insecticides	Pyrethoids
Esfenvalerate-d6-2(Surrogate)	Surrogate: Esfenvalerate-d6 peak 2	0		% recovery	% recovery				Organics	Pesticides	Insecticides	Pyrethoids
Estradiol, 17beta-	17beta-Estradiol	50282		ug/L					Organics	PPCPs
Estradiol-d3, 17beta-(IsoDilAnalogue)	Isotope Dilution Analogue: 17beta-Estradiol-d3	79037379		% recovery					Organics		IDA
Estrone	Estrone	0		ng/L
Ethaboxam	Ethaboxam	162650773		ng/L					Organics	Pesticides	Fungicides
Ethafluralin	Ethafluralin	55283686		ug/L					Organics	Pesticides	Herbicides
Ethalfluralin	Ethalfluralin	55283686		ug/L	ng/g dw				Organics	Pesticides	Herbicides
Ethion	Ethion	563122		ug/L	ng/g dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides
Ethion(Surrogate)	Surrogate: Ethion	563122		% recovery					Organics	Pesticides	OrganophosphatePest.	OrganochlorinePest.	Semi-VOAs	Insecticides
Ethofenprox	Ethofenprox	80844071		ug/L					Organics	PPCPs
Ethoprop	Ethoprop (Prophos)	13194484		ug/L	ug/g dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides	Nematocides
Ethyl Ether	Ethyl Ether	60297		ug/L					Organics	VOCs
Ethyl Perfluorooctane Sulfonamido Acetic Acid, N-	N-Ethyl Perfluorooctane Sulfonamido Acetic Acid (Et-PFOSA-AcOH)	0		ng/L	ng/g dw		ng/g ww	ng/g dw
Ethyl Perfluorooctane Sulfonamido Acetic Acid-d5, N-(IsoDilAnalogue)	Isotope Dilution Analogue: N-Ethyl Perfluorooctane Sulfonamido Acetic Acid-d5 (N-EtFOSAA)	0		% recovery	% recovery		% recovery	% recovery	Organics		IDA
Ethyl Perfluorooctane Sulfonamido Acetic Acid-d5, N-(Surrogate)	Surrogate: N-Ethyl Perfluorooctane Sulfonamido Acetic Acid-d5	0					% recovery	% recovery	Organics	PFAS	PFC Precursor
Ethyl Tert-butyl Ether	Ethyl Tert-butyl Ether (ETBE)	637923		ug/L					Organics	VOCs
Ethylbenzene	Ethylbenzene	100414		ug/L					Organics	VOCs	MTBE_BTEX
Ethylene Glycol	Ethylene Glycol	0		mg/L
Ethyl-perfluorooctanesulfonamide, N-	N-Ethyl-perfluorooctanesulfonamide	0		ng/L	ng/g dw		ng/g ww	ng/g dw
Ethyl-perfluorooctanesulfonamide-d5, N-(IsoDilAnalogue)	Isotope Dilution Analogue: N-Ethyl-perfluorooctanesulfonamide-d5 (N-EtFOSA)	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAs	IDA
Ethyl-perfluorooctanesulfonamide-d5, N-(Surrogate)	Surrogate: Ethyl-perfluorooctanesulfonamide-d5, N- (N-EtFOSA)	0					% recovery	% recovery	Organics	PFAS
Ethyl-perfluorooctanesulfonamidoethanol, N-	N-Ethyl-perfluorooctanesulfonamidoethanol	0		ng/L	ng/g dw		ng/g ww	ng/g dw
Ethyl-perfluorooctanesulfonamidoethanol-d9, N-(IsoDilAnalogue)	Isotope Dilution Analogue: N-Ethyl-perfluorooctanesulfonamidoethanol-d9 (N-EtFOSE)	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAs	IDA
Ethyl-perfluorooctanesulfonamidoethanol-d9, N-(Surrogate)	Surrogate: Ethyl-perfluorooctanesulfonamidoethanol-d9, N- (N-EtFOSE)	0					% recovery	% recovery	Organics	PFAS
Ethynylestradiol, 17alpha-	17alpha-Ethynylestradiol	0		ng/L
Ethynylestradiol-d4, 17alpha-(IsoDilAnalogue)	Isotope Dilution Analogue: 17alpha-Ethynylestradiol-d4	350820063		% recovery					Organics		IDA
Ev_FlowHab	Evenness of flow habitat types physical-habitat metric	0	none						Bioassessment
Evidence of Fire	Evidence of Fire	0	none						Habitat
Evidence of Fire Intensity	Evidence of Fire Intensity - Specific to EMAP BA	0	none						Habitat
Evidence of Illegal Connection	Evidence of Illegal Connection	0	none
Evidence of Illegal Dumping	Evidence of Illegal Dumping	0	none
Evidence of Recent Rainfall	Evidence of Recent Rainfall	0	none						Habitat
Evidence of Scour	Site is affected by recent scouring event	0	none						Habitat	FieldObservations
E-waste	E-waste	0	pieces						Debris	Trash	Plastics	Toxic
Fabric	Fabric	0	pieces						Debris	Trash	Non-Plastics	Biodegradable
Famoxadone	Famoxadone	131807573		ng/L					Organics	Pesticides	Fungicides
Famphur	Famphur	52857		ug/L					Organics	Pesticides	Pest-OPs	Insecticides
FBDE 069	Fluorobrominated Diphenyl Ether (FBDE) 069 (4'-Fluoro-2,3',4,6-tetrabromodiphenyl ether)	863314878			ng/Kg dw		ug/Kg ww	ug/Kg dw	Organics
FBDE 160	Fluorobrominated Diphenyl Ether (FBDE) 160 (4'-Fluoro-2,3,3',4,5,6-hexabromodiphenyl ether)	863314889			ng/Kg dw		ug/Kg ww	ug/Kg dw	Organics
Fenamidone	Fenamidone	161326347		ng/L					Organics	Pesticides	Fungicides
Fenamiphos	Fenamiphos (Phosphoramidic acid, Isopropyl-, 4-(methylthio)-m-tolyl Ethyl Ester)	22224926		ug/L					Organics	Pesticides	Pest-Ops	Insecticides
Fenarimol	Fenarimol	60168889		ng/L					Organics	Pesticides	Fungicides
Fenbuconazole	Fenbuconazole	114369436		ng/L					Organics	Pesticides	Fungicides
Fenchlorphos	Fenchlorphos (Ronnel)	299843		ug/L	ug/g dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides
Fenhexamid	Fenhexamid	126833178		ng/L					Organics	Pesticides	Fungicides
Fenitrothion	Fenitrothion	122145		ug/L	ng/g dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides
Fenpropathrin	Fenpropathrin (Danitol)	39515418		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Fenpropathrin-d6(Surrogate)	Surrogate: Fenpropathrin-d6	0			% recovery				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Fenpyroximate	Fenpyroximate	134098616		ng/L					Organics	Pesticides	Insecticides
Fensulfothion	Fensulfothion	115902		ug/L	ug/g dw				Organics	Pesticides	Pest-OPs	Insecticides	Nematocides
Fenthion	Fenthion (Mercaptophos)	55389		ug/L	ug/g dw				Organics	Pesticides	Pest-OPs	Insecticides
Fenuron	Fenuron	101428		ug/L					Organics	Pesticides	Herbicides
Fenvalerate	Fenvalerate	51630581		ug/L	ug/Kg dw				Organics
Fenvalerate-d5(Surrogate)	Surrogate: Fenvalerate-d5	0		% recovery	% recovery				Organics
Fertilization	Fertilization (%)	0				%			Toxicity
Filling Time	Time to fill a collection device with water	0	seconds						Habitat
Fine	Fine	0			%				Inorganics	Conventionals	GrainSize
Fipronil	Fipronil	120068373		ug/L	ng/g dw				Organics	Pesticides	Insecticides
Fipronil Amide	Fipronil Amide	0		ug/L	ng/g dw				Organics	Pesticides	Insecticides
Fipronil Desulfinyl	Fipronil Desulfinyl	205650653		ug/L	ng/g dw				Organics	Pesticides	Insecticides
Fipronil Desulfinyl Amide	Fipronil Desulfinyl Amide	1115248093		ug/L	ng/g dw				Organics	Pesticides	Insecticides
Fipronil Sulfide	Fipronil Sulfide	120067836		ug/L	ng/g dw				Organics	Pesticides	Insecticides
Fipronil Sulfone	Fipronil Sulfone	120068362		ug/L	ng/g dw				Organics	Pesticides	Insecticides
Fipronil-13C4 15N2(Surrogate)	Surrogate: Fipronil-13C4 15N2	0		% recovery
Fipronil-C13(Surrogate)	Surrogate: Fipronil-C13	0		% recovery					Organics	Pesticides
Fireworks	Fireworks	0	pieces						Debris	Trash	Non-Plastics	Toxic
Fish Cover Artificial Structures	Fish Cover/Instream Habitat Complexity Other Artificial Structures	0	none						Habitat
Fish Cover Boulders	Fish Cover/Instream Habitat Complexity Other Boulders	0	none						Habitat
Fish Cover Filamentous Algae	Fish Cover/Instream Habitat Complexity - Other Filamentous Algae	0	none						Habitat
Fish Cover Live Trees/Roots	Fish Cover/Instream Habitat Complexity Other Live Trees or Roots	0	none						Habitat
Fish Cover Macrophytes	Fish Cover/Instream Habitat Complexity - Macrophytes	0	none						Habitat
Fish Cover Overhang.Veg	Fish Cover/Instream Habitat Complexity Other Overhanging Vegetation =<1 m of surface	0	none						Habitat
Fish Cover Undercut Banks	Fish Cover/Instream Habitat Complexity Other Undercut Banks	0	none						Habitat
Fish Cover Woody Debris <0.3 m	Fish Cover/Instream Habitat Complexity Other Woody Debris <0.3 m	0	none						Habitat
Fish Cover Woody Debris >0.3 m	Fish Cover/Instream Habitat Complexity Other Woody Debris >0.3 m	0	none						Habitat
Fish Stocking	Fish Stocking	0	none						Habitat
Fishing Line/Net	Fishing Line/Net	0	pieces						Debris	Trash	Plastics	Miscellaneous
Float Time	Float time of observed object	0	seconds						Habitat
Floatables	Floatables	0	none						Habitat
Flonicamid	Flonicamid	158062670		ng/L					Organics	Pesticides	Insecticides
Fluazinam	Fluazinam	79622596		ng/L					Organics	Pesticides	Fungicides
Flucythrinate	Flucythrinate	0		ng/L					Organics
Fludioxonil	Fludioxonil	131341861		ng/L					Organics	Pesticides	Fungicides
Flufenacet	Flufenacet	142459583		ng/L					Organics	Pesticides	Herbicides
Flumequine	Flumequine	0					ng/g ww	ng/g dw	Organics
Flumetralin	Flumetralin	62924703		ng/L					Organics	Pesticides	Herbicides
Flumetsulam	Flumetsulam	98967409		ug/L					Organics	Herbicides
Flumioxazin	Flumioxazin	103361097		ug/L					Organics	Pesticides
Fluometuron	Fluometuron	2164172		ug/L					Organics	Pesticides	Herbicides
Fluopicolide	Fluopicolide	239110157		ng/L					Organics	Pesticides	Fungicides
Fluopyram	Fluopyram	658066354		ng/L					Organics	Pesticides	Fungicides
Fluoranthene	Fluoranthene	206440		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH
Fluoranthene/Pyrenes, C1-	C1-Fluoranthene/Pyrenes	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH
Fluoranthene-d10(IsoDilAnalogue)	Isotope Dilution Analogue: Fluoranthene-d10	93951690		% recovery					Organics	PAHs	IDA
Fluoranthene-d10(Surrogate)	Surrogate: Fluoranthene-d10	206440		% recovery	% recovery		% recovery	% recovery	Organics	PAH
Fluoranthenes/Pyrenes, C2-	C2-Fluoranthenes/Pyrenes	0		ng/L					Organics	PAHs
Fluoranthenes/Pyrenes, C3-	C3-Fluoranthenes/Pyrenes	0		ng/L					Organics	PAHs
Fluoranthenes/Pyrenes, C4-	C4-Fluoranthenes/Pyrenes	0		ng/L					Organics	PAHs
Fluorene	Fluorene	86737		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH
Fluorenes, C1-	C1-Fluorenes	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH
Fluorenes, C2-	C2-Fluorenes	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH
Fluorenes, C3-	C3-Fluorenes	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH
Fluorescence	Fluorescence	0		none					WaterQualityMeasurements
Fluoride	Fluoride	16984488		mg/L					Inorganics	Conventionals
Fluoro-2,3',6-Tribromodiphenyl Ether, 4'-(Surrogate)	Surrogate: 4'-Fluoro-2,3',6-tribromodiphenyl Ether	863314867			% recovery				Organics	PBDEs
Fluorobiphenyl, 2-	2-Fluorobiphenyl	0		ug/L			ng/g ww	ng/g dw
Fluorobiphenyl, 2-(Surrogate)	Surrogate: 2-Fluorobiphenyl	321608		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs
Fluorophenol, 2-	2-Fluorophenol	0		ug/L
Fluorophenol, 2-(Surrogate)	Surrogate: 2-Fluorophenol	367124		ug/L					Organics	SVOCs	Phenols	non-Chlorinated Phenols
Fluorotelomer Carboxylic Acid, 3:3-	3:3 Fluorotelomer carboxylic acid (2H, 2H, 3H, 3H-perfluorohexanoic acid) (3:3 FTCA)	356025		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS
Fluorotelomer Carboxylic Acid, 5:3-	5:3 Fluorotelomer carboxylic acid (2H, 2H, 3H, 3H-perfluorooctanoic acid) (5:3 FTCA)	0		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS
Fluorotelomer Carboxylic Acid, 7:3-	7:3 Fluorotelomer carboxylic acid (2H, 2H, 3H, 3H-perfluorodecanoic acid) (7:3 FTCA)	812704		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS
Fluorotelomer Sulfonate, 4:2-	4:2-Fluorotelomer Sulfonate (4:2 FTS)	757124724		ng/L	ng/g dw		ng/g ww	ng/g dw
Fluorotelomer Sulfonate, 6:2-	6:2-Fluorotelomer Sulfonate (6:2 FTS)	27619972		ng/L	ng/g dw		ng/g ww	ng/g dw
Fluorotelomer Sulfonate, 8:2-	8:2-Fluorotelomer Sulfonate (8:2 FTS)	39108344		ng/L	ng/g dw		ng/g ww	ng/g dw
Fluorotelomer Sulfonate-13C, 6:2-(Surrogate)	Surrogate: 6:2-Fluorotelomer Sulfonate-13C	0					% recovery	% recovery	Organics	PFAS	PFC Precursor
Fluorotelomer Sulfonate-13C2, 4:2-(IsoDilAnalogue)	Isotope Dilution Analogue: 4:2-Fluorotelomer Sulfonate-13C2 (4:2 FTS)	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAs	IDA
Fluorotelomer Sulfonate-13C2, 4:2-(Surrogate)	Surrogate: Fluorotelomer Sulfonate-13C2, 4:2- (4:2 FTS)	0					% recovery	% recovery	Organics	PFAS
Fluorotelomer Sulfonate-13C2, 6:2-(IsoDilAnalogue)	Isotope Dilution Analogue: 6:2-Fluorotelomer Sulfonate-13C2 (6:2 FTS)	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAs	IDA
Fluorotelomer Sulfonate-13C2, 8:2-(IsoDilAnalogue)	Isotope Dilution Analogue: 8:2-Fluorotelomer Sulfonate-13C2 (8:2 FTS)	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAs	IDA
Fluorotelomer Sulfonate-13C2, 8:2-(Surrogate)	Surrogate: Fluorotelomer Sulfonate-13C2, 8:2- (8:2 FTS)	0					% recovery	% recovery	Organics	PFAS
Fluoxastrobin	Fluoxastrobin	193740760		ng/L					Organics	Pesticides	Fungicides
Fluoxetine	Fluoxetine	54910893		ug/L			ng/g ww	ng/g dw	Organics	PPCPs
Fluoxetine-d5(Surrogate)	Surrogate: Fluoxetine-d5	0					% recovery	% recovery	Organics
Fluridone	Fluridone	59756604		ug/L					Organics	Pesticides	Herbicides
Fluridone(Surrogate)	Surrogate: Fluridone	59756604		% recovery	% recovery				Organics	Pesticides	Pest-Pyrethroids
Flusilazole	Flusilazole	85509199		ng/L					Organics	Pesticides	Fungicides
Flutolanil	Flutolanil	66332965		ug/L					Organics	Fungicides
Flutriafol	Flutriafol	76674210		ng/L					Organics	Pesticides	Fungicides
Fluvalinate	Fluvalinate	0		ug/L	ug/Kg dw				Organics	Pesticides
Fluxapyroxad	Fluxapyroxad	907204313		ng/L					Organics	Pesticides	Fungicides
Foam Ball	Foam Ball	0	pieces						Debris	Trash	Plastics	Miscellaneous
Foliose Algae	Foliose Algae	0	pieces						Debris	Trash	Non-Plastics	Marine Origin
Folpet	Folpet	133073		ug/L					Organics	Pesticides	Fungicides
Fonofos	Fonofos (Dyfonate)	944229		ug/L	ng/g dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides
Food Service	Food Service	0	L						Debris	Trash	Plastics
Food Service, Other	Food Service, Other	0	pieces						Debris	Trash	Plastics	FoodService
Forest Dominant Age Class	Forest Dominant Age Class	0	none						Habitat
Formate(Surrogate)	Surrogate: Formate	0		% recovery					Organics
Furniture	Furniture	0	pieces						Debris	Trash	Plastics	Non-Plastics	Household	Large
Gage Height	Water surface level measured against a staff gage within a given waterbody	0		ft					Habitat
Galaxolide	Galaxolide	1222055		ng/L
Galaxolide-d6(Surrogate)	Surrogate: Galaxolide-d6	507442491		% recovery					Organics	PPCPs
Garbage Bag of Trash	Garbage Bag of Trash	0	pieces						Debris	Trash	Non-Plastics	Large
Gasoline	Gasoline	0		ug/L
Gemfibrozil	Gemfibrozil	25812300		ug/L					Organics	PPCPs
Gemfibrozil-d6(IsoDilAnalogue)	Isotope Dilution Analogue: Gemfibrozil-d6	1184986455		% recovery					Organics		IDA
Gemfibrozil-d6(Surrogate)	Surrogate: Gemfibrozil-d6	25812300		% recovery					Organics	PPCPs
Germination	Germination (%)	0				%			Toxicity
Giardia	Giardia	0		oocysts/L					Microbiological	Pathogens	Conventional
Glass Servicewear	Glass Servicewear	0	pieces						Debris	Trash	Non-Plastics	Household
Glass Shard	Glass Shard	0	pieces						Debris	Trash	Non-Plastics	Household
Glide	Glide	0	%						Habitat
Glide/Pool Bank Stability	Glide/Pool Bank Stability (used for EMAP RBP 20-score habitat characterization)	0	none						Habitat
Glide/Pool Channel Alteration	Glide/Pool Channel Alteration	0	none						Habitat
Glide/Pool Channel Flow Status	Glide/Pool Channel Flow Status	0	none						Habitat
Glide/Pool Channel Sinuosity	Glide/Pool Channel Sinuosity	0	none						Habitat
Glide/Pool Epifaunal Substrate	Glide/Pool Epifaunal Substrate	0	none						Habitat
Glide/Pool Pool Substrate	Glide/Pool Pool Substrate	0	none						Habitat
Glide/Pool Pool Variability	Glide/Pool Pool Variability	0	none						Habitat
Glide/Pool Riparian Zone Width	Glide/Pool Riparian Zone Width	0	none						Habitat
Glide/Pool Sediment Deposition	Glide/Pool Sediment Deposition	0	none						Habitat
Glide/Pool Vegetative Protection	Glide/Pool Vegetative Protection	0	none						Habitat
Glyphosate	Glyphosate	1071836		ug/L					Organics	Pesticides	Herbicides
Granule	Granule	0		%	%				Inorganics	Conventionals	GrainSize
Granule + Pebble	Granule + Pebble	0			%				Inorganics	Conventionals	GrainSize
Gravel	Gravel	0			%				Inorganics	Conventionals	GrainSize
Grazing_Recent	Evidence of grazing activiy by cattle within the past year	0	none						Habitat
Gross Alpha	Gross Alpha	12587461		pCi/L					Radiochemistry
Gross Beta	Gross Beta	12587472		pCi/L					Radiochemistry
Growth (ash-free dry wt/surv indiv)	Growth (ash-free dry wt/surv indiv)	0
Growth (Chlorophyll a fluorescence)	Growth (Chlorophyll a fluorescence)	0
Growth (Chlorophyll a)	Growth (Chlorophyll a)	0							Organics
Growth (length)	Growth (length)	0				mm			Toxicity
Growth (wt/surv indiv)	Growth (weight/surviving individual)	0				mg/ind			Toxicity
Growth Ratio	Growth Ratio (final measurement / initial measurement)	0				Num/Rep			Toxicity
Gull_Gull2TM	Gull_Gull2TM	0		copies/100 mL					Microbiological
H_AqHab	Shannon diversity of natural instream cover types physical-habitat metric	0	none						Bioassessment
H_SubNat	Shannon diversity of natural substrate types physical-habitat metric	0	none						Bioassessment
HabitatType	HabitatType	0	none						FieldObservations	Habitat
Halosulfuron Methyl	Halosulfuron Methyl	100784201		ug/L					Organics	Pesticides	Herbicides
Hard Plastic Piece, non-specific	Hard Plastic Piece, non-specific	0	pieces						Debris	Trash	Plastics	Bags/Packaging
Hardness as CaCO3	Hardness as CaCO3	0		mg/L					Inorganics	Conventionals	WaterQualityMeasurements
HCH, alpha-	alpha-Hexachlorocyclohexane (HCH) (alpha-BHC)	319846		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Rodenticides
HCH, beta-	beta-Hexachlorocyclohexane (HCH) (beta-BHC)	319857		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Rodenticides
HCH, beta-(Surrogate)	Surrogate: beta-Hexachlorocyclohexane (HCH) (beta-BHC)	319857		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides
HCH, delta-	delta-Hexachlorocyclohexane (HCH) (delta-BHC)	319868		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Rodenticides
HCH, delta-(Surrogate)	Surrogate: delta-HCH	0		% recovery	% recovery		% recovery	% recovery	Organics
HCH, gamma-	gamma-Hexachlorocyclohexane (HCH) (gamma-BHC) (Lindane)	58899		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Endocrine Disruptors	Rodenticides
HCH, gamma-(Surrogate)	Surrogate: gamma-Hexachlorocyclohexane (HCH) (gamma-BHC) (Lindane)	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides	Pest-OCHs	Insecticides	Endocrine Disruptors	Rodenticides
HCH-13C6, alpha-(IsoDilAnalogue)	Isotope Dilution Analogue: alpha-Hexachlorocyclohexane-13C6 (HCH) (alpha-BHC)	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA
HCH-13C6, beta-(IsoDilAnalogues)	Isotope Dilution Analogue: beta-Hexachlorocyclohexane-13C6 (HCH) (beta-BHC)	222966689		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA
HCH-13C6, delta-(IsoDilAnalogue)	Isotope Dilution Analogue: delta-Hexachlorocyclohexane-13C6 (HCH) (delta-BHC)	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA
HCH-13C6, gamma-(IsoDilAnalogue)	Isotope Dilution Analogue: gamma-Hexachlorocyclohexane-13C6 (HCH) (gamma-BHC) (Lindane)	104215852		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA
Heptachlor	Heptachlor	76448		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Endocrine Disruptors
Heptachlor Epoxide	Heptachlor Epoxide	1024573		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Endocrine Disruptors
Heptachlor Epoxide(Surrogate)	Surrogate: Heptachlor Epoxide	0		% recovery	% recovery		% recovery	% recovery	Organics
Heptachlor Epoxide-13C10(IsoDilAnalogue)	Isotope Dilution Analogue: Heptachlor Epoxide-13C10	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides	IDA
Heptachlor(Surrogate)	Surrogate: Heptachlor	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides
Heptachlor-13C10(IsoDilAnalogue)	Isotope Dilution Analogue: Heptachlor-13C10	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA
Hexachlorobenzene	Hexachlorobenzene	118741		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Endocrine Disruptors	Fungicides
Hexachlorobenzene(Surrogate)	Surrogate: Hexachlorobenzene	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides
Hexachlorobenzene-13C6(IsoDilAnalogue)	Isotope Dilution Analogue: Hexachlorobenzene-13C6	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides	IDA
Hexachlorobutadiene	Hexachlorobutadiene	87683		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	VOCs	SVOCs	Fungicides
Hexachlorocyclopentadiene	Hexachlorocyclopentadiene	77474		ug/L					Organics	SVOCs
Hexachloroethane	Hexachloroethane	67721		ug/L					Organics	SVOCs
Hexahydro-1,3,5-trinitro-1,3,5-triazine	Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX)	121824		ug/L	ug/kg				Organics
Hexanone, 2-	2-Hexanone	591786		ug/L					Organics	VOCs
Hexazinone	Hexazinone	51235042		ug/L	ng/g dw				Organics	Pesticides	Pest-Triazines	Herbicides
HF183TMSIPP	HF183TMSIPP	0		copies/100 mL					Microbiological
Hiking Trails	Hiking Trails	0	none						Habitat
Holmium	Holmium	7440600		ug/L					Inorganics
Homeless Encampment, Distance from Transect	Homeless Encampment, Distance from Transect	0	m						Habitat	Debris
Homeless Encampment, Distance from Transect Downstream	Homeless Encampment, Distance from Transect Downstream	0	m						Habitat	Debris
Homeless Encampment, Distance from Transect Upstream	Homeless Encampment, Distance from Transect Upstream	0	m						Habitat	Debris
Homeless Encampment, Within Transect	Homeless Encampment, Within Transect	0	none						Habitat	Debris
Hose Piece	Hose Piece	0	pieces						Debris	Trash	Non-Plastics	Household
Household	Household	0	L						Debris	Trash	Plastics
Household, Other	Household, Other	0	pieces						Debris	Trash	Plastics	Non-Plastics	Household
HpCDD, 1,2,3,4,6,7,8-	1,2,3,4,6,7,8-Heptachlorodibenzo-p-dioxin (HpCDD)	35822394		ug/L					Organics	PCDDs/PCDFs	Dioxins/Dibenzofurans
HPCDD, 1,2,3,4,6,7,8- (TEQ ND=0)	1,2,3,4,6,7,8-HPCDD (TEQ ND=0)	0		pg/L					Organics	Dioxins/Dibenzofurans
HPCDD, 1,2,3,4,6,7,8- (TEQ ND=1/2 DL)	1,2,3,4,6,7,8-HPCDD (TEQ ND=1/2 DL)	0		pg/L					Organics	Dioxins/Dibenzofurans
HpCDD, 1,2,3,4,6,7,8-(Surrogate)	Surrogate: 1,2,3,4,6,7,8-Heptachlorodibenzo-p-dioxin (HpCDD)	35822394		% recovery					Organics	PCDDs/PCDFs	Dioxins/Dibenzofurans
HpCDD-13C, 1,2,3,4,6,7,8-(Surrogate)	Surrogate: 1,2,3,4,6,7,8-Heptachlorodibenzo-p-dioxin-13C (HpCDD)	109719837		% recovery					Organics	PCDDs/PCDFs	Dioxins/Dibenzofurans
HpCDD-13C12, 1,2,3,4,6,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,4,6,7,8-HpCDD-13C12	109719837		% recovery					Organics	Dioxins/Dibenzofurans	IDA
HpCDF, 1,2,3,4,6,7,8-	1,2,3,4,6,7,8-Heptachlorodibenzofuran (HpCDF)	67562394		pg/L					Organics	PCDDs/PCDFs	Dioxins/Dibenzofurans
HPCDF, 1,2,3,4,6,7,8- (TEQ ND=0)	1,2,3,4,6,7,8-HPCDF (TEQ ND=0)	0		pg/L					Organics	Dioxins/Dibenzofurans
HPCDF, 1,2,3,4,6,7,8- (TEQ ND=1/2 DL)	1,2,3,4,6,7,8-HPCDF (TEQ ND=1/2 DL)	0		pg/L					Organics	Dioxins/Dibenzofurans
HpCDF, 1,2,3,4,6,7,8-(Surrogate)	Surrogate: 1,2,3,4,6,7,8-Heptachlorodibenzofuran	0		% recovery					Organics	Dioxins/Dibenzofurans
HpCDF, 1,2,3,4,7,8,9-	1,2,3,4,7,8,9-Heptachlorodibenzofuran (HpCDF)	55673897		pg/L					Organics	PCDDs/PCDFs	Dioxins/Dibenzofurans
HPCDF, 1,2,3,4,7,8,9- (TEQ ND=0)	1,2,3,4,7,8,9-HPCDF (TEQ ND=0)	0		pg/L					Organics	Dioxins/Dibenzofurans
HPCDF, 1,2,3,4,7,8,9- (TEQ ND=1/2 DL)	1,2,3,4,7,8,9-HPCDF (TEQ ND=1/2 DL)	0		pg/L					Organics	Dioxins/Dibenzofurans
HpCDF, 1,2,3,4,7,8,9-(Surrogate)	Surrogate: 1,2,3,4,7,8,9-Heptachlorodibenzofuran (HpCDF)	55673897		% recovery					Organics	PCDDs/PCDFs	Dioxins/Dibenzofurans
HpCDF-13C12, 1,2,3,4,6,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,4,6,7,8-HpCDF-13C12	109719848		% recovery					Organics	Dioxins/Dibenzofurans	IDA
HpCDF-13C12, 1,2,3,4,7,8,9-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,4,7,8,9-HpCDF-13C12	109719940		% recovery					Organics	Dioxins/Dibenzofurans	IDA
Human Adenovirus	Human Adenovirus	0		copies/100 mL	copies/g dw				Microbiological
Human Marker (HF183)	Human Marker (HF183)	0		gc/mL					Microbiological
Human Norovirus GI	Human Norovirus GI	0		copies/100 mL					Microbiological
Human Norovirus GII	Human Norovirus GII	0		copies/100 mL					Microbiological
Human Waste/Diaper	Human Waste/Diaper	0	pieces						Debris	Trash	Non-Plastics	Toxic
Human_HF183TMCaMan	Human_HF183TMCaMan	0		copies/100 mL					Microbiological
HumanHealth	HumanHealth using Trash Protocol	0	score						Trash
HxCDD, 1,2,3,4,7,8-	1,2,3,4,7,8-Hexachlorodibenzo-p-dioxin (HxCDD)	39227286		ug/L					Organics	PCDDs/PCDFs	Dioxins/Dibenzofurans
HXCDD, 1,2,3,4,7,8- (TEQ ND=0)	1,2,3,4,7,8-HXCDD (TEQ ND=0)	0		pg/L					Organics	Dioxins/Dibenzofurans
HXCDD, 1,2,3,4,7,8- (TEQ ND=1/2 DL)	1,2,3,4,7,8-HXCDD (TEQ ND=1/2 DL)	0		pg/L					Organics	Dioxins/Dibenzofurans
HxCDD, 1,2,3,4,7,8-(Surrogate)	Surrogate: 1,2,3,4,7,8-Hexachlorodibenzo-p-dioxin (HxCDD)	39227286		% recovery					Organics	PCDDs/PCDFs	Dioxins/Dibenzofurans
HxCDD, 1,2,3,6,7,8-	1,2,3,6,7,8-Hexachlorodibenzo-p-dioxin (HxCDD)	57653857		ug/L					Organics	PCDDs/PCDFs	Dioxins/Dibenzofurans
HXCDD, 1,2,3,6,7,8- (TEQ ND=0)	1,2,3,6,7,8-HXCDD (TEQ ND=0)	0		pg/L					Organics	Dioxins/Dibenzofurans
HXCDD, 1,2,3,6,7,8- (TEQ ND=1/2 DL)	1,2,3,6,7,8-HXCDD (TEQ ND=1/2 DL)	0		pg/L					Organics	Dioxins/Dibenzofurans
HxCDD, 1,2,3,6,7,8-(Surrogate)	Surrogate: 1,2,3,6,7,8-Hexachlorodibenzo-p-dioxin (HxCDD)	57653857		% recovery					Organics	PCDDs/PCDFs	Dioxins/Dibenzofurans
HxCDD, 1,2,3,7,8,9-	1,2,3,7,8,9-Hexachlorodibenzo-p-dioxin (HxCDD)	19408743		ug/L					Organics	PCDDs/PCDFs	Dioxins/Dibenzofurans
HXCDD, 1,2,3,7,8,9- (TEQ ND=0)	1,2,3,7,8,9-HXCDD (TEQ ND=0)	0		pg/L					Organics	Dioxins/Dibenzofurans
HXCDD, 1,2,3,7,8,9- (TEQ ND=1/2 DL)	1,2,3,7,8,9-HXCDD (TEQ ND=1/2 DL)	0		pg/L					Organics	Dioxins/Dibenzofurans
HxCDD-13C, 1,2,3,6,7,8-(Surrogate)	Surrogate: 1,2,3,6,7,8-Hexachlorodibenzo-p-dioxin-13C (HxCDD)	109719815		% recovery					Organics	PCDDs/PCDFs	Dioxins/Dibenzofurans
HxCDD-13C12, 1,2,3,4,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,4,7,8-HxCDD-13C12	109719804		% recovery					Organics	Dioxins/Dibenzofurans	IDA
HxCDD-13C12, 1,2,3,6,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,6,7,8-HxCDD-13C12	109719815		% recovery					Organics	Dioxins/Dibenzofurans	IDA
HxCDD-13C12, 1,2,3,7,8,9-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,7,8,9-Hexachlorodibenzo-p-dioxin-13C12 (HxCDD)	109719826		% recovery					Organics	PCDDs/PCDFs	Dioxins/Dibenzofurans
HxCDF, 1,2,3,4,7,8-	1,2,3,4,7,8-Hexachlorodibenzofuran (HxCDF)	70648269		pg/L					Organics	PCDDs/PCDFs	Dioxins/Dibenzofurans
HXCDF, 1,2,3,4,7,8- (TEQ ND=0)	1,2,3,4,7,8-HXCDF (TEQ ND=0)	0		pg/L					Organics	Dioxins/Dibenzofurans
HXCDF, 1,2,3,4,7,8- (TEQ ND=1/2 DL)	1,2,3,4,7,8-HXCDF (TEQ ND=1/2 DL)	0		pg/L					Organics	Dioxins/Dibenzofurans
HxCDF, 1,2,3,4,7,8-(Surrogate)	Surrogate: 1,2,3,4,7,8-Hexachlorodibenzofuran (HxCDF)	70648269		% recovery					Organics	PCDDs/PCDFs	Dioxins/Dibenzofurans
HxCDF, 1,2,3,6,7,8-	1,2,3,6,7,8-Hexachlorodibenzofuran (HxCDF)	57117449		pg/L					Organics	PCDDs/PCDFs	Dioxins/Dibenzofurans
HXCDF, 1,2,3,6,7,8- (TEQ ND=0)	1,2,3,6,7,8-HXCDF (TEQ ND=0)	0		pg/L					Organics	Dioxins/Dibenzofurans
HXCDF, 1,2,3,6,7,8- (TEQ ND=1/2 DL)	1,2,3,6,7,8-HXCDF (TEQ ND=1/2 DL)	0		pg/L					Organics	Dioxins/Dibenzofurans
HxCDF, 1,2,3,6,7,8-(Surrogate)	Surrogate: 1,2,3,6,7,8-Hexachlorodibenzofuran (HxCDF)	57117449		% recovery					Organics	PCDDs/PCDFs	Dioxins/Dibenzofurans
HxCDF, 1,2,3,7,8,9-	1,2,3,7,8,9-Hexachlorodibenzofuran (HxCDF)	72918219		pg/L					Organics	PCDDs/PCDFs	Dioxins/Dibenzofurans
HXCDF, 1,2,3,7,8,9- (TEQ ND=0)	1,2,3,7,8,9-HXCDF (TEQ ND=0)	0		pg/L					Organics	Dioxins/Dibenzofurans
HXCDF, 1,2,3,7,8,9- (TEQ ND=1/2 DL)	1,2,3,7,8,9-HXCDF (TEQ ND=1/2 DL)	0		pg/L					Organics	Dioxins/Dibenzofurans
HxCDF, 1,2,3,7,8,9-(Surrogate)	Surrogate: 1,2,3,7,8,9-Hexachlorodibenzofuran (HxCDF)	72918219		% recovery					Organics	PCDDs/PCDFs	Dioxins/Dibenzofurans
HxCDF, 2,3,4,6,7,8-	2,3,4,6,7,8-Hexachlorodibenzofuran (HxCDF)	60851345		pg/L					Organics	PCDDs/PCDFs	Dioxins/Dibenzofurans
HXCDF, 2,3,4,6,7,8- (TEQ ND=0)	2,3,4,6,7,8-HXCDF (TEQ ND=0)	0		pg/L					Organics	Dioxins/Dibenzofurans
HXCDF, 2,3,4,6,7,8- (TEQ ND=1/2 DL)	2,3,4,6,7,8-HXCDF (TEQ ND=1/2 DL)	0		pg/L					Organics	Dioxins/Dibenzofurans
HXCDF, 2,3,4,6,7,8-(Surrogate)	Surrogate: 2,3,4,6,7,8-Hexachlorodibenzofuran (HxCDF)	60851345		% recovery					Organics	PCDDs/PCDFs	Dioxins/Dibenzofurans
HxCDF-13C12, 1,2,3,4,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,4,7,8-HxCDF-13C12	114423982		% recovery					Organics	Dioxins/Dibenzofurans	IDA
HxCDF-13C12, 1,2,3,6,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,6,7,8-HxCDF-13C12	116843039		% recovery					Organics	Dioxins/DibenzofuransDioxins/Dibenzofurans	IDA
HxCDF-13C12, 1,2,3,7,8,9-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,7,8,9-HxCDF-13C12	116843040		% recovery					Organics	Dioxins/Dibenzofurans	IDA
HxCDF-13C12, 2,3,4,6,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 2,3,4,6,7,8-HxCDF-13C12	116843051		% recovery					Organics	Dioxins/Dibenzofurans	IDA
Hydraulic Height	Height from bottom of stream to top of bankfull height or the summation of station water depth and bankfull height	0	m						Habitat
Hydrolyzable Phosphorus + Orthophosphate as P	Hydrolyzable Phosphorus + Orthophosphate as P	0		mg/L					Inorganics	Conventionals
Hydroperiod	Hydroperiod of the waterbody	0	none						Habitat
Hydroxide	Hydroxide	14280309		mg/L					Inorganics	Conventionals
Hydroxyatrazine, 2-	2-Hydroxyatrazine	2163689		ug/L					Organics	Pesticides	Pest-Triazines
Hydroxycarbofuran, 3-	3-Hydroxycarbofuran	16655826		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Carbamates
Hydroxy-ibuprofen, 2-	2-Hydroxy-ibuprofen	0		ng/L
Hydroxy-Imidacloprid, 5-	5-Hydroxy-Imidacloprid	380912094		ug/L
Ibuprofen	Ibuprofen	15687271		ug/L					Organics	PPCPs
Ibuprofen-d3(IsoDilAnalogue)	Isotope Dilution Analogue: Ibuprofen-d3	121662144		% recovery					Organics		IDA
Imazalil	Imazalil	35554440		ug/L					Organics	Pesticides	Fungicides
Imazamox	Imazamox	114311329		ug/L					Organics
Imazapyr	Imazapyr	0		ug/L
Imazaquin	Imazaquin	81335377		ug/L					Organics	Herbicides
Imazethapyr	Imazethapyr	81335775		ug/L					Organics	Herbicides
Imidacloprid	Imidacloprid	138261413		ug/L	ng/g dw				Organics	PPCPs
Imidacloprid-d4(Surrogate)	Surrogate: Imidacloprid-d4	0		% recovery					Organics	Pesticides	Insecticides
Incised Height	Incised Height	0	m						Habitat
Increment	Increment	0	m						Habitat
Indeno(1,2,3-c,d)pyrene	Indeno(1,2,3-c,d)pyrene	193395		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH	Endocrine Disruptors`
Indeno(1,2,3-c,d)pyrene-d12(IsoDilAnalogue)	Isotope Dilution Analogue: Indeno(1,2,3-c,d)pyrene-d12	203578330		% recovery					Organics	PAHs	IDA
Indeno(1,2,3-c,d)pyrene-d12(Surrogate)	Surrogate: Indeno(1,2,3-c,d)pyrene-d12	0		% recovery	% recovery		% recovery	% recovery	Organics	PAH
Indoxacarb	Indoxacarb	173584446		ug/L					Organics	Pesticides	Ozadiazine
Industrial Plants	Industrial Plants	0	none						Habitat
Instream Plant Cover	Instream Plant Cover	0	none						Habitat
IntertidalSubstrateCharacteristics_Mud	IntertidalSubstrateCharacteristics_Mud	0	none						Habitat	Debris
IntertidalSubstrateCharacteristics_Rocky	IntertidalSubstrateCharacteristics_Rocky	0	none						Habitat	Debris
IntertidalSubstrateCharacteristics_Sand	IntertidalSubstrateCharacteristics_Sand	0	none						Habitat	Debris
IntertidalSubstrateCharacteristics_Vegetated	IntertidalSubstrateCharacteristics_Vegetated	0	none						Habitat	Debris
Iopromide	Ioprmide	0		ng/L
Iopromide-d3(IsoDilAnalogue)	Isotope Dilution Analogue: Iopromide-d3	1189947736		% recovery					Organics		IDA
Ipconazole	Ipconazole	125225287		ng/L					Organics	Pesticides	Fungicides
IPI	Score for the Index of Physical-habitat Integrity (IPI)	0	score						Bioassessment
IPI_Ev_FlowHab_qa	Quality assurance metric for the evenness of flow habitat types physical-habitat metric, calculated as the percent of expected measurements present in the input data	0	count						Bioassessment
IPI_Ev_FlowHab_score	Scored evenness of flow habitat types physical-habitat metric	0	score						Bioassessment
IPI_H_AqHab_pred	Predicted Shannon diversity of natural instream cover types physical-habitat metric	0	none						Bioassessment
IPI_H_AqHab_qa	Quality assurance metric for the Shannon diversity of natural instream cover types physical-habitat metric, calculated as the percent of expected measurements present in the input data	0	count						Bioassessment
IPI_H_AqHab_score	Scored Shannon diversity of natural instream cover types physical-habitat metric	0	score						Bioassessment
IPI_H_SubNat_qa	Quality assurance metric for the Shannon diversity of natural substrate types physical-habitat metric, calculated as the percent of expected measurements present in the input data	0	count						Bioassessment
IPI_H_SubNat_score	Scored Shannon diversity of natural substrate types physical-habitat metric	0	score						Bioassessment
IPI_IPI_qa	Quality assurance metric for the Index of Physical-habitat Integrity score, calculated as the minimum of other quality assurance metric values	0	count						Bioassessment
IPI_PCT_SAFN_pred	Predicted percent sands and fines streambed substrate physical-habitat metric	0	%						Bioassessment
IPI_PCT_SAFN_qa	Quality assurance metric for the percent sands and fines physical-habitat metric, calculated as the percent of expected measurements present in the input data	0	count						Bioassessment
IPI_PCT_SAFN_score	Scored percent sands and fines streambed substrate physical-habitat metric	0	score						Bioassessment
IPI_XCMG_pred	Predicted riparian cover as sum of three layers physical-habitat metric	0	%						Bioassessment
IPI_XCMG_qa	Quality assurance metric for the riparian cover metric, calculated as the percent of expected measurements present in the input data	0	count						Bioassessment
IPI_XCMG_score	Scored riparian cover as sum of three layers physical-habitat metric	0	score						Bioassessment
Iprodione	Iprodione	36734197		ug/L					Organics	Fungicides
Iron	Iron	7439896		ug/L	ug/g dw		ug/g ww	ug/g dw	Inorganics	Conventionals	Metals
Irrigation Equipment	Irrigation Equipment	0	none						Habitat
Isofenphos	Isofenphos	25311711		ug/L					Organics	Pesticides
Isophorone	Isophorone	78591		ug/L	mg/Kg dw				Organics	SVOCs
Isopropylbenzene	Isopropylbenzene (Cumene)	98828		ug/L					Organics	VOCs
Isopropyltoluene, p-	p-Isopropyltoluene	99876		ug/L					Organics	VOCs
Isoxaben	Isoxaben (Flexidor) (Gallery)	82558507		ug/L					Organics
Isoxaben(Surrogate)	Surrogate: Isoxaben (Flexidor) (Gallery)	82558507		% recovery					Organics	Herbicides
Jasmolin-1	Jasmolin-1 (Jasmolin I)	4466142		ug/L	ng/g dw				Organics	Pesticides	Pest-Pyrethroids
Jasmolin-2	Jasmolin-2 (Jasmolin II)	1172630		ug/L	ng/g dw				Organics	Pesticides	Pest-Pyrethroids
Kelp holdfast	Kelp holdfast	0	pieces						Debris	Natural	Non-Plastics	Marine Origin
Kelp Stipe/Blade	Kelp Stipe/Blade	0	pieces						Debris	Natural	Non-Plastics	Marine Origin
Kepone	Kepone (Chlordecone)	143500		ug/L	ng/g dw				Organics	Pesticides	Pest-OCHs
Ketocarbofuran, 3-	3-Ketocarbofuran	16709301		ug/L					Organics	Pesticides	Pest-Carbamates
Keyboard	Keyboard	0	pieces						Debris	Trash	Plastics	Toxic
Kresoxim-methyl	Kresoxim-methyl	143390890		ng/L					Organics	Fungicides
Large/Unmovable, Other	Large/Unmovable, Other	0	pieces						Debris	Trash	Non-Plastics	Large
Lead	Lead	7439921		ug/L	umol/g		ug/g ww	ug/g dw	Inorganics	TraceElements	Metals
Length	Length	0	m						Tissue	Habitat
Length Downstream	Length Downstream from X location	0	m						Habitat
Length Pool	Length Pool	0	m						Habitat
Length Reach	Length Reach	0	m						Habitat
Length Riffle	Length Riffle	0	m						Habitat
Length Upstream	Length Upstream from X location	0	m						Habitat
Length, Segment	Segment Length	0	m						Habitat
Leptophos	Leptophos	21609905		ug/L					Organics	Pesticides	Pest-OPs	Insecticides
Level Of Trash	Level Of Trash using Trash Protocol	0	score						Trash
Lid	Lid	0	pieces						Debris	Trash	Plastics	FoodService
Lighter	Lighter	0	pieces						Debris	Trash	Plastics	Toxic
Liming	Liming	0	none						Habitat
Lincomycin	Lincomycin	154212		ug/L			ng/g ww	ng/g dw	Organics	PPCPs
Linuron	Linuron	330552		ug/L					Organics	Pesticides	Herbicides
Linuron-d6(Surrogate)	Surrogate: Linuron-d6	1219804768		% recovery					Organics	Pesticides	Herbicides
Lipid	Lipid	0		% recovery			% ww	% dw	Organics	Inorganics	Conventional
Lithium	Lithium	7439932		ug/L					Inorganics
Littering	Littering using Trash Protocol	0	score						Trash
Livestock Use	Livestock Use	0	none						Habitat
Logging	Logging	0	none						Habitat
Lomefloxacin	Lomefloxacin	0					ng/g ww	ng/g dw	Organics
Loss On Ignition	Loss On Ignition	0			%				Inorganics
LWD >0.8 DLE, Length >15m	LWD >0.8 DLE, Length >15m	0	count						Habitat
LWD >0.8m DLE, Length 1.5-5m	LWD >0.8m DLE, Length 1.5-5m	0	count						Habitat
LWD >0.8m DLE, Length 5-15m	LWD >0.8m DLE, Length 5-15m	0	count						Habitat
LWD 0.1-<0.3m DLE, Length >15m	LWD 0.1-<0.3m DLE, Length >15m	0	count						Habitat
LWD 0.1-<0.3m DLE, Length 1.5-5m	LWD 0.1-<0.3m DLE, Length 1.5-5m	0	count						Habitat
LWD 0.1-<0.3m DLE, Length 5-15m	LWD 0.1-<0.3m DLE, Length 5-15m	0	count						Habitat
LWD 0.3-<0.6m DLE, Length >15	LWD 0.3-<0.6m DLE, Length >15	0	count						Habitat
LWD 0.3-<0.6m DLE, Length 1.5-5m	LWD 0.3-<0.6m DLE, Length 1.5-5m	0	count						Habitat
LWD 0.3-<0.6m DLE, Length 5-15m	LWD 0.3-<0.6m DLE, Length 5-15m	0	count						Habitat
LWD 0.6-<0.8m DLE, Length >15m	LWD 0.6-<0.8m DLE, Length >15m	0	count						Habitat
LWD 0.6-<0.8m DLE, Length 1.5-5m	LWD 0.6-<0.8m DLE, Length 1.5-5m	0	count						Habitat
LWD 0.6-<0.8m DLE, Length 5-15	LWD 0.6-<0.8m DLE, Length 5-15	0	count						Habitat
LWD A	Large Woody Debris in the A class of corresponding Diameter and Length categories	0	count						Habitat
LWD L	Large Woody Debris in the L class of corresponding Diameter and Length categories	0	count						Habitat
LWD M	Large Woody Debris in the M class of corresponding Diameter and Length categories	0	count						Habitat
LWD S	Large Woody Debris in the S class of corresponding Diameter and Length categories	0	count						Habitat
LWD T	Large Woody Debris in the T class of corresponding Diameter and Length categories	0	count						Habitat
Lyngbyatoxin-a	Lyngbyatoxin-a	0		ug/L					Microbiological	Cyanotoxins
Macroalgae Cover, Attached	Presence/Absence of attached macroalgae at a point along a transect	0	none						Habitat
Macroalgae Cover, Unattached	Presence/Absence of unattached macroalgae at a point along a transect	0	none						Habitat
Macroinvertebrate Habitat Patch Richness Metric	Metric assesses macroinvertebrate habitat patch richness along the channel edge and bank within the assessment area.	0	score						Habitat
Macrophyte Cover	Presence/Absence of macrophytes at a point along a transect	0	none						Habitat
Magnesium	Magnesium	7439954		ug/L					Inorganics	Conventionals	Metals	AlkalineEarthMetals
Maintained Lawns	Maintained Lawns	0	none						Habitat
Malaoxon	Malaoxon	1634782		ng/L					Organics	Pesticides
Malathion	Malathion	121755		ug/L	ug/g dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides	Endocrine Disruptors
Mandipropamid	Mandipropamid	374726622		ng/L					Organics	Pesticides	Fungicides
Manganese	Manganese	7439965		ug/L	ug/g dw		ug/g ww	ug/g dw	Inorganics	TraceElements	Metals	Conventionals
Marine, Other	Marine, Other	0	pieces						Debris	Natural	Non-Plastics	Marine Origin
MBAS	MBAS (Methylene Blue Active Substances)	0		ug/L					Inorganics	Surfactants
MCPA	MCPA (2-Methyl-4-chlorophenoxy)Acetic Acid) (2,4-MCPA)	94746		ug/L					Organics	Herbicides
MCPP	MCPP (2-(2-Methyl-4-chlorophenoxy) Propionic Acid)	93652		ug/L					Organics	Herbicides
Mean Percent Normal Alive	The observed number of normal larvae divided by the mean number of live embryos inoculated at the beginning of the test	0				%			Toxicity	Endpoint
Mechanical Pencil	Mechanical Pencil	0	pieces						Debris	Trash	Plastics	Household
Medical Device	Medical Device	0	pieces						Debris	Trash	Plastics	Toxic
Meprobamate	Meprobamate	57534		ng/L					Organics	PPCPs
Mercury	Mercury	7439976		ug/L	ug/Kg dw		ug/g ww	ug/g dw	Inorganics	TraceElements	Metals
Mercury, Methyl	Methyl Mercury	22967926		ug/L			ug/g ww	ug/g dw	Inorganics	TraceElements	Metals
Merphos	Merphos (Tributylphosphorotrithioite)	150505		ug/L	ug/g dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs
Metal Object	Metal Object	0	pieces						Debris	Trash	Non-Plastics	Metal
Metal Pipe/Bar	Metal Pipe/Bar	0	pieces						Debris	Trash	Non-Plastics	Metal
Metal, Other	Metal, Other	0	pieces						Debris	Trash	Non-Plastics	Metal
Metalaxyl	Metalaxyl	57837191		ug/L					Organics	Herbicides
Metconazole	Metconazole	125116236		ug/L					Organics	Fungicides
MeterAveragingInterval	Time period (seconds) upon which the meter reading is averaged internally to attain a result	0		seconds					WaterQualityMeasurements
Methadone	Methadone	76993		ng/L
Methamidophos	Methamidophos (O,S-Dimethyl thiophosphate)	10265926		ug/L	ng/g dw				Organics	Pesticides	Pest-OPs	Insecticides
Methidathion	Methidathion	950378		ug/L	ng/g dw				Organics	Pesticides	Pest-OPs	Insecticides
Methiocarb	Methiocarb	2032657		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Carbamates	Insecticides
Methomyl	Methomyl	16752775		ug/L	ug/Kg dw				Organics	Pesticides	Pest-OPs	Insecticides
Methoprene	Methoprene	40596698		ng/L					Organics	Pesticides
Methoxychlor	Methoxychlor	72435		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Endocrine Disruptors
Methoxychlor(Surrogate)	Surrogate: Methoxychlor	0			% recovery				Organics
Methoxychlor-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Methoxychlor-13C12	0			% recovery				Organics	Pesticides	IDA
Methoxyfenozide	Methoxyfenozide	161050584		ng/L					Organics	Pesticides	Insecticides
Methyl 3-Amino-2,5-dichlorobenzoate	Methyl 3-Amino-2,5-dichlorobenzoate (Chloramben Methyl)	7286842		ug/L					Organics	Herbicides
Methyl Perfluorooctane Sulfonamido Acetic Acid, N-	N-Methyl Perfluorooctane Sulfonamido Acetic Acid (Me-PFOSA-AcOH)	0		ng/L	ng/g dw		ng/g ww	ng/g dw
Methyl Perfluorooctane Sulfonamido Acetic Acid-d3, N-(IsoDilAnalogue)	Isotope Dilution Analogue: N-Methyl Perfluorooctane Sulfonamido Acetic Acid-d3 (N-MeFOSAA)	0		% recovery	% recovery		% recovery	% recovery	Organics		IDA
Methyl Perfluorooctane Sulfonamido Acetic Acid-d3, N-(Surrogate)	Surrogate: N-Methyl Perfluorooctane Sulfonamido Acetic Acid-d3	0					% recovery	% recovery	Organics	PFAS	PFC Precursor
Methyl Tert-butyl Ether	Methyl Tert-butyl Ether (MTBE)	1634044		ug/L					Organics	VOCs	MTBE_BTEX
Methyl-2-pentanone, 4-	4-Methyl-2-pentanone (Methyl Isobutyl Ketone)	108101		ug/L					Organics	VOCs
Methylanthracene	Methylanthracene	0		ng/L					Organics	PAHs
Methylanthracene, 2-	2-Methylanthracene	613127					ug/Kg ww	ug/Kg dw	Organics	PAHs	Semi-VOAs
Methylbenzo(a)pyrene, 7-	7-Methylbenzo(a)pyrene	63041770		ng/L					Organics	PAHs
Methylchlolanthrene, 3-	Methylchlolanthrene, 3-	0		ng/L					Organics	PAHs
Methylchrysene, 1-	1-Methylchrysene	3351288		ng/L					Organics	PAHs
Methylchrysene, 5/6-	5-Methylchrysene/6-Methylchrysene	0		ng/L					Organics	PAHs
Methyldibenzothiophene, 2-	2-Methyldibenzothiophene	20928023		ng/L					Organics	PAHs
Methyldibenzothiophene, 4-	4-Methyldibenzothiophene	7372885		ug/L	ng/g dw		ng/g ww	ng/g dw	Organics	PAHs	SVOCs
Methyldibenzothiophenes, 2/3-	2-Methyldibenzothiophene/3-Methyldibenzothiophene	0		ng/L					Organics	PAHs
Methylene Chloride	Methylene Chloride (Dichloromethane)	75092		ug/L					Organics	VOCs
Methylfluoranthene, 2-	2-Methylfluoranthene	33543316		ug/L	ng/g dw		ng/g ww	ng/g dw	Organics	PAHs	SVOCs	HMW_PAH
Methylfluoranthene, 3-	3-Methylfluoranthene	2523399		ng/L					Organics	PAHs
Methylfluoranthene, 3-/Benzo(a)fluorene	3-Methylfluoranthene/Benzo(a)fluorene	0		ng/L					Organics	PAHs
Methylfluorene, 1-	1-Methylfluorene	1730376		ug/L	ng/g dw		ng/g ww	ng/g dw	Organics	PAHs	SVOCs
Methylfluorene, 2-	2-Methylfluorene	1430973		ng/L					Organics	PAHs
Methylnaphthalene, 1-	1-Methylnaphthalene	90120		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH
Methylnaphthalene, 2-	2-Methylnaphthalene	91576		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH
Methylnaphthalene-d10, 2-(IsoDilAnalogue)	Isotope Dilution Analogue: 2-Methylnaphthalene-d10	7297452		% recovery					Organics	PAHs	IDA
Methylnaphthalene-d10, 2-(Surrogate)	Surrogate: 2-Methylnaphthalene-d10	0		% recovery	% recovery		% recovery	% recovery	Organics	PAH
Methyl-perfluorooctanesulfonamide, N-	N-Methyl-perfluorooctanesulfonamide	0		ng/L	ng/g dw		ng/g ww	ng/g dw
Methyl-perfluorooctanesulfonamide-d3, N-(IsoDilAnalogue)	Isotope Dilution Analogue: N-Methyl-perfluorooctanesulfonamide-d3 (N-MeFOSA)	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAs	IDA
Methyl-perfluorooctanesulfonamide-d3, N-(Surrogate)	Surrogate: Methyl-perfluorooctanesulfonamide-d3, N- (N-MeFOSA)	0					% recovery	% recovery	Organics	PFAS
Methyl-perfluorooctanesulfonamidoethanol, N-	N-Methyl-perfluorooctanesulfonamidoethanol	0		ng/L	ng/g dw		ng/g ww	ng/g dw
Methyl-perfluorooctanesulfonamidoethanol-d7, N-(IsoDilAnalogue)	Isotope Dilution Analogue: N-Methyl-perfluorooctanesulfonamidoethanol-d7 (N-MeFOSE)	0		% recovery	% recovery		% recovery	% recovery	Organics	PFAs	IDA
Methyl-perfluorooctanesulfonamidoethanol-d7, N-(Surrogate)	Surrogate: N-Methyl-perfluorooctanesulfonamidoethanol-d7	0					% recovery	% recovery	Organics	PFAS
Methylphenanthrene	Methylphenanthrene	0		ng/L					Organics
Methylphenanthrene, 1-	1-Methylphenanthrene	832699		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH
Methylphenanthrene, 2-	2-Methylphenanthrene	2531842					ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH
Methylphenanthrene, 3-	3-Methylphenanthrene	832713					ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH
Methylphenanthrene, 3/4-	3/4-Methylphenanthrene	0					ug/Kg ww	ug/Kg dw	Organics	PAHs
Methylphenanthrene, 9/4-	9/4-Methylphenanthrene	0		ng/L					Organics	PAHs
Methylphenol, 2-	2-Methylphenol	95487		ug/L	mg/Kg dw				Organics	SVOCs	Phenols	non-Chlorinated Phenols
Methylphenol, 3-	3-Methylphenol	0		ug/L					Organics	SVOCs
Methylphenol, 3/4-	3-Methylphenol/4-Methylphenol	106445		ug/L	mg/Kg dw				Organics	SVOCs	Phenols	non-Chlorinated Phenols
Methylphenol, 4-	4-Methylphenol	0		ug/L					Organics	SVOCs
Metolachlor	Metolachlor	51218452		ug/L	ng/g dw				Organics	Herbicides
Metolachlor, S-	S-Metolachlor	87392129		ug/L					Organics	Pesticides
Metribuzin	Metribuzin	21087649		ug/L					Organics	Herbicides
Metsulfuron Methyl	Metsulfuron Methyl	74223646		ug/L					Organics	Herbicides
Mevinphos	Mevinphos (Phosdrin)	7786347		ug/L	ug/g dw				Organics	Pesticides	Pest-OPs	Insecticides
Mexacarbate	Mexacarbate	315184		ug/L					Organics	Pesticides	Pest-Carbamates	Insecticides
Miconazole	Miconazole	0					ng/g ww	ng/g dw	Organics
Microalgae Thickness	Thickness of microalgae (if present) at a point along a transect	0	none						Habitat
Microcystin-LA	Microcystin-LA (MCY-LA)	96180799		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins
Microcystin-LF	Microcystin-LF (MCY-LF)	154037704		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins
Microcystin-LR	Microcystin-LR (MCY-LR)	101043372		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins
Microcystin-LW	Microcystin-LW (MCY-LW)	157622021		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins
Microcystin-LY	Microcystin-LY (MCY-LY)	123304109		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins
Microcystin-RR	Microcystin-RR (MCY-RR)	111755374		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins
Microcystins, Total	Total Microcystins	0		ug/L					Microbiological	Cyanotoxins
Microcystin-YR	Microcystin-YR (MCY-YR)	101064486		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins
Milk Carton	Milk Carton	0	pieces						Debris	Trash	Plastics	FoodService
Mines, Quaries	Mines, Quaries	0	none						Habitat
Mirex	Mirex	2385855		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides	Endocrine Disruptors
Mirex(Surrogate)	Surrogate: Mirex	0		% recovery	% recovery		% recovery	% recovery	Organics
Mirex-13C10(IsoDilAnalogue)	Isotope Dilution Analogue: Mirex-13C10	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides	IDA
Miscellaneous	Miscellaneous using Trash Protocol	0	L						Trash
Miscellaneous, Other	Miscellaneous, Other	0	pieces						Debris	Trash	Plastics	Miscellaneous
Moisture	Moisture	0		% recovery	% ww		% ww	% dw	Organics	Inorganics	Conventional
Molinate	Molinate (Ordram)	2212671		ug/L	ng/g dw				Organics	Pesticides	Pest-OPs
Molybdenum	Molybdenum	7459987		ug/L	ug/g dw				Inorganics	Metals
Molybdenum, Acid Labile	Acid Labile Molybdenum	0		mg/L					Inorganics	Metals
Monobutyltin as Sn	Monobutyltin as Sn (MBT)	78763549			ug/Kg dw				Organics	Organotins	Biocide
Monocrotophos	Monocrotophos	6923224		ug/L					Organics	Pesticides	Insecticides	Organophosphorous
Monuron	Monuron	150685		ug/L					Organics	Pesticides	Pest-Carbamates	Herbicides
Monuron(Surrogate)	Surrogate: Monuron	150685		% recovery					Organics
Mortality/Normality	Mortality/Normality (%)	0				%			Toxicity
Motor Oil	Motor Oil	0		ug/L					Organics
Myclobutanil	Myclobutanil	88671890		ug/L					Organics	Fungicides
Nail/Screw/Bolt	Nail/Screw/Bolt	0	pieces						Debris	Trash	Non-Plastics	Metal
Naled	Naled (Dibrom)	300765		ug/L	ng/g dw				Organics	Pesticides	Pest-OPs	Insecticides	Rodenticides
Naphthalene	Naphthalene	91203		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH	VOCs
Naphthalene-d8(IsoDilAnalogue)	Isotope Dilution Analogue: Naphthalene-d8	1146652		% recovery					Organics	PAHs	IDA
Naphthalene-d8(Surrogate)	Surrogate: Naphthalene-d8	1146652		% recovery	ng/g dw		ng/g ww	ng/g dw	Organics	PAHs	SVOCs	Insecticides
Naphthalenes, C1-	C1-Naphthalenes	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH
Naphthalenes, C2-	C2-Naphthalenes	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH
Naphthalenes, C3-	C3-Naphthalenes	0		uS/cm	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH
Naphthalenes, C4-	C4-Naphthalenes	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH
Naphthobenzothiophene	Naphthobenzothiophene	0		ng/L					Organics	PAHs
Naphthobenzothiophene, C1-	C1-Naphthobenzothiophene	0		ng/L					Organics	PAHs
Naphthobenzothiophene, C2-	C2-Naphthobenzothiophene	0		ng/L					Organics	PAHs
Naphthobenzothiophene, C3-	C3-Naphthobenzothiophene	0		ng/L					Organics	PAHs
Napropamide	Napropamide	15299997		ug/L	ng/g dw				Organics	Pesticides	Herbicides
Naproxen	Naproxen	0		ng/L
Naproxen-d3(IsoDilAnalogue)	Isotope Dilution Analogue: Naproxen-d3	958293771		% recovery					Organics		IDA
Natural, cotton/wool	Natural, cotton/wool	0	pieces						Debris	Trash	Non-Plastics	Biodegradable
Neburon	Neburon	555373		ug/L					Organics	Pesticides	Pest-Carbamates	Herbicides
Neodymium	Neodymium	7440008		ug/L					Inorganics
Nickel	Nickel	7440020		ug/L	umol/g		ug/g ww	ug/g dw	Inorganics	TraceElements	Metals
Nicosulfuron	Nicosulfuron	111991094		ug/L					Organics	Herbicides
NID as CTAS	4-Nitro-Inden-1-One (NID) as Cobalt Thiocyanate Active Substances (CTAS)	0		mg/L
Nitrate + Nitrite as N	Nitrate + Nitrite as N	0		ug/L					Inorganics	Conventionals	Nutrients
Nitrate as N	Nitrate as N	14797558		ug/L	mg/Kg nr				Inorganics	Conventionals	Nutrients	WaterQualityMeasurements
Nitrite as N	Nitrite as N	14797650		ug/L	mg/Kg dw				Inorganics	Conventionals	Nutrients
Nitroaniline, 2-	2-Nitroaniline	88744		ug/L					Organics	SVOCs
Nitroaniline, 3-	3-Nitroaniline	99092		ug/L					Organics	SVOCs
Nitroaniline, 4-	4-Nitroaniline	100016		ug/L					Organics	SVOCs
Nitrobenzene	Nitrobenzene	98953		ug/L	ug/kg				Organics	VOCs
Nitrobenzene-d5(Surrogate)	Surrogate: Nitrobenzene-d5	4165600		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs
Nitrogen Oxide	Nitrogen Oxide	10102439		mg/L					Inorganics	Conventional
Nitrogen, Inorganic	Inorganic Nitrogen as N	0		mg/L					Inorganics
Nitrogen, Organic	Organic Nitrogen as N	10102400		mg/L	mg/Kg nr				Inorganics	Conventional
Nitrogen, Total	Total Nitrogen	0		ug/L	% dw				Inorganics	Conventionals	Nutrients	WaterQualityMeasurements
Nitrogen, Total Kjeldahl	Total Kjeldahl Nitrogen (TKN)	7727379		ug/L	mg/Kg dw				Inorganics	Conventionals	Nutrients
Nitrogen-15/Nitrogen-14 Ratio	Nitrogen-15/Nitrogen-14 Ratio (Delta 15N nitrate isotope)	0		per mil
Nitrophenol, 2-	2-Nitrophenol	88755		ug/L	mg/Kg dw				Organics	SVOCs	Phenols	non-Chlorinated Phenols	Nitrophenols
Nitrophenol, 4-	4-Nitrophenol	100027		ug/L	mg/Kg dw				Organics	SVOCs	Phenols	non-Chlorinated Phenols	Nitrophenols
Nitrosodimethylamine, N-	N-Nitrosodimethylamine	0		ug/L					Organics	SVOCs
Nitrosodi-n-propylamine, N-	N-Nitrosodi-n-propylamine	621647		ug/L					Organics	SVOCs
Nitrosodiphenylamine, N-	N-Nitrosodiphenylamine	0		ug/L					Organics	SVOCs
No Debris Collected	No Debris Collected	0	pieces						Debris	Trash	Survey
No Debris Present	No Debris Present	0	pieces						Debris	Trash	Survey
Nodularin	Nodularin	118399227		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins
NoItems	Number of Items using Trash Protocol	0	score						Trash
Nonachlor, cis-	cis-Nonachlor	5103731		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Endocrine Disruptors
Nonachlor, cis-(Surrogate)	Surrogate: cis-Nonachlor	0		% recovery	% recovery		% recovery	% recovery	Organics
Nonachlor, trans-	trans-Nonachlor	39765805		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Endocrine Disruptors
Nonachlor, trans-(Surrogate)	Surrogate: trans-Nonachlor	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides
Nonachlor-13C10, cis-(IsoDilAnalogue)	Isotope Dilution Analogue: cis-Nonachlor-13C10	0		% recovery	% recovery		% recovery	% recovery	Organics	Pesticides	IDA
Nonachlor-13C10, trans-(IsoDilAnalogue)	Isotope Dilution Analogue: trans-Nonachlor-13C10	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA
Nonylphenol	Nonylphenol	25154523		ug/L					Organics	Surfactants	Phenols	non-Chlorinated Phenols	Endocrine Disruptors
Nonylphenol, 4-n-	4-n-Nonylphenol	104405		ug/L					Organics
Nonylphenol, tech-	tech-Nonylphenol (Branched p-nonylphenol)	84852153		ug/L					Organics	Pesticides
Nonylphenolethoxylate	Nonylphenolethoxylate	9016459		ug/L					Organics	Surfactants	Phenols	non-Chlorinated Phenols	Endocrine Disruptors
Norfloxacin	Norfloxacin	0					ng/g ww	ng/g dw	Organics
Norflurazon	Norflurazon (3(2H)-Pyridazinone, 4-chloro-5-(methylamino)-2-[3-(trifluoromethyl)phenyl]-) (Telok)	27314132		ug/L					Organics	Pesticides	Herbicides
Norgestimate	Norgestimate	0					ng/g ww	ng/g dw	Organics
Normal Development	Normal Development (%)	0				%			Toxicity
Novaluron	Novaluron	116714466		ng/L					Organics	Pesticides	Herbicides
O,O,O-Triethyl phosphorothioate	O,O,O-Triethyl phosphorothioate	0		ug/L
ObservedChannelFlowLevel	ObservedChannelFlowLevel	0	none						FieldObservations	Habitat
ObservedFlow	ObservedFlow	0	none	cfs					FieldObservations	Habitat
OCDD, 1,2,3,4,6,7,8,9-	1,2,3,4,6,7,8,9-Octachlordibenzo-p-dioxin (OCDD)	3268879		ug/L					Organics	PCDDs/PCDFs	Dioxins/Dibenzofurans
OCDD, 1,2,3,4,6,7,8,9- (TEQ ND=0)	1,2,3,4,6,7,8,9-OCDD (TEQ ND=0)	0		pg/L					Organics	Dioxins/Dibenzofurans
OCDD, 1,2,3,4,6,7,8,9- (TEQ ND=1/2 DL)	1,2,3,4,6,7,8,9-OCDD (TEQ ND=1/2 DL)	0		pg/L					Organics	Dioxins/Dibenzofurans
OCDD, 1,2,3,4,6,7,8,9-(Surrogate)	Surrogate: 1,2,3,4,6,7,8,9-Octachlordibenzo-p-dioxin (OCDD)	3268879		% recovery					Organics	PCDDs/PCDFs	Dioxins/Dibenzofurans
OCDD-13C, 1,2,3,4,6,7,8,9-(Surrogate)	Surrogate: 1,2,3,4,6,7,8,9-Octachlordibenzo-p-dioxin-13C (OCDD)	114423971		% recovery					Organics	PCDDs/PCDFs	Dioxins/Dibenzofurans
OCDD-13C12, 1,2,3,4,6,7,8,9-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,4,6,7,8,9-OCDD-13C12	114423971		% recovery					Organics	Dioxins/Dibenzofurans	IDA
OCDF, 1,2,3,4,6,7,8,9-	1,2,3,4,6,7,8,9-Octachlordibenzofuran (OCDF)	39001020		pg/L					Organics	PCDDs/PCDFs	Dioxins/Dibenzofurans
OCDF, 1,2,3,4,6,7,8,9- (TEQ ND=0)	1,2,3,4,6,7,8,9-OCDF (TEQ ND=0)	0		pg/L					Organics	Dioxins/Dibenzofurans
OCDF, 1,2,3,4,6,7,8,9- (TEQ ND=1/2 DL)	1,2,3,4,6,7,8,9- OCDF (TEQ ND=1/2 DL)	0		pg/L					Organics	Dioxins/Dibenzofurans
OCDF, 1,2,3,4,6,7,8,9-(Surrogate)	Surrogate: 1,2,3,4,6,7,8,9-Octachlordibenzofuran (OCDF)	39001020		% recovery					Organics	PCDDs/PCDFs	Dioxins/Dibenzofurans
Octacosane, n-	n-Octacosane	0		% recovery					Organics	Alkanes
Odor	Odor	0	none	TON	none				FieldObservations	Habitat
Odor Intensity	Odor Intensity - Specific to EMAP BA (characterizes intensity of odor)	0	none						Habitat
Ofloxacin	Ofloxacin	0					ng/g ww	ng/g dw	Organics
Oil, Gas Wells	Oil, Gas Wells	0	none						Habitat
OilandGrease	Oil & Grease	0		mg/L					Inorganics	Conventionals
OilandGrease; HEM	Oil and Grease, N-Hexane Extractable Material	0		mg/L					Inorganics	Conventionals
OilandGrease; SGT-HEM	Oil and Grease, Silica Gel Treated N-Hexane Extractable Material (Non-Polar Material Not Adsorbed by Silica Gel)	0		mg/L					Inorganics	Conventionals
Okadaic Acid	Okadaic Acid	78111178		ug/L			ng/g ww	ng/g dw	Microbiological	Cyanotoxins
Orchards	Orchards	0	none						Habitat
Ormetoprim	Ormetoprim	0					ng/g ww	ng/g dw	Organics
OrthoPhosphate as P	Reactive Phosphorous (PO4)	14265442		ug/L					Inorganics	Conventionals	Nutrients
Oryzalin	Oryzalin (Rycelan) (Ryzelan) (Surflan)	19044883		ug/L					Organics	Herbicides
o-Terphenyl(Surrogate)	Surrogate: o-Terphenyl	84151		% recovery	% recovery				Organics	SVOCs
OtherPresence	OtherPresence	0	none						FieldObservations	Habitat
Outfall Accessibility	Outfall Accessibility	0	none
Outfall Structural Cond	Structural condition of the outfall	0	none
Outfall, Distance from Transect	Outfall, Distance from Transect	0	m						Habitat	Debris
Outfall, Within Transect	Outfall, Within Transect	0	none						Habitat	Debris
OverlandRunoffLast24hrs	Influence of overland runoff during last 24 hours	0	none						FieldObservations	Habitat
Oxacillin	Oxacillin	0					ng/g ww	ng/g dw	Organics
Oxadiazon	Oxadiazon	19666309		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs
Oxamyl	Oxamyl	23135220		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Carbamates	Insecticides	Nematocides
Oxidation-Reduction Potential	Oxidation-Reduction Potential (OPR)	0		mV					WaterQualityMeasurements	Conventionals	Inorganics
Oxolinic Acid	Oxolinic Acid	0					ng/g ww	ng/g dw	Organics
Oxychlordane	Oxychlordane	27304138		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Endocrine Disruptors
Oxychlordane(Surrogate)	Surrogate: Oxychlordane	0		% recovery	% recovery		% recovery	% recovery	Organics
Oxychlordane-13C10(IsoDilAnalogue)	Isotope Dilution Analogue: Oxychlordane-13C10	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA
Oxychlordane-13C10(Surrogate)	Surrogate: Oxychlordane-13C10	0		% recovery					Organics
Oxyfluorfen	Oxyfluorfen (Goal)	42874033		ug/L	ng/g dw				Organics	Pesticides	Pest-OCHs
Oxygen, Dissolved	Dissolved Oxygen (DO)	0		mg/L					WaterQualityMeasurements	Conventionals
Oxygen, Saturation	Oxygen, Saturation	0		%					WaterQualityMeasurements	Conventionals
Oxygen-18/Oxygen-16 Ratio	Oxygen-18/Oxygen-16 Ratio (Delta 18O nitrate isotope)	14797718		per mil					Isotopes
Oxytetracycline	Oxytetracycline	79572		ug/L					Organics	PPCPs
Paclobutrazol	Paclobutrazol	76738620		ng/L					Organics	Pesticides	Fungicides
Paper/Cardboard	Paper/Cardboard	0	pieces						Debris	Trash	Non-Plastics	Biodegradable
PAR	Photosynthetically Active Radiation (PAR)	0		mE/m2/s					WaterQualityMeasurements
Paraquat	Paraquat	4685150		ug/L					Organics	Pesticides	Herbicides
Parathion, Ethyl	Ethyl Parathion (Parathion)	56382		ug/L	ng/g dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides
Parathion, Methyl	Methyl Parathion	298000		ug/L	ug/g dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides
Parathion, Total	Total Parathion	0		ug/L					Organics
Parks, Campgrounds	Parks, Campgrounds	0	none						Habitat
Particulate Organic Carbon	Particulate Organic Carbon (POC)	0		mg/L					Inorganics	Conventionals
Pasture	Pasture	0	none						Habitat
PBDE 007	Polybrominated Diphenyl Ether (PBDE) 7	0		pg/sample	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 008	Polybrominated Diphenyl Ether (PBDE) 8	0		pg/sample	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 008/11	Polybrominated Diphenyl Ether (PBDE) 8/11	0		pg/L			pg/g ww	pg/g dw	Organics	PBDEs	FlameRetardants
PBDE 010	Polybrominated Diphenyl Ether (PBDE) 10	0		pg/sample	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 011	Polybrominated Diphenyl Ether (PBDE) 11	0		pg/sample	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 012	Polybrominated Diphenyl Ether (PBDE) 12	0		pg/sample	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 012/13	Polybrominated Diphenyl Ether (PBDE) 12/13	0		pg/L			pg/g ww	pg/g dw	Organics	PBDEs	FlameRetardants
PBDE 013	Polybrominated Diphenyl Ether (PBDE) 13	0		pg/sample	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 015	Polybrominated Diphenyl Ether (PBDE) 15	0		pg/sample	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 015(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 15	0		% recovery	% recovery		% recovery	% recovery	Organics	FlameRetardants
PBDE 017	Polybrominated Diphenyl Ether (PBDE) 17	49690940		ug/L	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants
PBDE 017/25	Polybrominated Diphenyl Ether (PBDE) 17/25	0		ug/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants
PBDE 025	Polybrominated Diphenyl Ether (PBDE) 25	0		ug/L	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants
PBDE 028	Polybrominated Diphenyl Ether (PBDE) 28	6430906		ug/L	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants
PBDE 028(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 28	0		% recovery	% recovery		% recovery	% recovery	Organics	FlameRetardants
PBDE 028/33	Polybrominated Diphenyl Ether (PBDE) 28/33	0		ug/L	ng/g dw		pg/g ww	pg/g dw	Organics	PBDEs	FlameRetardants
PBDE 028-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 028-13C12	0			% recovery		% recovery	% recovery	Organics	PBDE	IDA
PBDE 030	Polybrominated Diphenyl Ether (PBDE) 30	0		ug/L	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants
PBDE 032	Polybrominated Diphenyl Ether (PBDE) 32	0		pg/sample	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 033	Polybrominated Diphenyl Ether (PBDE) 33	0		ug/L	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants
PBDE 035	Polybrominated Diphenyl Ether (PBDE) 35	0		pg/sample	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 037	Polybrominated Diphenyl Ether (PBDE) 37	0		pg/sample	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 047	Polybrominated Diphenyl Ether (PBDE) 47	5436431		ug/L	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants
PBDE 047(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 47	5436430		% recovery	% recovery		% recovery	% recovery	Organics	FlameRetardants
PBDE 047-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 047-13C12	0			% recovery		% recovery	% recovery	Organics	PBDE	IDA
PBDE 049	Polybrominated Diphenyl Ether (PBDE) 49	0		ug/L	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants
PBDE 051	Polybrominated Diphenyl Ether (PBDE) 51	0		pg/sample	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 066	Polybrominated Diphenyl Ether (PBDE) 66	84303457		ug/L	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants
PBDE 071	Polybrominated Diphenyl Ether (PBDE) 71	0		pg/sample	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 075	Polybrominated Diphenyl Ether (PBDE) 75	0		pg/sample	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 077	Polybrominated Diphenyl Ether (PBDE) 77	0		pg/sample	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 077(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 77	0		% recovery	% recovery		% recovery	% recovery	Organics	FlameRetardants
PBDE 079	Polybrominated Diphenyl Ether (PBDE) 79	0		pg/sample	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 085	Polybrominated Diphenyl Ether (PBDE) 85	182346210		ug/L	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants
PBDE 099	Polybrominated Diphenyl Ether (PBDE) 99	60348609		ug/L	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants
PBDE 099(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 99	0		% recovery	% recovery		% recovery	% recovery	Organics	FlameRetardants
PBDE 099-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 099-13C12	0			% recovery		% recovery	% recovery	Organics	PBDE	IDA
PBDE 100	Polybrominated Diphenyl Ether (PBDE) 100	97038976		ug/L	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants
PBDE 100(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 100	0		% recovery	% recovery		% recovery	% recovery	Organics	FlameRetardants
PBDE 100-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 100-13C12	0			% recovery		% recovery	% recovery	Organics		IDA
PBDE 100-L(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 100-Labeled	0		% recovery	% recovery		% recovery	% recovery	Organics	PBDEs	FlameRetardants
PBDE 105	Polybrominated Diphenyl Ether (PBDE) 105	0		pg/sample	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 116	Polybrominated Diphenyl Ether (PBDE) 116	0		pg/sample	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 119	Polybrominated Diphenyl Ether (PBDE) 119	0		pg/sample	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 119/120	Polybrominated Diphenyl Ether (PBDE) 119/120	0		pg/L			pg/g ww	pg/g dw	Organics	PBDEs	FlameRetardants
PBDE 120	Polybrominated Diphenyl Ether (PBDE) 120	0		pg/sample	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 126	Polybrominated Diphenyl Ether (PBDE) 126	0		pg/sample	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 126(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 126	0		% recovery	% recovery		% recovery	% recovery	Organics	FlameRetardants
PBDE 128	Polybrominated Diphenyl Ether (PBDE) 128	0		pg/sample	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 138	Polybrominated Diphenyl Ether (PBDE) 138	67888986		ug/L	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants
PBDE 138(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 138	67888986		% recovery	% recovery				Organics	PBDEs	FlameRetardants
PBDE 138/166	Polybrominated Diphenyl Ether (PBDE) 138/166	0		pg/L			pg/g ww	pg/g dw	Organics	PBDEs	FlameRetardants
PBDE 139(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 139	0		% recovery	% recovery		% recovery	% recovery	Organics	FlameRetardants
PBDE 139-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 139-13C12	0			% recovery		% recovery	% recovery	Organics		IDA
PBDE 140	Polybrominated Diphenyl Ether (PBDE) 140	0		pg/sample	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 153	Polybrominated Diphenyl Ether (PBDE) 153	68631492		ug/L	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants
PBDE 153(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 153	0		% recovery	% recovery		% recovery	% recovery	Organics	FlameRetardants
PBDE 153-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 153-13C12	0			% recovery		% recovery	% recovery	Organics		IDA
PBDE 154	Polybrominated Diphenyl Ether (PBDE) 154	36402150		ug/L	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants
PBDE 154(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 154	0		% recovery	% recovery		% recovery	% recovery	Organics	FlameRetardants
PBDE 154-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 154-13C12	0			% recovery		% recovery	% recovery	Organics		IDA
PBDE 155	Polybrominated Diphenyl Ether (PBDE) 155	0		pg/sample	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 166	Polybrominated Diphenyl Ether (PBDE) 166	0		pg/sample	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 179	Polybrominated Diphenyl Ether (PBDE) 179	0		ug/L	ng/g dw		ng/g ww	ng/g dw	Organics	PBDEs	FlameRetardants
PBDE 181	Polybrominated Diphenyl Ether (PBDE) 181	0		pg/sample	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	FlameRetardants
PBDE 183	Polybrominated Diphenyl Ether (PBDE) 183	68928803		ug/L	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants
PBDE 183(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 183	0		% recovery	% recovery		% recovery	% recovery	Organics	FlameRetardants
PBDE 183-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 183-13C12	0			% recovery		% recovery	% recovery	Organics		IDA
PBDE 184	Polybrominated Diphenyl Ether (PBDE) 184	0		ug/L	ng/g dw		ng/g ww	ng/g dw	Organics	PBDEs	FlameRetardants
PBDE 188	Polybrominated Diphenyl Ether (PBDE) 188	0		ug/L	ng/g dw		ng/g ww	ng/g dw	Organics	PBDEs	FlameRetardants
PBDE 190	Polybrominated Diphenyl Ether (PBDE) 190	79682250		ug/L	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants
PBDE 197(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 197	0		% recovery	% recovery		% recovery	% recovery	Organics	FlameRetardants
PBDE 200	Polybrominated Diphenyl Ether (PBDE) 200	0		ug/L	ng/g dw				Organics	PBDEs	FlameRetardants
PBDE 200/203	Polybrominated Diphenyl Ether (PBDE) 200/203	0		ug/L	ng/g dw		ng/g ww	ng/g dw	Organics	PBDEs	FlameRetardants
PBDE 201	Polybrominated Diphenyl Ether (PBDE) 201	0		ug/L	ng/g dw		ng/g ww	ng/g dw	Organics	PBDEs	FlameRetardants
PBDE 202	Polybrominated Diphenyl Ether (PBDE) 202	0		ug/L	ng/g dw		ng/g ww	ng/g dw	Organics	PBDEs	FlameRetardants
PBDE 203	Polybrominated Diphenyl Ether (PBDE) 203	0		ug/L	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants
PBDE 206	Polybrominated Diphenyl Ether (PBDE) 206	0		ug/L	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants
PBDE 207	Polybrominated Diphenyl Ether (PBDE) 207	0		ug/L	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants
PBDE 208	Polybrominated Diphenyl Ether (PBDE) 208	0		ug/L	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants
PBDE 209	Polybrominated Diphenyl Ether (PBDE) 209	0		ug/L	pg/g dw		ug/Kg ww	ug/Kg dw	Organics	PBDEs	FlameRetardants
PBDE 209(Surrogate)	Surrogate: Polybrominated Diphenyl Ether (PBDE) 209	2051240		% recovery	% recovery		% recovery	% recovery	Organics	FlameRetardants
PBDE 209-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 209-13C12	0			% recovery		% recovery	% recovery	Organics		IDA
PCB 001	PCB 1 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 001(Surrogate)	Surrogate: PCB 1 Congener	0		% recovery	% recovery		% recovery	% recovery	Organics	PCBs
PCB 001-13C(surrogate)	Surrogate: PCB 001-13C Congener	0		% recovery					Organics
PCB 001-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 001-13C12	234432850		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 002	PCB 2 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 003	PCB 3 Congener	2051629		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 003(Surrogate)	Surrogate: PCB 3 Congener	0		% recovery	% recovery		% recovery	% recovery	Organics	PCBs
PCB 003-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 003-13C12	208263778		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 004	PCB 4 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 004(Surrogate)	Surrogate: PCB 4 Congener	0		% recovery	% recovery		% recovery	% recovery	Organics	PCBs
PCB 004/10	PCB 4/10 Congener	0		pg/L					Organics	PCBs
PCB 004-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 004-13C12	234432861		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 005	PCB 5 Congener	16605917		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 005/8	PCB 5/8 Congener	0		ug/L	ng/g dw				Organics	PCBx
PCB 006	PCB 6 Congener	25569806		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 007	PCB 7 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 007/9	PCB 7/9 Congener	0		pg/L					Organics	PCBs
PCB 008	PCB 8 Congener	34883437		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 008(Surrogate)	Surrogate: PCB 8 Congener	34883400		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	Congeners
PCB 009	PCB 9 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 009-13C(Surrogate)	Surrogate: PCB 009-13C Congener	0		% recovery					Organics	PCBs
PCB 009-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 9-13C12	250694894		% recovery					Organics	PCBs	IDA
PCB 010	PCB 10 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 011	PCB 11 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 011-13C(Surrogate)	Surrogate: PCB 011-13C Congener	0		% recovery					Organics	PCBs
PCB 012	PCB 12 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 012/13	PCB 12/13 Congener	0		pg/L	ug/Kg dw				Organics	PCBs
PCB 013	PCB 13 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 014	PCB 14 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 015	PCB 15 Congener	2050682		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 015(Surrogate)	Surrogate: PCB 15 Congener	0		% recovery	% recovery		% recovery	% recovery	Organics	PCBs
PCB 015-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 015-13C12	208263676		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 016	PCB 16 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 016/32	PCB 16/32 Congener	0		pg/L					Organics	PCBs
PCB 017	PCB 17 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 018	PCB 18 Congener	37680652		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 018/30	PCB 18/30 Congener	0		pg/L	ug/Kg ww				Organics	PCBs
PCB 019	PCB 19 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 019(Surrogate)	Surrogate: PCB 19 Congener	0		% recovery	% recovery		% recovery	% recovery	Organics	PCBs
PCB 019-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 019-13C12	234432872		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 020	PCB 20 Congener	38444800		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 020/21/33	PCB 020/21/33 Congener	0		ug/L					Organics	PCBs	Congeners
PCB 020/28	PCB 20/28 Congener	0		pg/L	ug/Kg ww				Organics	PCBs
PCB 021	PCB 21 Congener	55702500		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 021/33	PCB 21/33 Congener	0		pg/L	ug/Kg dw				Organics	PCBs
PCB 022	PCB 22 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 023	PCB 23 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 024	PCB 24 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 024/27	PCB 24/27 Congener	0		pg/L					Organics	PCBs
PCB 025	PCB 25 Congener	55712373		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 026	PCB 26 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 026/29	PCB 26/29 Congener	0		pg/L	ug/Kg dw				Organics	PCBs
PCB 027	PCB 27 Congener	38444767		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 028	PCB 28 Congener	7012375		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 028(Surrogate)	Surrogate: PCB 28 Congener	0		% recovery	% recovery		% recovery	% recovery	Organics	PCBs
PCB 028/31	PCB 28/31 Congener	0		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PCBs	Congeners
PCB 028-13C(Surrogate)	Surrogate: PCB 028-13C Congener	0		% recovery					Organics	PCBs
PCB 028-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 028-13C12	208263767		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 029	PCB 29 Congener	15862074		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 030	PCB 30 Congener	0		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 030(Surrogate)	Surrogate: PCB 30 Congener	35693926		ug/L	ng/g dw		% recovery	% recovery	Organics	PCBs	Congeners
PCB 031	PCB 31 Congener	16606023		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 031(Surrogate)	Surrogate: PCB 31 Congener	16606023		% recovery			% recovery	% recovery	Organics	PCBs	Congeners
PCB 031-13C(Surrogate)	Surrogate: PCB 31-13C Congener	0		% recovery					Organics
PCB 031-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 031-13C12	0		% recovery					Organics	PCBs	IDA
PCB 032	PCB 32 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 032-13C(Surrogate)	Surrogate: PCB 32-13C Congener	0		% recovery					Organics	PCBs	Congeners
PCB 032-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 32-13C12	0		% recovery					Organics	PCBs	IDA
PCB 033	PCB 33 Congener	38444869		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 034	PCB 34 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 035	PCB 35 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 036	PCB 36 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 037	PCB 37 Congener	38444905		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 037(Surrogate)	Surrogate: PCB 37 Congener	0		% recovery	% recovery		% recovery	% recovery	Organics	PCBs
PCB 037-13C(surrogate)	Surrogate: PCB 037-13C Congener	0		% recovery					Organics
PCB 037-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 037-13C12	208263790		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 038	PCB 38 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 039	PCB 39 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 040	PCB 40 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 040/41	PCB 40/41 Congener	0		pg/L	ug/Kg dw				Organics	PCBs
PCB 040/41/71	PCB 40/41/71 Congener	0		pg/L	ng/g nr
PCB 040/71	PCB 40/71 Congener	0		pg/L	ug/Kg dw				Organics	PCBs
PCB 041	PCB 41 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 041/64/71/72	PCB 041/64/71/72 Congener	0		pg/L					Organics	PCBs
PCB 041/71/40	PCB 41/71/40 Congener	0		pg/L
PCB 042	PCB 42 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 042/59	PCB 042/59 Congener	0		pg/L					Organics	PCBs
PCB 043	PCB 43 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 043/49	PCB 43/49 Congener	0		ug/L					Organics	PCBs	Congeners
PCB 043/73	PCB 43/73 Congener	0		pg/L
PCB 044	PCB 44 Congener	41464395		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 044/47	PCB 44/47 Congener	0		pg/L	ug/Kg ww				Organics	PCBs
PCB 044/47/65	PCB 44/47/65	0		pg/L	ng/g nr
PCB 044/65	PCB 44/65 Congener	0		pg/L	ug/Kg ww				Organics	PCBs
PCB 045	PCB 45 Congener	0		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 045/51	PCB 45/51 Congener	0		pg/L	ug/Kg ww				Organics	PCBs
PCB 046	PCB 46 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 047	PCB 47 Congener	0		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 047-13C(Surrogate)	Surrogate: PCB 47-13C Congener	0		% recovery					Organics	PCBs	Congeners
PCB 047-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 47-13C12	0		% recovery					Organics	PCBs	IDA
PCB 048	PCB 48 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 048/75	PCB 048/75 Congener	0		pg/L					Organics	PCBs
PCB 049	PCB 49 Congener	41464408		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 049/69	PCB 49/69 Congener	0		pg/L	ug/Kg ww				Organics	PCBs
PCB 050	PCB 50 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 050/53	PCB 50/53 Congener	0		pg/L	ug/Kg dw				Organics	PCBs
PCB 051	PCB 51 Congener	0		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 052	PCB 52 Congener	35693993		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 052/69	PCB 52/69 Congener	0		ug/L					Organics	PCBs	Congeners
PCB 052-13C(Surrogate)	Surrogate: PCB 052-13C Congener	0		% recovery					Organics	PCBs
PCB 052-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 52-13C12	208263803		% recovery					Organics	PCBs	IDA
PCB 053	PCB 53 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 054	PCB 54 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 054(Surrogate)	Surrogate: PCB 54 Congener	0		% recovery	% recovery		% recovery	% recovery	Organics	PCBs
PCB 054-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 054-13C12	234432883		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 055	PCB 55 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 056	PCB 56 Congener	41464431		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 056/60	PCB 56/60 Congener	0		ug/L	ug/g dw		ng/g ww	ng/g dw	Organics	PCBs	Congeners
PCB 057	PCB 57 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 058	PCB 58 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 059	PCB 59 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 059/62	PCB 59/62 Congener	0		pg/L	ug/Kg dw				Organics	PCBs
PCB 059/62/75	PCB 59/62/75 Congener	0		pg/L	ng/g nr
PCB 059/75	PCB 59/75 Congener	0		pg/L	ug/Kg dw				Organics	PCBs
PCB 060	PCB 60 Congener	33025411		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 061	PCB 61 Congener	33284500		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 061/70	PCB 61/70 Congener	0		ug/L	ug/Kg dw				Organics	PCBs	Congeners
PCB 061/70/74/76	PCB 61/70/74/76 Congener	0		pg/L	ng/g nr
PCB 061/74	PCB 61/74 Congener	0		pg/L					Organics	PCBs
PCB 061/76	PCB 61/76 Congener	0		pg/L					Organics	PCBs
PCB 062	PCB 62 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 063	PCB 63 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 064	PCB 64 Congener	52663588		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 065	PCB 65 Congener	33284500		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 065(Surrogate)	Surrogate: PCB 65 Congener	33284547			% recovery		% recovery	% recovery	Organics	PCBs	Congeners
PCB 066	PCB 66 Congener	32598100		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 066/76	PCB 66/76 Congener	0		ug/L					Organics	PCBs	Congeners
PCB 067	PCB 67 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 068	PCB 68 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 069	PCB 69 Congener	60233200		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 070	PCB 70 Congener	32598111		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 070/61/74/76	PCB 70/61/74/76 Congener	0		pg/L
PCB 070/74	PCB 070/74	0			ug/Kg dw				Organics	PCBs
PCB 070/76	PCB 070/76	0			ug/Kg dw				Organics	PCBs
PCB 070-13C(Surrogate)	Surrogate: PCB 70-13C Congener	0		% recovery					Organics	PCBs	Congeners
PCB 070-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 70-13C12	208263814		% recovery					Organics	PCBs	IDA
PCB 071	PCB 71 Congener	41464464		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 072	PCB 72 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 073	PCB 73 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 074	PCB 74 Congener	32690930		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 075	PCB 75 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 076	PCB 76 Congener	70362500		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 077	PCB 77 Congener	32598133		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 077 (TEQ ND=0)	PCB 077 (TEQ ND=0)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 077 (TEQ ND=1/2 DL)	PCB 077 (TEQ ND=1/2 DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 077 (TEQ ND=DL)	PCB 077 (TEQ ND=DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 077(Surrogate)	Surrogate: PCB 77 Congener	0		% recovery	% recovery		% recovery	% recovery	Organics	PCBs
PCB 077-13C(Surrogate)	Surrogate: PCB 77-13C Congener	0		% recovery					Organics	PCBs
PCB 077-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 077-13C12	105600235		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 078	PCB 78 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 079	PCB 79 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 079-13C(Surrogate)	Surrogate: PCB 79-13C Congener	0		% recovery					Organics	PCBs	Congeners
PCB 079-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 79-13C12	0		% recovery					Organics	PCBs	IDA
PCB 080	PCB 80 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 080-13C(Surrogate)	Surrogate: PCB 80-13C Congener	0		% recovery					Organics	PCBs	Congeners
PCB 080-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 80-13C12	0		% recovery					Organics	PCBs	IDA
PCB 081	PCB 81 Congener	70362504		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 081 (TEQ ND=0)	PCB 081 (TEQ ND=0)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 081 (TEQ ND=1/2 DL)	PCB 081 (TEQ ND=1/2 DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 081 (TEQ ND=DL)	PCB 081 (TEQ ND=DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 081(Surrogate)	Surrogate: PCB 81 Congener	0		% recovery	% recovery		% recovery	% recovery	Organics	PCBs
PCB 081-13C(surrogate)	Surrogate: PCB 081-13C Congener	0		% recovery					Organics
PCB 081-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 081-13C12	208461249		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 082	PCB 82 Congener	52663624		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 083	PCB 83 Congener	0		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 083/99	PCB 83/99 Congener	0		pg/L	ug/Kg ww				Organics	PCBs
PCB 084	PCB 84 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 084/92	PCB 084/92 Congener	0		pg/L					Organics	PCBs
PCB 085	PCB 85 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 085/110/115/116/117	PCB 85/110/115/116/117 Congener	0		pg/L					Organics	PCBs	Congeners
PCB 085/116	PCB 85/116 Congener	0		pg/L	ug/Kg dw				Organics	PCBs
PCB 085/116/117	PCB 85/116/117 Congener	0		pg/L	ng/g nr
PCB 085/117	PCB 85/117 Congener	0		pg/L	ug/Kg dw				Organics	PCBs
PCB 086	PCB 86 Congener	55312700		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 086/108	PCB 86/108 Congener	0		pg/L					Organics	PCBs
PCB 086/119	PCB 86/119 Congener	0		pg/L					Organics	PCBs
PCB 086/125	PCB 86/125 Congener	0		pg/L					Organics	PCBs
PCB 086/87	PCB 86/87 Congener	0		pg/L	ug/Kg ww				Organics	PCBs
PCB 086/87/97/109/119/125	PCB 86/87/97/109/119/125 Congener	0		pg/L	ng/g nr
PCB 086/97	PCB 86/97 Congener	0		pg/L					Organics	PCBs
PCB 087	PCB 87 Congener	38380028		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 087/108	PCB 087/108	0			ug/Kg ww				Organics	PCBs
PCB 087/117/125	PCB 87/117/125 Congener	0		ug/L					Organics	PCBs	Congeners
PCB 087/119	PCB 087/119	0			ug/Kg ww				Organics	PCBs
PCB 087/125	PCB 087/125	0			ug/Kg ww				Organics	PCBs
PCB 087/97	PCB 087/97	0			ug/Kg ww				Organics	PCBs
PCB 088	PCB 88 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 088/91	PCB 88/91 Congener	0		pg/L	ug/Kg dw				Organics	PCBs
PCB 089	PCB 89 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 090	PCB 90 Congener	68194100		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 090/101	PCB 90/101 Congener	0		ug/L	ug/Kg ww				Organics	PCBs
PCB 090/101/113	PCB 90/101/113 Congener	0		pg/L	ng/g nr
PCB 090/113	PCB 90/113 Congener	0		pg/L					Organics	PCBs
PCB 091	PCB 91 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 092	PCB 92 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 093	PCB 93 Congener	73575600		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 093/100	PCB 93/100 Congener	0		pg/L					Organics	PCBs
PCB 093/102	PCB 93/102 Congener	0		pg/L					Organics	PCBs
PCB 093/95	PCB 93/95 Congener	0		pg/L	ug/Kg ww				Organics	PCBs
PCB 093/95/100	PCB 93/95/100 Congener	0		pg/L
PCB 093/95/98/100/102	PCB 93/95/98/100/102 Congener	0		pg/L
PCB 093/98	PCB 93/98 Congener	0		pg/L					Organics	PCBs
PCB 093/98/100/102	PCB 93/98/100/102 Congener	0			ng/g nr
PCB 094	PCB 94 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 095	PCB 95 Congener	38379996		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 095(Surrogate)	Surrogate: PCB 95 Congener	38379996		% recovery			% recovery	% recovery	Organics	PCBs	Congeners
PCB 095/100	PCB 095/100	0			ug/Kg ww				Organics	PCBs
PCB 095/102	PCB 095/102	0			ug/Kg ww				Organics	PCBs
PCB 095/98	PCB 095/98	0			ug/Kg ww				Organics	PCBs
PCB 095/98/102	PCB 95/98/102 Congener	0		ug/L					Organics	PCBs	Congeners
PCB 095-13C(Surrogate)	Surrogate: PCB 095-13C Congener	0		% recovery					Organics	PCBs
PCB 095-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 095-13C12	0		% recovery					Organics	PCBs	IDA
PCB 096	PCB 96 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 097	PCB 97 Congener	41464511		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 097-13C(Surrogate)	Surrogate: PCB 97-13C Congener	0		% recovery					Organics	PCBs	Congeners
PCB 097-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 97-13C12	0		% recovery					Organics	PCBs	IDA
PCB 098	PCB 98 Congener	60233300		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 098/102	PCB 98/102 Congener	0		pg/L
PCB 099	PCB 99 Congener	38380017		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 100	PCB 100 Congener	39485800		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 101	PCB 101 Congener	37680732		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 101(Surrogate)	Surrogate: PCB 101 Congener	0		% recovery	% recovery		% recovery	% recovery	Organics	PCBs
PCB 101/113	PCB 101/113	0			ug/Kg ww				Organics	PCBs
PCB 101-13C(Surrogate)	Surrogate: PCB 101-13C Congener	0		% recovery					Organics	PCBs
PCB 101-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 101-13C12	104130394		% recovery					Organics	PCBs	IDA
PCB 102	PCB 102 Congener	68194100		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 103	PCB 103 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 104	PCB 104 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 104(Surrogate)	Surrogate: PCB 104 Congener	0		% recovery	% recovery		% recovery	% recovery	Organics	PCBs
PCB 104-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 104-13C12	234432894		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 105	PCB 105 Congener	32598144		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 105 (TEQ ND=0)	PCB 105 (TEQ ND=0)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 105 (TEQ ND=1/2 DL)	PCB 105 (TEQ ND=1/2 DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 105 (TEQ ND=DL)	PCB 105 (TEQ ND=DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 105(Surrogate)	Surrogate: PCB 105 Congener	0		% recovery	% recovery		% recovery	% recovery	Organics	PCBs
PCB 105-13C(Surrogate)	Surrogate: PCB 105-13C Congener	0		% recovery					Organics	PCBs
PCB 105-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 105-13C12	208263621		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 106	PCB 106 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 106/118	PCB 106/118 Congener	0		ug/L					Organics	PCBs	Congeners
PCB 107	PCB 107 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 107/109	PCB 107/109 Congener	0		pg/L					Organics	PCBs
PCB 107/124	PCB 107/124 Congener	0		pg/L	ug/Kg dw				Organics	PCBs
PCB 108	PCB 108 Congener	70362400		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 108/112	PCB 108/112 Congener	0		pg/L					Organics	PCBs
PCB 108/124	PCB 108/124 Congener	0		pg/L	ng/g nr
PCB 109	PCB 109 Congener	0		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 110	PCB 110 Congener	38380039		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 110/115	PCB 110/115 Congener	0		pg/L	ug/Kg ww				Organics	PCBs
PCB 110/151	PCB 110/151 Congener	0		ug/L					Organics	PCBs	Congeners
PCB 111	PCB 111 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 111(Surrogate)	Surrogate: PCB 111 Congener	0		% recovery	% recovery		% recovery	% recovery	Organics	PCBs
PCB 111/115	PCB 111/115 Congener	0		pg/L					Organics	PCBs
PCB 111-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 111-13C12	235416292		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 112	PCB 112 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 112(Surrogate)	Surrogate: PCB 112 Congener	74472369		ug/L	ng/g dw		% recovery	% recovery	Organics	PCBs	Congeners
PCB 113	PCB 113 Congener	68194100		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 114	PCB 114 Congener	74472370		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 114 (TEQ ND=0)	PCB 114 (TEQ ND=0)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 114 (TEQ ND=1/2 DL)	PCB 114 (TEQ ND=1/2 DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 114 (TEQ ND=DL)	PCB 114 (TEQ ND=DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 114(Surrogate)	Surrogate: PCB 114 Congener	0		% recovery	% recovery		% recovery	% recovery	Organics	PCBs
PCB 114-13C(surrogate)	Surrogate: PCB 114-13C Congener	0		% recovery					Organics
PCB 114-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 114-13C12	208263632		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 115	PCB 115 Congener	74472400		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 116	PCB 116 Congener	18259100		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 117	PCB 117 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 118	PCB 118 Congener	31508084		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 118 (TEQ ND=0)	PCB 118 (TEQ ND=0)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 118 (TEQ ND=1/2 DL)	PCB 118 (TEQ ND=1/2 DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 118 (TEQ ND=DL)	PCB 118 (TEQ ND=DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 118(Surrogate)	Surrogate: PCB 118 Congener	0		% recovery	% recovery		% recovery	% recovery	Organics	PCBs
PCB 118-13C(Surrogate)	Surrogate: PCB 118-13C Congener	0		% recovery					Organics	PCBs
PCB 118-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 118-13C12	104130407		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 119	PCB 119 Congener	56558179		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 120	PCB 120 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 121	PCB 121 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 122	PCB 122 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 123	PCB 123 Congener	65510443		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 123 (TEQ ND=0)	PCB 123 (TEQ ND=0)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 123 (TEQ ND=1/2 DL)	PCB 123 (TEQ ND=1/2 DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 123 (TEQ ND=DL)	PCB 123 (TEQ ND=DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 123(Surrogate)	Surrogate: PCB 123 Congener	0		% recovery	% recovery		% recovery	% recovery	Organics	PCBs
PCB 123-13C(Surrogate)	Surrogate: PCB 123-13C Congener	0		% recovery					Organics	PCBs
PCB 123-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 123-13C12	208263643		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 124	PCB 124 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 125	PCB 125 Congener	74472400		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 126	PCB 126 Congener	57465288		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 126 (TEQ ND=0)	PCB 126 (TEQ ND=0)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 126 (TEQ ND=1/2 DL)	PCB 126 (TEQ ND=1/2 DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 126 (TEQ ND=DL)	PCB 126 (TEQ ND=DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 126(Surrogate)	Surrogate: PCB 126 Congener	0		% recovery	% recovery		% recovery	% recovery	Organics	PCBs
PCB 126-13C(Surrogate)	Surrogate: PCB 126-13C Congener	0		% recovery					Organics	PCBs
PCB 126-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 126-13C12	208263654		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 127	PCB 127 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 127-13C(Surrogate)	Surrogate: PCB 127-13C Congener	0		% recovery					Organics	PCBs
PCB 128	PCB 128 Congener	38380073		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 128/162	PCB 128/162 Congener	0		ug/L					Organics	PCBs	Congeners
PCB 128/166	PCB 128/166	0		pg/L	ug/Kg ww				Organics	PCBs
PCB 128/167	PCB 128/167 Congener	0			ng/g dw				Organics	PCBs	Congeners
PCB 129	PCB 129 Congener	0		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 129/138	PCB 129/138 Congener	0		pg/L	ug/Kg ww				Organics	PCBs
PCB 129/138/163	PCB 129/138/163 Congener	0		pg/L	ng/g nr
PCB 129/160	PCB 129/160 Congener	0		pg/L					Organics	PCBs
PCB 129/163	PCB 129/163 Congener	0		pg/L					Organics	PCBs
PCB 129/166	PCB 129/166 Congener	0		pg/L					Organics	PCBs
PCB 130	PCB 130 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 131	PCB 131 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 131/133	PCB 131/133	0		pg/L					Organics
PCB 132	PCB 132 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 132/153	PCB 132/153	0		ug/L	ug/kg		ug/Kg ww	ug/Kg dw
PCB 132/161	PCB 132/161 Congener	0		ug/L					Organics	PCBs	Congeners
PCB 132/168	PCB 132/168 Congener	0		ug/L	ug/g dw				Organics	PCBs
PCB 133	PCB 133 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 134	PCB 134 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 134/143	PCB 134/143 Congener	0		pg/L	ug/Kg dw				Organics	PCBs
PCB 135	PCB 135 Congener	0		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 135/151	PCB 135/151 Congener	0		pg/L	ug/Kg ww				Organics	PCBs
PCB 135/151/154	PCB 135/151/154 Congener PCB 135/151/154	0		pg/L
PCB 135/154	PCB 135/154 Congener	0		pg/L					Organics	PCBs
PCB 136	PCB 136 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 137	PCB 137 Congener	35694065		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 138	PCB 138 Congener	35065282		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 138/158	PCB 138/158 Congener	0		ug/L	ng/g dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 138/160	PCB 138/160	0			ug/Kg ww				Organics	PCBs
PCB 138/163	PCB 138/163	0			ug/Kg ww				Organics	PCBs
PCB 138/163/164	PCB 138/163/164 Congener	0		ug/L					Organics	PCBs	Congeners
PCB 138-13C(Surrogate)	Surrogate: PCB 138-13C Congener	0		% recovery					Organics	PCBs
PCB 138-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 138-13C12	208263665		% recovery					Organics	PCBs	IDA
PCB 139	PCB 139 Congener	56030600		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 139/140	PCB 139/140 Congener	0		pg/L	ug/Kg dw				Organics	PCBs
PCB 139/149	PCB 139/149 Congener	0		ug/L					Organics	PCBs	Congeners
PCB 140	PCB 140 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 141	PCB 141 Congener	52712046		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 141-13C(Surrogate)	Surrogate: PCB 141-13C Congener	0		% recovery					Organics	PCBs	Congeners
PCB 141-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 141-13C12	0		% recovery					Organics	PCBs	IDA
PCB 142	PCB 142 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 143	PCB 143 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 144	PCB 144 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 145	PCB 145 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 146	PCB 146 Congener	51908168		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 146/165	PCB 146/165 Congener	0		pg/L					Organics	PCBs
PCB 147	PCB 147 Congener	68194100		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 147/149	PCB 147/149 Congener	0		pg/L	ug/Kg ww				Organics	PCBs
PCB 148	PCB 148 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 149	PCB 149 Congener	38380040		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 150	PCB 150 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 151	PCB 151 Congener	52663635		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 151/154	PCB 151/154	0			ug/Kg ww				Organics	PCBs
PCB 152	PCB 152 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 153	PCB 153 Congener	35065271		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 153(Surrogate)	Surrogate: PCB 153 Congener	35065271		% recovery			% recovery	% recovery	Organics	PCBs	Congeners
PCB 153/168	PCB 153/168 Congener	0		pg/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 153-13C(Surrogate)	Surrogate: PCB 153-13C Congener	0		% recovery					Organics	PCBs
PCB 153-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 153-13C12	185376583		% recovery					Organics	PCBs	IDA
PCB 154	PCB 154 Congener	60145200		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 155	PCB 155 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 155(Surrogate)	Surrogate: PCB 155 Congener	0		% recovery	% recovery		% recovery	% recovery	Organics	PCBs
PCB 155-13C(Surrogate)	Surrogate: PCB 155-13C Congener	0		% recovery					Organics	PCBs
PCB 155-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 155-13C12	34432907		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 156	PCB 156 Congener	38380084		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 156 (TEQ ND=0)	PCB 156 (TEQ ND=0)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 156 (TEQ ND=1/2 DL)	PCB 156 (TEQ ND=1/2 DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 156 (TEQ ND=DL)	PCB 156 (TEQ ND=DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 156(Surrogate)	Surrogate: PCB 156 Congener	0		% recovery	% recovery		% recovery	% recovery	Organics	PCBs
PCB 156/157	PCB 156/157 Congener	0		pg/L	ug/Kg ww				Organics	PCBs
PCB 156/157 (TEQ ND=0)	PCB 156/157 (TEQ ND=0)	0		pg/sample	ug/Kg dw				Organics	PCBs
PCB 156/157 (TEQ ND=1/2 DL)	PCB 156/157 (TEQ ND=1/2 DL)	0		pg/sample	ug/Kg dw				Organics	PCBs
PCB 156/157 (TEQ ND=DL)	PCB 156/157 (TEQ ND=DL)	0		pg/sample	ug/Kg dw				Organics	PCBs
PCB 156/157(Surrogate)	Surrogate: PCB 156/157	0		% recovery	% recovery				Organics	PCBs
PCB 156-13C(Surrogate)	Surrogate: PCB 156-13C Congener	0		% recovery					Organics	PCBs
PCB 156-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 156-13C12	208263687		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 157	PCB 157 Congener	69782907		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 157 (TEQ ND=0)	PCB 157 (TEQ ND=0)	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 157 (TEQ ND=1/2 DL)	PCB 157 (TEQ ND=1/2 DL)	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 157 (TEQ ND=DL)	PCB 157 (TEQ ND=DL)	0		pg/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 157(Surrogate)	Surrogate: PCB 157 Congener	0		% recovery	% recovery		% recovery	% recovery	Organics	PCBs
PCB 157-13C(surrogate)	Surrogate: PCB 157-13C Congener	0		% recovery					Organics
PCB 157-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 157-13C12	235416305		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 158	PCB 158 Congener	74472427		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 158/160	PCB 158/160 Congener	0		ug/L					Organics	PCBs	Congeners
PCB 159	PCB 159 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 159(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 159	0		% recovery					Organics	PCBs	IDA
PCB 159(Surrogate)	Surrogate: PCB 159 Congener	39635353		% recovery	% recovery		% recovery	% recovery	Organics	PCBs
PCB 159-13C(Surrogate)	Surrogate: PCB 159-13C Congener	0		% recovery					Organics	PCBs
PCB 159-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 159-13C12	0		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 160	PCB 160 Congener	41411600		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 161	PCB 161 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 162	PCB 162 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 163	PCB 163 Congener	74472400		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 164	PCB 164 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 165	PCB 165 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 166	PCB 166 Congener	41411600		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 167	PCB 167 Congener	52663726		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 167 (TEQ ND=0)	PCB 167 (TEQ ND=0)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 167 (TEQ ND=1/2 DL)	PCB 167 (TEQ ND=1/2 DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 167 (TEQ ND=DL)	PCB 167 (TEQ ND=DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 167(Surrogate)	Surrogate: PCB 167 Congener	0		% recovery	% recovery		% recovery	% recovery	Organics	PCBs
PCB 167-13C(surrogate)	Surrogate: PCB 167-13C Congener	0		% recovery					Organics
PCB 167-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 167-13C12	208263698		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 168	PCB 168 Congener	59291655		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 169	PCB 169 Congener	32774166		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 169 (TEQ ND=0)	PCB 169 (TEQ ND=0)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 169 (TEQ ND=1/2 DL)	PCB 169 (TEQ ND=1/2 DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 169 (TEQ ND=DL)	PCB 169 (TEQ ND=DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 169(Surrogate)	Surrogate: PCB 169 Congener	0		% recovery	% recovery		% recovery	% recovery	Organics	PCBs
PCB 169-13C(Surrogate)	Surrogate: PCB 169-13C Congener	0		% recovery					Organics	PCBs
PCB 169-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 169-13C12	208263701		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 170	PCB 170 Congener	35065306		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 170(Surrogate)	Surrogate: PCB 170 Congener	0		% recovery	% recovery		% recovery	% recovery	Organics	PCBs
PCB 170-13C(Surrogate)	Surrogate: PCB 170-13C Congener	0		% recovery					Organics	PCBs
PCB 170-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 170-13C12	160901804		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 171	PCB 171 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 171/173	PCB 171/173 Congener	0		pg/L	ug/Kg dw				Organics	PCBs
PCB 172	PCB 172 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 173	PCB 173 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 174	PCB 174 Congener	38411255		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 175	PCB 175 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 176	PCB 176 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 177	PCB 177 Congener	52663704		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 178	PCB 178 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 178(Surrogate)	Surrogate: PCB 178 Congener	0		% recovery	% recovery		% recovery	% recovery	Organics	PCBs
PCB 178-13C(Surrogate)	Surrogate: PCB 178-13C Congener	0		% recovery					Organics	PCBs
PCB 178-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 178-13C12	232919674		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 179	PCB 179 Congener	52663646		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 180	PCB 180 Congener	35065293		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 180(Surrogate)	Surrogate: PCB 180 Congener	0		% recovery	% recovery		% recovery	% recovery	Organics	PCBs
PCB 180/193	PCB 180/193 Congener	0		pg/L	ug/Kg ww				Organics	PCBs
PCB 180-13C(Surrogate)	Surrogate: PCB 180-13C Congener	0		% recovery					Organics	PCBs
PCB 180-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 180-13C12	160901826		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 181	PCB 181 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 182	PCB 182 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 182/187	PCB 182/187 Congener	0		ug/L					Organics	PCBs	Congeners
PCB 183	PCB 183 Congener	52663691		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 183/185	PCB 183/185 Congener	0		pg/L	ug/Kg ww				Organics	PCBs
PCB 184	PCB 174 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 185	PCB 185 Congener	0		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 186	PCB 176 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 187	PCB 187 Congener	52663680		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 188	PCB 188 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 188(Surrogate)	Surrogate: PCB 188 Congener	0		% recovery	% recovery		% recovery	% recovery	Organics	PCBs
PCB 188-13C(Surrogate)	Surrogate: PCB 188-13C Congener	0		% recovery					Organics	PCBs
PCB 188-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 188-13C12	234432918		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 189	PCB 189 Congener	39635319		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 189 (TEQ ND=0)	PCB 189 (TEQ ND=0)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 189 (TEQ ND=1/2 DL)	PCB 189 (TEQ ND=1/2 DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 189 (TEQ ND=DL)	PCB 189 (TEQ ND=DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 189(Surrogate)	Surrogate: PCB 189 Congener	0		% recovery	% recovery		% recovery	% recovery	Organics	PCBs
PCB 189-13C(surrogate)	Surrogate: PCB 189-13C Congener	0		% recovery					Organics
PCB 189-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 189-13C12	208263734		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 190	PCB 190 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 191	PCB 191 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 192	PCB 192 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 193	PCB 193 Congener	0		pg/sample	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 194	PCB 194 Congener	35694087		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 194-13C(Surrogate)	Surrogate: PCB 194-13C Congener	0		% recovery					Organics	PCBs
PCB 194-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 194-13C12	208263745		% recovery					Organics	PCBs	IDA
PCB 195	PCB 195 Congener	52663782		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 196	PCB 196 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 196/203	PCB 196/203 Congener	0		ug/L					Organics	PCBs
PCB 197	PCB 197 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 197/200	PCB 197/200 Congener	0		pg/L	ug/Kg dw				Organics	PCBs
PCB 198	PCB 198 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 198(Surrogate)	Surrogate: PCB 198 Congener	68194172		ug/L	ng/g dw		% recovery	% recovery	Organics	PCBs	Congeners
PCB 198/199	PCB 198/199 Congener	0		pg/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	PCBs	Congeners
PCB 199	PCB 199 Congener	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 199/200	PCB 199/200 Congener	0		ug/L	ug/g dw
PCB 200	PCB 200 Congener	52663737		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 201	PCB 201 Congener	40186718		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 202	PCB 202 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 202(Surrogate)	Surrogate: PCB 202 Congener	0		% recovery	% recovery		% recovery	% recovery	Organics	PCBs
PCB 202-13C(Surrogate)	Surrogate: PCB 202-13C Congener	0		% recovery					Organics	PCBs
PCB 202-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 202-13C12	105600268		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 203	PCB 203 Congener	52663760		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 204	PCB 204 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 205	PCB 205 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 205(Surrogate)	Surrogate: PCB 205 Congener	0		% recovery	% recovery		% recovery	% recovery	Organics	PCBs
PCB 205-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 205-13C12	234446641		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 206	PCB 206 Congener	40186729		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 206(Surrogate)	Surrogate: PCB 206 Congener	0		% recovery	% recovery		% recovery	% recovery	Organics	PCBs
PCB 206-13C(surrogate)	Surrogate: PCB 206-13C Congener	0		% recovery					Organics
PCB 206-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 206-13C12	208263756		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 207	PCB 207 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 207(Surrogate)	Surrogate: PCB 207 Congener	52663771		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	Congeners
PCB 208	PCB 208 Congener	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB 208(Surrogate)	Surrogate: PCB 208 Congener	0		% recovery	% recovery		% recovery	% recovery	Organics	PCBs
PCB 208-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 208-13C12	234432929		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 209	PCB 209 Congener (Decachlorobiphenyl) (DCB)	2051243		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 209(Surrogate)	Surrogate: PCB 209 Congener (Decachlorobiphenyl) (DCB)	2051243		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs	Congeners
PCB 209(Surrogate)DB-608	Surrogate: PCB 209 run on DB-608 (Decachlorobiphenyl) (DCB)	2051243		% recovery	% recovery				Organics	PCBs
PCB 209(Surrogate)HP-5	Surrogate: PCB 209 run on HP-5 (Decachlorobiphenyl) (DCB)	2051243		% recovery	% recovery				Organics	PCBs
PCB 209-13C(surrogate)	Surrogate: PCB 209-13C Congener	0		% recovery					Organics
PCB 209-13C12(IsoDilAnalogue)	Isotope Dilution Analogue: PCB 209-13C12	105600279		% recovery	% recovery		% recovery	% recovery	Organics	PCBs	IDA
PCB 209-L(Surrogate)	Surrogate: PCB 209 Congener (Decachlorobiphenyl) (DCB)-Labeled not defined	0		ug/L					Organics
PCB AROCLOR 1016	PCB Aroclor 1016	12674112		ug/L	ug/Kg ww		ng/g ww	ng/g dw	Organics	PCBs	Aroclors
PCB AROCLOR 1221	PCB Aroclor 1221	11104282		ug/L	ug/Kg ww		ng/g ww	ng/g dw	Organics	PCBs	Aroclors
PCB AROCLOR 1232	PCB Aroclor 1232	11141165		ug/L	ug/Kg ww		ng/g ww	ng/g dw	Organics	PCBs	Aroclors
PCB AROCLOR 1242	PCB Aroclor 1242	53469219		ug/L	ug/Kg ww		ng/g ww	ng/g dw	Organics	PCBs	Aroclors
PCB AROCLOR 1248	PCB Aroclor 1248	12672296		ug/L	ug/Kg ww		ng/g ww	ng/g dw	Organics	PCBs	Aroclors
PCB AROCLOR 1254	PCB Aroclor 1254	11097691		ug/L	ug/Kg ww		ng/g ww	ng/g dw	Organics	PCBs	Aroclors
PCB AROCLOR 1260	PCB Aroclor 1260	11096825		ug/L	ug/Kg ww		ng/g ww	ng/g dw	Organics	PCBs	Aroclors
PCB TOTAL (TEQ ND=0)	PCB TOTAL (TEQ ND=0)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB TOTAL (TEQ ND=1/2 DL)	PCB TOTAL (TEQ ND=1/2 DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCB TOTAL (TEQ ND=DL)	PCB TOTAL (TEQ ND=DL)	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
PCT AROCLOR 5432	Polychlorinated Terphenyl AROCLOR 5432	0			ug/Kg dw
PCT AROCLOR 5442	Polychlorinated Terphenyl AROCLOR 5442	0			ug/Kg dw
PCT AROCLOR 5460	Polychlorinated Terphenyl AROCLOR 5460	0			ug/Kg dw
PCT_DR	Percent dry channel	0	%						Bioassessment
PCT_FAST	Percent fast-water habitat of reach	0	%						Bioassessment
PCT_POOL	Percent pool habitat of reach	0	%						Bioassessment
PCT_RC	Percent concrete or asphalt streambed substrate physical-habitat metric	0	%						Bioassessment
PCT_SAFN	Percent sands and fines streambed substrate physical-habitat metric	0	%						Bioassessment
PCT_SLOW	Percent slow-water habitat of reach	0	%						Bioassessment
Pebble	Pebble	0			%				Inorganics	Conventionals	GrainSize
Pebulate	Pebulate (PEBC)	1114712		ug/L	ng/g dw				Organics	Pesticides	Pest-Carbamates
PeCDD, 1,2,3,7,8-	1,2,3,7,8-Pentachlorodibenzo-p-dioxin (PeCDD)	40321764		ug/L					Organics	PCDDs/PCDFs	Dioxins/Dibenzofurans
PECDD, 1,2,3,7,8- (TEQ ND=0)	1,2,3,7,8-PECDD (TEQ ND=0)	0		pg/L					Organics	Dioxins/Dibenzofurans
PECDD, 1,2,3,7,8- (TEQ ND=1/2 DL)	1,2,3,7,8-PECDD (TEQ ND=1/2 DL)	0		pg/L					Organics	Dioxins/Dibenzofurans
PeCDD, 1,2,3,7,8-(Surrogate)	Surrogate: 1,2,3,7,8-Pentachlorodibenzo-p-dioxin (PeCDD)	40321764		% recovery					Organics	PCDDs/PCDFs	Dioxins/Dibenzofurans
PeCDD-13C, 1,2,3,7,8-(Surrogate)	Surrogate: 1,2,3,7,8-Pentachlorodibenzo-p-dioxin-13C (PeCDD)	109719791		% recovery					Organics	PCDDs/PCDFs	Dioxins/Dibenzofurans
PeCDD-13C12, 1,2,3,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,7,8-PeCDD-13C12	109719791		% recovery					Organics	Dioxins/Dibenzofurans	IDA
PeCDF, 1,2,3,7,8-	1,2,3,7,8-Pentachlorodibenzofuran (PeCDF)	57117416		pg/L					Organics	PCDDs/PCDFs	Dioxins/Dibenzofurans
PECDF, 1,2,3,7,8- (TEQ ND=0)	1,2,3,7,8-PECDF (TEQ ND=0)	0		pg/L					Organics	Dioxins/Dibenzofurans
PECDF, 1,2,3,7,8- (TEQ ND=1/2 DL)	1,2,3,7,8-PECDF (TEQ ND=1/2 DL)	0		pg/L					Organics	Dioxins/Dibenzofurans
PeCDF, 1,2,3,7,8-(Surrogate)	Surrogate: 1,2,3,7,8-Pentachlorodibenzofuran (PeCDF)	57117416		% recovery					Organics	PCDDs/PCDFs	Dioxins/Dibenzofurans
PeCDF, 2,3,4,7,8-	2,3,4,7,8-Pentachlorodibenzofuran (PeCDF)	57117314		pg/L					Organics	PCDDs/PCDFs	Dioxins/Dibenzofurans
PECDF, 2,3,4,7,8- (TEQ ND=0)	2,3,4,7,8-PECDF (TEQ ND=0)	0		pg/L					Organics	Dioxins/Dibenzofurans
PECDF, 2,3,4,7,8- (TEQ ND=1/2 DL)	2,3,4,7,8-PECDF (TEQ ND=1/2 DL)	0		pg/L					Organics	Dioxins/Dibenzofurans
PeCDF, 2,3,4,7,8-(Surrogate)	Surrogate: 2,3,4,7,8-Pentachlorodibenzofuran (PeCDF)	57117314		% recovery					Organics	PCDDs/PCDFs	Dioxins/Dibenzofurans
PeCDF-13C12, 1,2,3,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,7,8-PeCDF-13C12	109719779		% recovery					Organics	Dioxins/Dibenzofurans	IDA
PeCDF-13C12, 2,3,4,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 2,3,4,7,8-PeCDF-13C12	116843028		% recovery					Organics	Dioxins/Dibenzofurans	IDA
Pen/Marker	Pen/Marker	0	pieces						Debris	Trash	Plastics	Toxic
Pendimethalin	Pendimethalin (Prowl)	40487421		ug/L	ug/Kg dw				Organics	Pesticides	Herbicides
Penicillin G	Penicillin G	0					ng/g ww	ng/g dw	Organics
Penicillin V	Penicillin V	0					ng/g ww	ng/g dw	Organics
Penoxsulam	Penoxsulam	219714962		ug/L					Organics	Pesticides	Herbicides
Pentachloroanisole	Pentachloroanisole	1825214		ng/L					Organics	Pesticides
Pentachlorobenzene	Pentachlorobenzene	0			ug/Kg dw
Pentachlorobenzene-13C6(IsoDilAnalogue)	Isotope Dilution Analogue: Pentachlorobenzene-13C6	2483735540			% recovery		% recovery	% recovery	Organics		IDA
Pentachloronitrobenzene	Pentachloronitrobenzene (PCNB)	82688		ug/L					Organics	Pesticides	Pest-OCHs	Algaecides	Fungicides	Nematocides
Pentachlorophenol	Pentachlorophenol	87865		ug/L	mg/Kg dw				Organics	SVOCs	Phenols	Chlorinated Phenols	Insecticides	Fungicides
Perchlorate	Perchlorate	14797730		ug/L	ug/kg				Inorganics	Conventionals
Perfluoro(2-ethoxyethane)sulfonic acid	Perfluoro(2-ethoxyethane)sulfonic acid (PFEESA)	113507827		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS
Perfluoro-2-Propoxypropanoic Acid	Perfluoro-2-Propoxypropanoic Acid	13252136		ng/L	ng/g dw		ng/g ww	ng/g dw
Perfluoro-2-Propoxypropanoic Acid-13C3(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluoro-2-Propoxypropanoic Acid-13C3 (HFPO-DA)	0		% recovery	% recovery		% recovery	% recovery	Organics		IDA
Perfluoro-2-Propoxypropanoic Acid-13C3(Surrogate)	Surrogate: Perfluoro-2-Propoxypropanoic Acid-13C3 (HFPO-DA)	0					% recovery	% recovery	Organics	PFAS
Perfluoro-3,6-dioxaheptanoate	Perfluoro-3,6-dioxaheptanoate (Nonafluoro-3,6-dioxaheptanoic acid) (NFDHA)	151772586		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS
Perfluoro-3-methoxypropanoate	Perfluoro-3-methoxypropanoate (Perfluoro-3-methoxypropanoic acid) (PFMPA)	377731		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS
Perfluoro-4-methoxybutanoate	Perfluoro-4-methoxybutanoate (Perfluoro-4-methoxybutanoic acid) (PFMBA)	863090895		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS
Perfluorobutanesulfonate	Perfluorobutanesulfonate	45187153		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	Perflouronate
Perfluorobutanesulfonate-13C3(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorobutanesulfonate-13C3 (PFBS)	0		% recovery	% recovery		% recovery	% recovery	Organics		IDA
Perfluorobutanesulfonate-13C3(Surrogate)	Surrogate: Perfluorobutanesulfonate-13C3 (PFBS)	0					% recovery	% recovery	Organics	PFAS
Perfluorobutanoate	Perfluorobutanoic Acid (PFBTA), (PFBA)	375224		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics
Perfluorobutanoate(Surrogate)	Surrogate: Perfluorobutanoic Acid (PFBTA), (PFBA)	375224		% recovery	% recovery		% recovery	% recovery	Organics
Perfluorobutanoate-13C4(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorobutanoate-13C4 (PFBTA) (PFBA)	0		% recovery	% recovery		% recovery	% recovery	Organics		IDA
Perfluorodecanesulfonate	Perfluorodecanesulfonate	126105348		ng/L	ng/g dw		ng/g ww	ng/g dw
Perfluorodecanoate	Perfluorodecanoic Acid (PFDA)	335762		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics
Perfluorodecanoate(Surrogate)	Surrogate: Perfluorodecanoic Acid (PFDA)	335762		% recovery	% recovery		% recovery	% recovery	Organics
Perfluorodecanoate-13C6(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorodecanoate-13C6 (PFDA)	0		ng/L	% recovery		% recovery	% recovery	Organics		IDA
Perfluorododecanesulfonate	Perfluorododecanesulfonate	0		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PFAS
Perfluorododecanoate	Perfluorododecanoic Acid (PFDoA)	307551		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics
Perfluorododecanoate(Surrogate)	Surrogate: Perfluorododecanoic Acid (PFDoA)	307551		% recovery	% recovery		% recovery	% recovery	Organics
Perfluorododecanoate-13C2(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorododecanoate-13C2 (PFDoA)	0		% recovery	% recovery		% recovery	% recovery	Organics		IDA
Perfluoroheptanesulfonate	Perfluoroheptanesulfonate	375928		ng/L	ng/g dw		ng/g ww	ng/g dw
Perfluoroheptanoate	Perfluoroheptanoic Acid (PFHpA)	375859		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics
Perfluoroheptanoate-13C4(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluoroheptanoate-13C4 (PFHpA)	0		% recovery	% recovery		% recovery	% recovery	Organics		IDA
Perfluoroheptanoate-13C4(Surrogate)	Surrogate: Perfluoroheptanoate-13C4 (PFHpA)	0					% recovery	% recovery	Organics	PFAS
Perfluorohexanesulfonate	Perfluorohexanesulfonate	108427538		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	Perflouronate
Perfluorohexanesulfonate-13C3(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorohexanesulfonate-13C3 (PFHxS)	0		% recovery	% recovery		% recovery	% recovery	Organics		IDA
Perfluorohexanesulfonate-13C3(Surrogate)	Surrogate: Perfluorohexanesulfonate-13C3 (PFHxS)	0					% recovery	% recovery	Organics	PFAS
Perfluorohexanesulfonate-18O2(Surrogate)	Surrogate: Perfluorohexanesulfonate-18O2	0		% recovery					Organics
Perfluorohexanoate	Perfluorohexanoic Acid (PFHxA)	307244		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics
Perfluorohexanoate(Surrogate)	Surrogate: Perfluorohexanoic Acid (PFHxA)	307244		% recovery	% recovery		% recovery	% recovery	Organics
Perfluorohexanoate-13C5(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorohexanoate-13C5 (PFHxA)	0		% recovery	% recovery		% recovery	% recovery	Organics		IDA
Perfluorononanesulfonate	Perfluorononanesulfonate	0		ng/L	ng/g dw		ng/g ww	ng/g dw
Perfluorononanoate	Perfluorononanoic Acid (PFNA)	375951		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics
Perfluorononanoate(Surrogate)	Surrogate: Perfluorononanoic Acid (PFNA)	375951		% recovery	% recovery		% recovery	% recovery	Organics
Perfluorononanoate-13C9(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorononanoate-13C9 (PFNA)	0		% recovery	% recovery		% recovery	% recovery	Organics		IDA
Perfluorooctanesulfonamide	Perfluorooctanesulfonamide	0		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	Perflouronate
Perfluorooctanesulfonamide-13C8(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorooctanesulfonamide-13C8 (PFOSA)	0		% recovery	% recovery		% recovery	% recovery	Organics		IDA
Perfluorooctanesulfonamide-13C8(Surrogate)	Surrogate: Perfluorooctanesulfonamide-13C8	0					% recovery	% recovery	Organics	PFAS
Perfluorooctanesulfonate	Perfluorooctanesulfonate	45298906		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	Perflouronate
Perfluorooctanesulfonate 080(Surrogate)	Surrogate: Perfluorooctanesulfonate 080 (PFOS)	45298906		% recovery	% recovery		% recovery	% recovery	Organics
Perfluorooctanesulfonate-13C8(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorooctanesulfonate-13C8 (PFOS)	0		% recovery	% recovery		% recovery	% recovery	Organics		IDA
Perfluorooctanesulfonic acid (PFOS)	Perfluorooctanesulfonic acid (PFOS)	0		ng/L					Organics	PFAS
Perfluorooctanesulfonic acid-13C8(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorooctanesulfonic acid-13C8 (PFOS)	0		% recovery					Organics		IDA
Perfluorooctanoate	Perfluorooctanoic Acid (PFOA)	335671		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics
Perfluorooctanoate(Surrogate)	Surrogate: Perfluorooctanoic Acid (PFOA)	335671		% recovery	% recovery		% recovery	% recovery	Organics
Perfluorooctanoate-13C8(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorooctanoate-13C8 (PFOA)	0		% recovery	% recovery		% recovery	% recovery	Organics		IDA
Perfluorooctanoate-13C8(Surrogate)	Surrogate: Perfluorooctanoate-13C8	0					% recovery	% recovery	Organics	Perflouronate
Perfluorooctanoic acid (PFOA)	Perfluorooctanoic acid (PFOA)	0		ng/L					Organics	PFAS
Perfluorooctanoic acid-13C2(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorooctanoic acid-13C2 (PFOA)	0		% recovery					Organics		IDA
Perfluoropentanesulfonate	Perfluoropentanesulfonate	0		ng/L	ng/g dw		ng/g ww	ng/g dw
Perfluoropentanoate	Perfluoropentanoic Acid (PFPeA)	2706903		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics
Perfluoropentanoate-13C5(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluoropentanoate-13C5 (PFPA) (PFPeA)	0		% recovery	% recovery		% recovery	% recovery	Organics		IDA
Perfluoropentanoate-13C5(Surrogate)	Surrogate: Perfluoropentanoate-13C5 (PFPA) (PFPeA)	0					% recovery	% recovery	Organics	PFAS
Perfluorotetradecanoate	Perfluorotetradecanoate	376067		ng/L	ng/g dw		ng/g ww	ng/g dw
Perfluorotetradecanoate-13C2(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluorotetradecanoate-13C2 (PFTeDA) (PFTA)	0		% recovery	% recovery		% recovery	% recovery	Organics		IDA
Perfluorotetradecanoate-13C2(Surrogate)	Surrogate: Perfluorotetradecanoate-13C2 (PFTeDA) (PFTA)	0					% recovery	% recovery	Organics	PFAS
Perfluorotridecanoate	Perfluorotridecanoate	72629948		ng/L	ng/g dw		ng/g ww	ng/g dw
Perfluoroundecanoate	Perfluoroundecanoic Acid (PFUnA)	2058948		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics
Perfluoroundecanoate-13C7(IsoDilAnalogue)	Isotope Dilution Analogue: Perfluoroundecanoate-13C7 (PFUnDA) (PFUdA)	0		% recovery	% recovery		% recovery	% recovery	Organics		IDA
Perfluoroundecanoate-13C7(Surrogate)	Surrogate: Perfluoroundecanoate-13C7 (PFUnDA) (PFUdA)	0					% recovery	% recovery	Organics	PFAS
Permethrin, cis-	cis-Permethrin, formerly peak 1	54774457		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Permethrin, cis-(Surrogate)	Surrogate: cis-Permethrin	0		% recovery					Organics	Pesticides	Pyrethroids	Insecticides
Permethrin, Total	Total Permethrin, sum peaks cis and trans (formerly 1 & 2)	52645531		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Permethrin, trans-	trans-Permethrin formerly peak 2	51877748		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Permethrin-13C6, cis-(Surrogate)	Surrogate: cis-Permethrin-13C6	0		ng/L	% recovery				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Perthane	Perthane	72560		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OCHs
Perylene	Perylene	198550		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH
Perylene-d12(IsoDilAnalogue)	Isotope Dilution Analogue: Perylene-d12	1520963		% recovery					Organics	PAHs	IDA
Perylene-d12(Surrogate)	Surrogate: Perylene-d12	1520963		ng/L	ng/g dw		ng/g ww	ng/g dw	Organics	PAHs	SVOCs	HMW_PAH
pH	pH	0		none	none				WaterQualityMeasurements	ToxTreatment
Phenanthrene	Phenanthrene	85018		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH	Endocrine Disruptors
Phenanthrene/Anthracene, C1-	C1-Phenanthrene/Anthracene	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH
Phenanthrene/Anthracene, C2-	C2-Phenanthrene/Anthracene	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH
Phenanthrene/Anthracene, C3-	C3-Phenanthrene/Anthracene	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH
Phenanthrene/Anthracene, C4-	C4-Phenanthrene/Anthracene	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH
Phenanthrene-d10(IsoDilAnalogue)	Isotope Dilution Analogue: Phenanthrene-d10	1517222		% recovery					Organics	PAHs	IDA
Phenanthrene-d10(Surrogate)	Surrogate: Phenanthrene-d10	1517222		% recovery	ng/g dw		ng/g ww	ng/g dw	Organics	PAHs	SVOCs	LMW_PAH	Endocrine Disruptors
Phenol	Phenol	108952		ug/L	ug/kg				Organics	SVOCs	Phenols	non-Chlorinated Phenols
Phenol-d5(Surrogate)	Surrogate: Phenol-d5	0		ug/L					Organics	SVOCs
Phenol-d6(Surrogate)	Surrogate: Phenol-d6	13127883		ug/L					Organics	SVOCs	Phenols	non-Chlorinated Phenols
Phenolics, Total	Total Phenolics, classification of phenols	0		ug/L					Organics	PPCPs
Phenothrin	Phenothrin	26002802		ug/L	ug/Kg dw				Organics	PPCPs
Phenytoin	Phenytoin	57410		ng/L
Pheophytin a	Pheophytin a	603178		ug/L					Inorganics	Conventionals	Benthic
Phone	Phone	0	pieces						Debris	Trash	Plastics	Toxic
Phorate	Phorate	298022		ug/L	ug/g dw				Organics	Pesticides	Pest-OPs	Insecticides	Nematocides
Phosalone	Phosalone	2310170		ug/L					Organics	Pesticides	Pest-OPs	Insecticides
Phosmet	Phosmet	732116		ug/L	ng/g dw				Organics	Pesticides	Pest-OPs	Insecticides
Phosphamidon	Phosphamidon	13171216		ug/L	ng/g dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides
Phosphate as P	Phosphate as P	14265442		mg/L					Inorganics	Conventionals	Nutrients	WaterQualityMeasurements
Phosphorus as P	Phosphorus as P	7723140		ug/L	ug/g dw				Inorganics	Conventionals	Nutrients
Picloram	Picloram	1918021		ug/L					Organics	Herbicides
Picoxystrobin	Picoxystrobin	117428225		ng/L					Organics	Pesticides	Fungicides
PictureCode	Picture code idenifier	0	none						FieldObservations	Habitat
Pipe, PVC	Pipe, PVC	0	pieces						Debris	Trash	Plastics	Household
Piperonyl Butoxide	Piperonyl Butoxide	51036		ug/L	ng/g dw				Organics	Pesticides	Pest-Pyrethroids	Insecticides
Pipes, Drains	Pipes, Drains	0	none						Habitat
Pirimiphos Methyl	Pirimiphos Methyl	29232937		ug/L					Organics	Pesticides	Insecticides
Plastic	Plastic using Trash Protocol	0	pieces						Trash
Plastic MicroDebris, > 4.75 mm	Plastic MicroDebris, > 4.75 mm	0	pieces						Debris	Plastics
Plastic MicroDebris, 0.355 mm	Plastic MicroDebris, 0.355 mm	0	pieces						Debris	Plastics
Plastic MicroDebris, 0.500 mm	Plastic MicroDebris, 0.500 mm	0	pieces						Debris	Plastics
Plastic MicroDebris, 1.0 mm	Plastic MicroDebris, 1.0 mm	0	pieces						Debris	Plastics
Plastic MicroDebris, 2.0 mm	Plastic MicroDebris, 2.0 mm	0	pieces						Debris	Plastics
Plastic MicroDebris, 4.75 mm	Plastic MicroDebris, 4.75 mm	0	pieces						Debris	Plastics
Plastic MicroDebris, Black	Plastic MicroDebris, Black	0	pieces						Debris	Plastics
Plastic MicroDebris, Blue	Plastic MicroDebris, Blue	0	pieces						Debris	Plastics
Plastic MicroDebris, Clear	Plastic MicroDebris, Clear	0	pieces						Debris	Plastics
Plastic MicroDebris, Green	Plastic MicroDebris, Green	0	pieces						Debris	Plastics
Plastic MicroDebris, Grey	Plastic MicroDebris, Grey	0	pieces						Debris	Plastics
Plastic MicroDebris, Orange	Plastic MicroDebris, Orange	0	pieces						Debris	Plastics
Plastic MicroDebris, Peach	Plastic MicroDebris, Peach	0	pieces						Debris	Plastics
Plastic MicroDebris, Pink	Plastic MicroDebris, Pink	0	pieces						Debris	Plastics
Plastic MicroDebris, Red	Plastic MicroDebris, Red	0	pieces						Debris	Plastics
Plastic MicroDebris, Tan	Plastic MicroDebris, Tan	0	pieces						Debris	Plastics
Plastic MicroDebris, White	Plastic MicroDebris, White	0	pieces						Debris	Plastics
Plastic MicroDebris, Yellow	Plastic MicroDebris, Yellow	0	pieces						Debris	Plastics
Plastic, Other	Plastic, Other	0	pieces						Debris	Trash	Plastics	Bags/Packaging
Plate, Waxed Paper	Plate, Waxed Paper	0	pieces						Debris	Trash	Plastics	FoodService
Ponded	Ponded water that either evaporates and/or infiltrates and does not flow to a surface receiving water	0	none						Habitat
Pool	Pool	0	%						Habitat
Pool Form	Pool Form	0	none						Habitat
Position	Position along transect where sample collected	0	none						Habitat
Potassium	Potassium	7440097		ug/L	mg/Kg nr				Inorganics	TraceElements	Metals	Conventionals
Potential Non-Stormwater Source	Potential Non-Stormwater Source	0	none
Poultry	Poultry	0	none						Habitat
Power Plants	Power Plants	0	none						Habitat
Prallethrin	Prallethrin	0		ug/L	ug/Kg dw				Organics	PPCPs
Precipitation	Precipitation	0	none						FieldObservations	Habitat
PrecipitationLast24hrs	PrecipitationLast24hrs	0	none						FieldObservations	Habitat
Precipitationlast72hrs	Precipitation within the last 72 hours	0	none
Primidone	Primidone	125337		ng/L
Primitive Parks, Camping	Primitive Parks, Camping	0	none						Habitat
Procymidone	Procymidone	32809168		ug/L					Organics	Pesticides
Prodiamine	Prodiamine	29091212		ug/L					Organics
Profenofos	Profenofos	41198087		ug/L					Organics	Pesticides
Profluralin	Profluralin	26399360		ug/L					Organics	Pesticides	Herbicides
Progesterone	Progesterone	0		ng/L
Progesterone-d9(IsoDilAnalogue)	Isotope Dilution Analogue: Progesterone-d9	15775743		% recovery					Organics		IDA
Prometon	Prometon	1610180		ug/L					Organics	Pesticides	Pest-Triazines	Herbicides
Prometryn	Prometryn	7287196		ug/L	ng/g dw				Organics	Pesticides	Pest-Triazines	Herbicides
Pronamide	Pronamide (Propyzamide)	23950585		ug/L					Organics	Herbicides
Propachlor	Propachlor	1918167		ug/L					Organics	Pesticides	Pest-Carbamates	Herbicides
Propanil	Propanil	709988		ug/L					Organics	Pesticides	Herbicides
Propargite	Propargite	2312358		ug/L					Organics	Pesticides	Pest-OPs	Acaricides
Propazine	Propazine	139402		ug/L					Organics	Pesticides	Pest-Triazines	Herbicides
Propham	Propham	122429		ug/L					Organics	Pesticides	Pest-Carbamates	Herbicides
Propiconazole	Propiconazole	60207901		ug/L					Organics	Herbicides
Proportion	Proportion	0	%						Habitat
Propoxur	Propoxur	114261		ug/L	ug/Kg dw				Organics	Pesticides	Pest-Carbamates	Insecticides
Propylbenzene, n-	n-Propylbenzene	103651		ug/L					Organics	VOCs
Propyzamide	Propyzamide	23950585		ng/L					Organics	Pesticides	Herbicides
p-Terphenyl-d14(Surrogate)	Surrogate: p-Terphenyl-d14	0		% recovery			ng/g ww	ng/g dw	Organics
Public Access	Public Access	0	none						Habitat	Debris
Pymetrozin	Pymetrozin	123312890		ug/L					Organics	Pesticides
Pyraclostrobin	Pyraclostrobin	175013180		ug/L					Organics	Fungicides
Pyrene	Pyrene	129000		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	HMW_PAH
Pyrene-d10(Surrogate)	Surrogate: Pyrene-d10	1718521		% recovery	% recovery		ng/g ww	ng/g dw	Organics	PAHs	SVOCs	HMW_PAH
Pyrethrin-1	Pyrethrin-1	121211		ug/L	ng/g dw				Organics	Pesticides	Pest-Pyrethroids
Pyrethrin-2	Pyrethrin-2 (Pyrethrin II)	121299		ug/L	ng/g dw				Organics	Pesticides	Pest-Pyrethroids
Pyridaben	Pyridaben	96489713		ug/L					Organics	Pesticides	Insecticides
Pyridine	Pyridine	0		ug/L					Organics	SVOCs
Pyrimethanil	Pyrimethanil	53112280		ng/L					Organics	Pesticides	Fungicides
Quinoxyfen	Quinoxyfen	124495187		ng/L					Organics	Pesticides	Fungicides
Radium-226	Radium-226	13982633		pCi/L					Radiochemisty
Radium-228	Radium-228	0		pCi/L
Rapid	Rapid	0	%						Habitat
Rebar	Rebar	0	pieces						Debris	Trash	Non-Plastics	Metal
Reproduction	Reproduction	0				Num/Rep			Toxicity
Residences	Residences	0	none						Habitat
Residential Dumping	Residential Dumping	0	none						Habitat
Resmethrin	Resmethrin	0		ug/L	ug/Kg dw				Organics	PPCPs
Retene	Retene	0		ng/L	% recovery		% recovery	% recovery	Organics	PAHs
Ribbon, Non-plastic	Ribbon, Non-plastic	0	pieces						Debris	Trash	Non-Plastics	Household
Ribbon, Packaging	Ribbon, Packaging	0	pieces						Debris	Trash	Plastics	Miscellaneous
Riffle	Riffle	0	%						Habitat
Riffle/Run Bank Stability	Riffle/Run Bank Stability (used for EMAP RBP 20-score habitat characterization)	0	none						Habitat
Riffle/Run Channel Alteration	Riffle/Run Channel Alteration	0	none						Habitat
Riffle/Run Channel Flow Status	Riffle/Run Channel Flow Status	0	none						Habitat
Riffle/Run Embeddedness	Riffle/Run Embeddedness	0	none						Habitat
Riffle/Run Epifaunal Substrate	Riffle/Run Epifaunal Substrate	0	none						Habitat
Riffle/Run Frequency	Riffle/Run Frequency	0	none						Habitat
Riffle/Run Riparian Zone Width	Riffle/Run Riparian Zone Width	0	none						Habitat
Riffle/Run Sediment Deposition	Riffle/Run Sediment Deposition	0	none						Habitat
Riffle/Run Vegetative Protection	Riffle/Run Vegetative Protection	0	none						Habitat
Riffle/Run Velocity/Depth Regime	Riffle/Run Velocity/Depth Regime scale data	0	none						Habitat
Rimsulfuron	Rimsulfuron	122931480		ug/L					Organics	Pesticides	Herbicides
Riparian Bridges/Abutments	Riparian Bridges/Abutments	0	none						Habitat
Riparian Buildings	Riparian Buildings	0	none						Habitat
Riparian Canopy Big Trees	EMAP BA Specific - Riparian Canopy Big Trees (Trunk > 0.3m DBH)	0	none						Habitat
Riparian Canopy Small Trees	EMAP BA Specific - Riparian Canopy Small Trees (Trunk < 0.3 m DBH)	0	none						Habitat
Riparian Canopy Veg Type	Riparian Canopy Vegetation Type	0	none						Habitat
Riparian Corridor Shading	Percent of stream's water surface upstream of sample location estimated to be shaded if the sun was directly over the stream	0	%						FieldObservations	Habitat
Riparian Cover Metric	Metric assesses total vegetation cover in the riparian and channel zones (excluding low-flow) and includes any kind of tree, bush, shrub, or helophyte.	0	score						Habitat
Riparian GroundCover Barren	Riparian Ground Cover Barren, Bare Dirt or Duff	0	none						Habitat
Riparian GroundCover NonWoody Plants	Riparian Ground Cover Non-woody Herbs, Grasses & Forbes	0	none						Habitat
Riparian GroundCover Woody Shrubs	Riparian Ground Cover Woody Shrubs & Saplings	0	none						Habitat
Riparian Landfill/Trash	Riparian Landfill/Trash	0	none						Habitat
Riparian Logging	Riparian Logging Operations	0	none						Habitat
Riparian Lower Canopy All Vegetation	Riparian Lower Canopy All Vegetation (merge of Riparian Understory Non-Woody Plants and Riparian Understory Woody Shrubs in EMAP BA)	0	none						Habitat
Riparian Mining	Riparian Mining Activity	0	none						Habitat
Riparian Orchards/Vineyards	Riparian Orchards/Vineyards	0	none						Habitat
Riparian Park/Lawn	Riparian Park/Lawn	0	none						Habitat
Riparian Pasture/Range	Riparian Pasture/Range/Hay field	0	none						Habitat
Riparian Pavement	Riparian Pavement/Cleared Lot	0	none						Habitat
Riparian Pipes	Riparian Piles (Inlet/Outlet)	0	none						Habitat
Riparian Powerline	Human disturbance measure for powerlines	0	none						Habitat
Riparian Road	Riparian Road/Railroad	0	none						Habitat
Riparian Row Crops	Riparian Row Crops	0	none						Habitat
Riparian Sub Condition/Vert Connectivity Metric	Metric assesses riparian substratum condition influencing natural infiltration capacity and vertical connectivity affecting alluvial permeability, subsurface flows and groundwater connectivity.	0	score						Habitat
Riparian Trail	Human disturbance measure for trails	0	none						Habitat
Riparian Understory NonWoody Plants	EMAP BA specific - Riparian Understory Non-woody Herbs, Grasses & Forbes	0	none						Habitat
Riparian Understory Veg Type	Riparian Understory Vegetation Type	0	none						Habitat
Riparian Understory Woody Shrubs	EMAP BA Specific - Riparian Understory Woody Shrubs & Saplings	0	none						Habitat
Riparian Upper Canopy All Trees	Riparian Upper Canopy All Trees (merge of Riparian Canopy Big Trees and Small Trees in EMAP BA)	0	none						Habitat
Riparian Upper Canopy Deciduous	Riparian Upper Canopy Deciduous	0	none						Habitat
Riparian Upper Canopy Evergreen	Riparian Upper Canopy Evergreen	0	none						Habitat
Riparian Vegetation Management	Riparian Vegetation Management	0	none						Habitat
Riparian Vegetation Width Metric	Metric assesses the average width of the defined riparian zone along the assessment area.	0	score						Habitat
Riparian Wall/Dike	Riparian Wall/Dike/Revetment/Riprap/Dam	0	none						Habitat
RipRAM Index	Riparian Rapid Assessment Method (RAM) for California index score based on the average score of eight component metrics.	0	score						Habitat
RisingGroundwater	Rising groundwater (i.e., a spring) that is the source of water in a receiving water and may contribute (or even define) the receiving water quality	0	none						Habitat
Roads	Roads	0	none						Habitat
Rope, Polypropylene	Rope, Polypropylene	0	pieces						Debris	Trash	Plastics	Miscellaneous
Rope/Tie	Rope/Tie	0	pieces						Debris	Trash	Plastics	Miscellaneous
Roxithromycin	Roxithromycin	80214831		ug/L			ng/g ww	ng/g dw	Organics	PPCPs
Rubber Materials (Non-Specific)	Rubber Materials (Non-Specific)	0	pieces						Debris	Trash	Non-Plastics	Construction
Rubber Piece	Rubber Piece	0	pieces						Debris	Trash	Plastics	Miscellaneous
Run	Run	0	%						Habitat
Safrotin	Safrotin	77491306		ug/L					Organics	Pesticides	Insecticides
Salicylic Acid	Salicylic Acid	0		ng/L
Salicylic Acid-d4(IsoDilAnalogue)	Isotope Dilution Analogue: Salicylic Acid-d4	78646170		% recovery					Organics		IDA
Salinity	Salinity	0		psu					WaterQualityMeasurements	Conventionals	Inorganics
Salmonella	Salmonella	0		none					Microbiological	Pathogens	Conventional
Salmonella-invA	Salmonella-invA	0		copies/100 mL					Microbiological	Pathogens	Conventional
Salmonella-ttr	Salmonella-ttr	0		copies/100 mL					Microbiological	Pathogens	Conventional
Sand	Sand	0		%	%				Inorganics	Conventionals	GrainSize
Sarafloxacin	Sarafloxacin	0					ng/g ww	ng/g dw	Organics
Saxitoxins	Saxitoxins	0		ug/L					Microbiological	Cyanotoxins
Scandium	Scandium	7440202		ug/L					Inorganics
Seagrass	Seagrass	0	pieces						Debris	Natural	Non-Plastics	Marine Origin
SeaState	SeaState	0	none						FieldObservations	Habitat
Secbumeton	Secbumeton	26259450		ug/L					Organics	Pesticides	Pest-Triazines	Herbicides
Secchi Depth	Measurement of clarity based on the depth at which the Secchi disk can be differentiated	0		m					WaterQualityMeasurements
Sedaxane	Sedaxane	874967676		ng/L					Organics	Pesticides	Fungicides
Selenate as Se	Selenate as Se (Se VI)	0		ug/L					Inorganics	Conventionals
Selenite as Se	Selenite as Se (Se IV)	0		ug/L					Inorganics	Conventionals
Selenium	Selenium	7782492		ug/L	ug/g dw		ug/g ww	ug/g dw	Inorganics	TraceElements	Metals
Sethoxydim	Sethoxydim	74051802		ug/L					Organics	Pesticides	Herbicides
Settleable Solids	Settleable Solids	0		mL/L/hr					Inorganics	Conventionals
Sewage Treatment	Sewage Treatment	0	none						Habitat
Shade	Amount of shade within the algae sampling area (1 m2)	0	%						Habitat
Shoe	Shoe	0	pieces						Debris	Trash	Non-Plastics	Household
Shopping Cart	Shopping Cart	0	pieces						Debris	Trash	Non-Plastics	Large
Side Channel	Side Channel present	0	none						Habitat
Siduron	Siduron	1982496		ug/L					Organics	Pesticides	Pest-Carbamates	Herbicides
Silica as SiO2	Silica as SiO2	14808607		ug/L					Inorganics	Conventionals	Habitat
Silicate as Si	Silicate as Si (Si(OH)4)	0		mg/L					Inorganics	Conventionals
Silicon	Silicon	7440213		mg/L
Silt	Silt	0		%	%				Inorganics	Conventionals	GrainSize
Silt + Clay	Silt + Clay	0			%				Inorganics	Conventionals
Silver	Silver	7440224		ug/L	ug/g dw		ug/g ww	ug/g dw	Inorganics	TraceElements	Metals
Simazine	Simazine	122349		ug/L	ng/g dw				Organics	Pesticides	Pest-Triazines	Herbicides	Algaecides	Endocrine Disruptors
Simazine(Surrogate)	Surrogate: Simazine	122349		% recovery					Organics	Pesticides	Pest-Triazines
Simetryn	Simetryn	1014706		ug/L					Organics	Pesticides	Pest-Triazines	Herbicides
Sinuosity	Ratio of the curvilinear length along a stream and the Euclidean (straight line) distance between two points along the stream	0	none						Habitat
Site Length	Site Length	0	m						Habitat	Debris
Site Width	Site Width	0	m						Habitat	Debris
SkyCode	SkyCode	0	none						FieldObservations	Habitat
Slope	Slope	0	%						Habitat
SOD	Sediment Oxygen Demand (SOD)	0			mg/Kg dw
Sodium	Sodium	7440235		ug/L					Inorganics	Conventionals	Metals
Soft Plastic Piece, non-specific	Soft Plastic Piece, non-specific	0	pieces						Debris	Trash	Plastics	Bags/Packaging
Soft Sediment	Soft Sediment; indicates presence/absence of soft/small sediment at the point where depth is measured	0	none						Habitat
Soot	Soot/Black Carbon	0			%
SpecificConductivity	Specific Conductivity	0		uS/cm					WaterQualityMeasurements	Conventionals	Inorganics
Sports Ball	Sports Ball	0	pieces						Debris	Trash	Plastics	Household
Spray Paint Can	Spray Paint Can	0	pieces						Debris	Trash	Non-Plastics	Toxic
StationWaterDepth	Depth of waterbody where sample was collected	0	m	ft					Habitat
StationWaterDepth_Avg	Estimated average depth of the waterbody at the time of sampling	0	cm						Habitat
StationWaterDepth_Max	Estimated maximum depth of the waterbody at the time of sampling	0	cm						Habitat
Stick/Branch/Driftwood	Stick/Branch/Driftwood	0	pieces						Debris	Natural	Non-Plastics	Marine Origin
Straw	Straw	0	pieces						Debris	Trash	Plastics	FoodService
Stream Confinement	Confinement based upon the valley width in relation to average bankfull width which the riverine system can migrate without encountering a hillside, terrace or other feature	0	none						Habitat
StreamBankCharacteristics_Concrete	StreamBankCharacteristics_Concrete	0	none						Habitat	Debris
StreamBankCharacteristics_Earthen	StreamBankCharacteristics_Earthen	0	none						Habitat	Debris
StreamBankCharacteristics_RipRap	StreamBankCharacteristics_RipRap	0	none						Habitat	Debris
StreamBankCharacteristics_Sloped	StreamBankCharacteristics_Sloped	0	none						Habitat	Debris
StreamBankCharacteristics_Vegetated	StreamBankCharacteristics_Vegetated	0	none						Habitat	Debris
StreamBankCharacteristics_Vertical	StreamBankCharacteristics_Vertical	0	none						Habitat	Debris
StreamBedCharacteristics_Concrete	StreamBedCharacteristics_Concrete	0	none						Habitat	Debris
StreamBedCharacteristics_Earthen	StreamBedCharacteristics_Earthen	0	none						Habitat	Debris
StreamBedCharacteristics_Rock	StreamBedCharacteristics_Rock	0	none						Habitat	Debris
StreamBedCharacteristics_SubPlants	StreamBedCharacteristics_SubPlants	0	none						Habitat	Debris
StreamMixing	Classification of stream mixing by stratification, well-mixed or poorly mixed	0	none						FieldObservations	Habitat
StreamWidth	StreamWidth	0	m						FieldObservations	Habitat
Strontium	Strontium	7440246		ug/L	ug/g dw		ug/g ww	ug/g dw	Inorganics	Metals
Strontium-87/Strontium-86 Ratio	Strontium-87/Strontium-86 Ratio	0		per mil					Isotopes
Strontium-90	Strontium-90	0		pCi/L
Styrene	Styrene	100425		ug/L					Organics	VOCs
Styrofoam Pellet	Styrofoam Pellet	0	pieces						Debris	Trash	Plastics	Bags/Packaging
SubreachesFished	Subreaches fished within a given waterbody	0	none						Habitat
Substrate Modifier	Substrate Modifier	0	none						Habitat
Substrate Size Class	Substrate Size Class	0	none						Habitat
Sucralose	Sucralose	56038132		ng/L
Sulfachloropyridazine	Sulfachloropyridazine	80320		ug/L			ng/g ww	ng/g dw	Organics	PPCPs
Sulfadiazine	Sulfadiazine	68359					ng/g ww	ng/g dw	Organics
Sulfadimethoxine	Sulfadimethoxine	122112		ug/L			ng/g ww	ng/g dw	Organics	PPCPs
Sulfallate	Sulfallate (CDEC)	95067		ug/L					Organics	Pesticides	Herbicides
Sulfamerazine	Sulfamerazine	127797		ug/L			ng/g ww	ng/g dw	Organics	PPCPs
Sulfamethazine	Sulfamethazine	57681		ug/L			ng/g ww	ng/g dw	Organics	PPCPs
Sulfamethazine-13C6(Surrogate)	Surrogate: Sulfamethazine-13C6	77643915		% recovery			% recovery	% recovery	Organics	PPCPs
Sulfamethizole	Sulfamethizole	144821		ug/L			ng/g ww	ng/g dw	Organics	PPCPs
Sulfamethoxazole	Sulfamethoxazole	723466		ug/L			ng/g ww	ng/g dw	Organics	PPCPs
Sulfamethoxazole-13C6(Surrogate)	Surrogate: Sulfamethoxazole-13C6	0					% recovery	% recovery	Organics
Sulfanilamide	Sulfanilamide	0					ng/g ww	ng/g dw	Organics
Sulfate	Sulfate	14808798		mg/L	mg/Kg nr				Inorganics	Conventionals	Nutrients
Sulfathiazole	Sulfathiazole	72140		ug/L			ng/g ww	ng/g dw	Organics	PPCPs
Sulfide, Total	Total Sulfide	0		mg/L	mg/Kg dw				WaterQualityMeasurements
Sulfometuron Methyl	Sulfometuron Methyl	74222972		ug/L					Organics	Herbicides
Sulfotep	Sulfotepp	3689245		ug/L	ng/g dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides
Sum of DDTs (RWQCB3)	Sum of DDD, DDE, and DDT (RWQCB3)	0			ug/Kg dw				Organics
Sum of HPAHs (Integral)	Sum of HPAHs (Integral)	0			ug/kg
Sum of LPAHs (Integral)	Sum of LPAHs (Integral)	0			ug/kg
Surface Films	Surface Films	0	none						Habitat
SurfaceAreaOfMax	Estimate of the current surface area size as a fraction of the total surface area the waterbody would have at high water stage	0	%						Habitat
SurfacewaterConnect	Discharge from an outfall that does or does not flow to and have hydrologic continuity with a surface receiving water and has or does not have the potential to contribute to the quality of the surface receiving water quality	0	none						Habitat
Survival	Survival (%)	0				%			Toxicity
Suspended Sediment Concentration	Suspended Sediment Concentration (SSC)	0		mg/L					Inorganics	Conventionals
Suspended Sediment Discharge	Suspended Sediment Discharge	0		tons/day					Inorganics
Swim Normally	Swim Normally (Num/Rep)	0				Num/Rep			Toxicity
Syringe/Pipette	Syringe/Pipette	0	pieces						Debris	Trash	Plastics	Toxic
Tape	Tape	0	pieces						Debris	Trash	Plastics	Household
Tarp	Tarp	0	pieces						Debris	Trash	Plastics	Household
TCDD, 2,3,7,8-	2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD)	1746016		ug/L					Organics	Dioxins/Dibenzofurans
TCDD, 2,3,7,8- (TEQ ND=0)	2,3,7,8-TCDD (TEQ ND=0)	0		pg/L					Organics	Dioxins/Dibenzofurans
TCDD, 2,3,7,8- (TEQ ND=1/2 DL)	2,3,7,8-TCDD (TEQ ND=1/2 DL)	0		pg/L					Organics	Dioxins/Dibenzofurans
TCDD, 2,3,7,8-(Surrogate)	Surrogate: 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD)	1746016		% recovery					Organics	Dioxins/Dibenzofurans
TCDD-13C, 2,3,7,8-(Surrogate)	Surrogate: 2,3,7,8-Tetrachlorodibenzo-p-dioxin-13C (TCDD)	156712		% recovery					Organics	PCDDs/PCDFs	Dioxins/Dibenzofurans
TCDD-13C12, 2,3,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 2,3,7,8-TCDD-13C12	76523405		% recovery					Organics	Dioxins/Dibenzofurans	IDA
TCDD-13C6, 1,2,3,4-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,4-TCDD-13C6	116865588		% recovery					Organics	Dioxins/Dibenzofurans	IDA
TCDD-13C6, 1,2,3,4-(Surrogate)	Surrogate: 1,2,3,4-Tetrachlorodibenzo-p-dioxin-13C6 (TCDD)	30746588		% recovery					Organics	Dioxins/Dibenzofurans
TCDD-37Cl, 2,3,7,8-(Surrogate)	Surrogate: 2,3,7,8-Tetrachlorodibenzo-p-dioxin-37Cl (TCDD)	0		% recovery					Organics	Dioxins/Dibenzofurans
TCDD-37Cl14, 2,3,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 2,3,7,8-TCDD-37Cl14	85508505		% recovery					Organics	Dioxins/Dibenzofurans	IDA
TCDF, 2,3,7,8-	2,3,7,8-Tetrachlorodibenzofuran (TCDF)	51207319		pg/L					Organics	Dioxins/Dibenzofurans
TCDF, 2,3,7,8- (TEQ ND=0)	2,3,7,8-TCDF (TEQ ND=0)	0		pg/L					Organics	Dioxins/Dibenzofurans
TCDF, 2,3,7,8- (TEQ ND=1/2 DL)	2,3,7,8-TCDF (TEQ ND=1/2 DL)	0		pg/L					Organics	Dioxins/Dibenzofurans
TCDF, 2,3,7,8-(Surrogate)	Surrogate: 2,3,7,8-Tetrachlorodibenzofuran (TCDF)	51207319		% recovery					Organics	Dioxins/Dibenzofurans
TCDF-13C12, 2,3,7,8-(IsoDilAnalogue)	Isotope Dilution Analogue: 2,3,7,8-TCDF-13C12	89059461		% recovery					Organics	Dioxins/Dibenzofurans	IDA
TCDF-2C, 2,3,7,8-	2,3,7,8-TCDF-2C	0		pg/L					Organics	Dioxins/Dibenzofurans
Tebuconazole	Tebuconazole (Folicur)	107534963		ug/L					Organics	Fungicides
Tebupirimfos	Tebupirimfos	96182535		ng/L					Organics	Pesticides	Insecticides
Tebupirimfos oxon	Tebupirimfos oxon	1035330369		ng/L					Organics	Pesticides
Tebuthiuron	Tebuthiuron	34014181		ug/L					Organics	Pesticides	Pest-OPs
Tebuthiuron(Surrogate)	Surrogate: Tebuthiuron	0		% recovery	% recovery				Organics
Tedion	Tedion (Tetradifon)	116290		ug/L	ng/g dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OCHs
Tefluthrin	Tefluthrin	79538322		ng/L	ug/Kg dw				Pyrethroid Pesticides
Television	Television	0	pieces						Debris	Trash	Non-Plastics	Large
Temephos	Temephos	3383968		ug/L					Organics	PPCPs
Temperature	Temperature	0		Deg C					WaterQualityMeasurements	Conventionals
Terbacil	Terbacil	5902512		ug/L					Organics	Herbicides
Terbufos	Terbufos	13071799		ug/L					Organics	Pesticides	Pest-OPs	Insecticides	Nematocides	Nematocides
Terbuthylazine	Terbuthylazine	5915413		ug/L					Organics	Pesticides	Pest-Triazines	Herbicides
Terbutryn	Terbutryn	886500		ug/L					Organics	Pesticides	Pest-Triazines	Herbicides
Terphenyl-d14	Terphenyl-d14	0		ug/L
Terphenyl-d14(Surrogate)	Surrogate: Terphenyl-d14	1718510		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	SVOCs
Tert-amyl Methyl Ether	Tert-amyl Methyl Ether	994058		ug/L					Organics	VOCs
Tert-butyl Alcohol	Tert-butyl Alcohol	75630		ug/L					Organics	VOCs
Testosterone	Testosterone	0		ng/L
Testosterone-d3(IsoDilAnalogue)	Isotope Dilution Analogue: Testosterone-d3	77546395		% recovery					Organics		IDA
Tetrabutyltin as Sn	Tetrabutyltin as Sn	0			ug/Kg dw				Organics
Tetrachlorobenzene, 1,2,3,4-	1,2,3,4-Tetrachlorobenzene	634662			ug/Kg dw
Tetrachlorobenzene, 1,2,3,4-(Surrogate)	Surrogate: 1,2,3,4-Tetrachlorobenzene	634662		% recovery	% recovery		% recovery	% recovery	Organics	Semi-VOAs
Tetrachlorobenzene, 1,2,3,5/1,2,4,5-	1,2,3,5/1,2,4,5-Tetrachlorobenzene	0			ug/Kg dw
Tetrachlorobenzene-13C6,1,2,3,4-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3,4-Tetrachlorobenzene-13C6	2483735528			% recovery		% recovery	% recovery	Organics		IDA
Tetrachloroethane, 1,1,1,2-	1,1,1,2-Tetrachloroethane	630206		ug/L					Organics	VOCs
Tetrachloroethane, 1,1,2,2-	1,1,2,2-Tetrachloroethane	76345		ug/L					Organics	VOCs
Tetrachloroethylene	Tetrachloroethylene, Tetrachloroethene	127184		ug/L					Organics	VOCs	Insecticides
Tetrachloro-m-xylene(Surrogate)	Surrogate: Tetrachloro-m-xylene (TCMX)	877098		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs
Tetrachlorophenol, 2,3,4,5-	2,3,4,5-Tetrachlorophenol	4901513		ug/L					Organics	SVOCs	Phenols	Chlorinated Phenols
Tetrachlorophenol, 2,3,4,6-	2,3,4,6-Tetrachlorophenol	58902		ug/L	mg/Kg dw				Organics	SVOCs	Phenols	Chlorinated Phenols
Tetrachlorophenol, 2,3,5,6-	2,3,5,6-Tetrachlorophenol	935955		ug/L					Organics	SVOCs	Phenols	Chlorinated Phenols
Tetrachlorvinphos	Tetrachlorvinphos (Stirofos)	22248799		ug/L	ug/g dw				Organics	Pesticides	Pest-OPs	Insecticides
Tetraconazole	Tetraconazole (1-[2-(2,4-Dichlorophenyl)-3-(1,1,2,2-tetrafluoroethoxy)propyl]- 1H-1,2,4-triazole) Tetraconazole (1-[2-(2,4-Dichlorophenyl)-3-(1,1,2,2-tetrafluoroethoxy)propyl]- 1H-1,2,4-triazole)	112281773		ug/L					Organics	Fungicides
Tetracosane, n-	n-Tetracosane	0		mg/L
Tetracosane, n-(Surrogate)	Surrogate: n-Tetracosane	0		% recovery
Tetracycline	Tetracycline	60548		ug/L					Organics	PPCPs
Tetradifon	Tetradifon	0		ng/L					Organics	Pesticides
Tetraethyl Pyrophosphate	Tetraethyl Pyrophosphate (TEPP)	107493		ug/L					Organics	Pesticides	OrganophosphatePest.
Tetramethrin	Tetramethrin	7696120		ug/L	ug/Kg dw				Organics	PPCPs
Tetramethylnaphthalene, 1,4,6,7-	1,4,6,7-Tetramethylnaphthalene	13764186		ng/L					Organics	PAHs
Tetryl	Tetryl	479458		ug/L	ug/kg				Organics
T-Fluvalinate	T-Fluvalinate	102851069		ug/L	ng/g dw				Organics
Thallium	Thallium	7440280		ug/L	ug/g dw		ug/g ww	ug/g dw	Inorganics	Metals
Thiabendazole	Thiabendazole	148798		ug/L			ng/g ww	ng/g dw	Organics	Pesticides	Fungicides
Thiabendazole-d6(Surrogate)	Surrogate: Thiabendazole-d6	0					% recovery	% recovery	Organics
Thiacloprid	Thiacloprid	111988499		ug/L	ng/g dw				Organics	Pesticides	Insecticides
Thiamethoxam	Thiamethoxam	153719234		ug/L	ng/g dw				Organics	Pesticides	Insecticides
Thiamethoxam-d3(Surrogate)	Surrogate: Thiamethoxam-d3	0		% recovery	% recovery
Thiazopyr	Thiazopyr	117718602		ng/L					Organics	Pesticides	Herbicides
Thiobencarb	Thiobencarb (Benthiocarb) (Bolero)	28249776		ug/L	ng/g dw				Organics	Pesticides	Pest-OPs
Thiobencarb(Surrogate)	Surrogate: Thiobencarb (Benthiocarb) (Bolero)	28249776		% recovery					Organics
Thionazin	Thionazin (Thionzin)	297972		ug/L	ng/g dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs
Tidal Height	Tidal Height	0	none						Habitat
Tidal State	Tidal State	0	none						FieldObservations	Habitat
TidalDirection	TidalDirection	0	none						Habitat
Time, Fishing	Time spent fishing within a given waterbody	0	mins						Habitat
Time, Shock	Time spent electroshocking within a given waterbody	0	seconds						Habitat
TimeToSpinTest	Time the velocity meter spins during QA/QC calibration checks	0							WaterQualityMeasurements
Tin	Tin	7440315		ug/L	ug/g dw		ug/g ww	ug/g dw	Inorganics	Metals
Tire	Tire	0	pieces						Debris	Trash	Non-Plastics	Construction
Titanium	Titanium	7440326		ug/L	ug/g dw		ug/g ww	ug/g dw	Inorganics	Metals
Tokuthion	Tokuthion (Prothiofos)	34643464		ug/L	ug/g dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides
Tolfenpyrad	Tolfenpyrad	129558765		ng/L					Organics	Pesticides	Insecticides
Toluene	Toluene	108883		ug/L					Organics	VOCs	MTBE_BTEX
Toluene-d8(Surrogate)	Surrogate: Toluene-d8	2037265		% recovery					Organics	VOCs	MTBE_BTEX
Toothbrush	Toothbrush	0	pieces						Debris	Trash	Plastics	Household
Torrent 01	Torrent 01 - Recently devegetated corridor two or more times the width of the low flow channel	0	none						Habitat
Torrent 02	Torrent 02 - Substrate cobbles or large gravel particles are not imbricated	0	none						Habitat
Torrent 03	Torrent 03 - Channel has little evidence of pool-riffle structure	0	none						Habitat
Torrent 04	Torrent 04 - Stream channel is scoured down to bedrock	0	none						Habitat
Torrent 05	Torrent 05 - Gravel and cobble berms above bankfull level	0	none						Habitat
Torrent 06	Torrent 06 - Massive deposits downstream of reach	0	none						Habitat
Torrent 07	Torrent 07 - Riparian trees have fresh bark scars	0	none						Habitat
Torrent 08	Torrent 08 - Riparian trees have fallen into channel as a result of scouring near their roots	0	none						Habitat
Torrent 09	Torrent 09 - Massive deposits of sediment, logs and debris within reach	0	none						Habitat
Torrent 10	Torrent 10 - Newly erroded deposits show evidence that the deposits are matrix supported	0	none						Habitat
Torrent 11	Torrent 11 - No evidence of torrent scouring or torrent deposits	0	none						Habitat
Total Anions	Total Anions	0		mg/L					Inorganics
Total Cations	Total Cations	0		mg/L					Inorganics
Total Cell Count	Total Cell Count	0				cells/ml			Toxicity
Total Chlordanes	Total Chlordanes	0			ug/Kg dw
Total DDDs	Total DDDs	0			ug/Kg dw				Organics	Pesticides
Total DDEs	Total DDEs	0			ug/Kg dw				Organics	Pesticides
Total DDTs	Total DDTs	0		ug/L	ug/Kg dw				Organics	Pesticides
Total Debris, >2.5 cm	Total Debris >2.5 cm	0	L						Debris	Debris	Trash	Plastics
Total Debris, 2.5 cm - 5 mm	Total Debris 2.5 cm - 5 mm	0	L						Debris	Debris	Trash	Plastics
Total Dichlorobiphenyls	Total Dichlorobiphenyls	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
Total Dioxins-Furans (TEQ ND=0)	Total Dioxins-Furans (TEQ ND=0 DL)	0		pg/L					Organics	Dioxins/Dibenzofurans
Total Dioxins-Furans (TEQ ND=1/2 DL)	Total Dioxins-Furans (TEQ ND=1/2 DL)	0		pg/L					Organics	Dioxins/Dibenzofurans
Total Di-PCB	Total Di-PCB	0		pg/L					Organics	PCBs
Total Dissolved Solids	Total Dissolved Solids	0		mg/L					Inorganics	Conventionals
Total HCHs	Total HCHs	0		ug/L					Organics	Pesticides
Total Heptachlorobiphenyls	Total Heptachlorobiphenyls	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
Total Hepta-Dioxins	Total Hepta-Dioxins	37871004		pg/L					Organics	Dioxins/Dibenzofurans
Total Hepta-Furans	Total Hepta-Furans	38998753		pg/L					Organics	Dioxins/Dibenzofurans
Total Hepta-PCB	Total Hepta-PCB	0		pg/L					Organics	PCBs
Total Hexachlorobiphenyls	Total Hexachlorobiphenyls	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
Total Hexa-Dioxins	Total Hexa-Dioxins	34465468		pg/L					Organics	Dioxins/Dibenzofurans
Total Hexa-Furans	Total Hexa-Furans	55684941		pg/L					Organics	Dioxins/Dibenzofurans
Total Hexa-PCB	Total Hexa-PCB	0		pg/L					Organics	PCBs
Total Monochlorobiphenyls	Total Monochlorobiphenyls	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
Total Mono-PCB	Total Mono-PCB	0		pg/L					Organics	PCBs
Total Nonachlorobiphenyls	Total Nonachlorobiphenyls	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
Total Nona-PCB	Total Nona-PCB	0		pg/L					Organics	PCBs
Total Octachlorobiphenyls	Total Octachlorobiphenyls	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
Total Octa-PCB	Total Octa-PCB	0		pg/L					Organics	PCBs
Total Organic Carbon	Total Organic Carbon (TOC)	0		mg/L	mg/Kg ww				Inorganics	Conventionals
Total Organic Matter	Includes all the elements (hydrogen, oxygen, nitrogen, etc) that are components of organic compounds, not just carbon.	0			% dw
Total PAHs	Total PAHs	0		ug/L	ug/kg				Organics
Total PCBs	Total PCBs	0		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
Total Pentachlorobiphenyls	Total Pentachlorobiphenyls	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
Total Penta-Dioxins	Total Penta-Dioxins	36088229		pg/L					Organics	Dioxins/Dibenzofurans
Total Penta-Furans	Total Penta-Furans	30402154		pg/L					Organics	Dioxins/Dibenzofurans
Total Penta-PCB	Total Penta-PCB	0		pg/L					Organics	PCBs
Total Pyrethrins	Total Pyrethrins	0		ug/L					Organics	Pesticides
Total Solids	Total Solids	0		mg/L	mg/Kg dw		% ww	% dw	Inorganics	Conventionals
Total Suspended Solids	Total Suspended Solids	0		mg/L					Inorganics	Conventionals
Total TEQ (WHO 2005; ND=0)	Total TEQ (WHO 2005; ND=0)	0		pg/L
Total TEQ (WHO 2005; ND=1/2DL)	Total TEQ (WHO 2005; ND=1/2DL)	0		pg/L					Organics
Total Tetrachlorobiphenyls	Total Tetrachlorobiphenyls	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
Total Tetra-Dioxins	Total Tetra-Dioxins	41903575		pg/L					Organics	Dioxins/Dibenzofurans
Total Tetra-Furans	Total Tetra-Furans	30402143		pg/L					Organics	Dioxins/Dibenzofurans
Total Tetra-PCB	Total Tetra-PCB	0		pg/L					Organics	PCBs
Total Trichlorobiphenyls	Total Trichlorobiphenyls	0		pg/sample	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PCBs
Total Tri-PCB	Total Tri-PCB	0		pg/L					Organics	PCBs
TotalPieces	Total Pieces of Trash using Trash Protocol	0	pieces						Trash
Toxaphene	Toxaphene	8001352		ug/L	ug/Kg ww		ug/Kg ww	ug/Kg dw	Organics	Pesticides	Pest-OCHs	Insecticides
Toxic	Toxic using Trash Protocol	0	L						Trash
Toxic, Other	Toxic, Other	0	pieces						Debris	Trash	Plastics	Toxic
Toy	Toy	0	pieces						Debris	Trash	Plastics	Household
TPH as Diesel C10-C22	TPH as Diesel C10-C22	0		ug/L					Organics	SVOCs
TPH as Diesel C10-C24	TPH as Diesel C10-C24	0		ug/L					Organics	SVOCs
TPH as Diesel C10-C25	TPH as Diesel C10-C25	0		mg/L					Organics	SVOCs
TPH as Diesel C10-C28	TPH as Diesel C10-C28	0		ug/L	ug/g dw				Organics	SVOCs
TPH as Diesel C12-C24	TPH as Diesel C12-C24	0		ug/L					Organics	SVOCs
TPH as Diesel C13-C28	TPH as Diesel C13-C28	0		ug/L					Organics	SVOCs
TPH as Gasoline C3-C13	TPH as Gasoline C3-C13	0		mg/L					Organics	SVOCs
TPH as Gasoline C6-C10	TPH as Gasoline C6-C10	0		ug/L					Organics	SVOCs
TPH as Gasoline C6-C12	TPH as Gasoline C6-C12	0		ug/L					Organics	SVOCs
TPH as Heavy Fuel Oils C22-C36	TPH as Heavy Fuel Oils C22-C36	0		mg/L					Organics	SVOCs
TPH as JP8 C7-C18	TPH as JP8 C7-C18	0		mg/L					Organics	SVOCs
TPH as Motor Oil C21-C32	TPH as Motor Oil C21-C32	0		ug/L					Organics	SVOCs
TPH as Motor Oil C23-C36	TPH as Motor Oil C23-C36	0		ug/L					Organics	SVOCs
TPH as Motor Oil C24-C36	TPH as Motor Oil C24-C36	0		ug/L					Organics	SVOCs
TPH as Motor Oil C24-C40	TPH as Motor Oil C24-C40	0		ug/L					Organics	SVOCs
TPH as Motor Oil C25-C36	TPH as Motor Oil C25-C36	0		mg/L					Organics	SVOCs
TPH as Motor Oil C29-C40	TPH as Motor Oil C29-C40	0		ug/L					Organics	SVOCs
TPH as Oil C29-C44	TPH as Oil C29-C44	0		mg/L					Organics	SVOCs
Tralomethrin	Tralomethrin	66841256		ug/L					Organics	Pesticides	Insecticides	Pyrethroids
TransectsSampled	Number of transects sampled to attain sample material	0	count						Habitat
Transmittance	Transmittance	0		%					Inorganics	Conventionals	WaterQualityMeasurements
Transparency	Transparency	0		cm					FieldObservations	Habitat
Trash at >96" Drain	Trash at >96" Drain	0	none						Debris	Trash
Trash at 12" Drain	Trash at 12" Drain	0	none						Debris	Trash
Trash at 18" Drain	Trash at 18" Drain	0	none						Debris	Trash
Trash at 24" Drain	Trash at 24" Drain	0	none						Debris	Trash
Trash at 30" Drain	Trash at 30" Drain	0	none						Debris	Trash
Trash at 36" Drain	Trash at 36" Drain	0	none						Debris	Trash
Trash at 48" Drain	Trash at 48" Drain	0	none						Debris	Trash
Trash at 60" Drain	Trash at 60" Drain	0	none						Debris	Trash
Trash, Litter	Trash, Litter	0	none						Habitat
Tree_Diameter	Diameter at breast height of the largest potential legacy tree visible from the location	0	m						Habitat
Tree_Distance	Distance from the wetted edge to the largest potential legacy tree visible from the location	0	m						Habitat
Tree_Height	Height of the largest potential legacy tree visible from the location	0	m						Habitat
Tree_TaxonomicCategoryCode	Taxonomic Category Code of the largest potential legacy tree visible from the location	0	none						Habitat
Triadimefon	Triadimefon	43121433		ng/L					Organics	Pesticides	Fungicides
Triadimenol	Triadimenol	55219653		ng/L					Organics	Pesticides	Fungicides
Triallate	Triallate	2303175		ng/L					Organics	Pesticides	Herbicides
Tribromophenol, 2,4,6-	2,4,6-Tribromophenol	0		ug/L
Tribromophenol, 2,4,6-(Surrogate)	Surrogate: 2,4,6-Tribromophenol	118796		ug/L					Organics	SVOCs	Phenols	non-Chlorinated Phenols	Brominated Phenols
Tributyl Phosphorotrithioate, S,S,S-	S,S,S-Tributyl Phosphorotrithioate (Def) (Butifos) (Merphos)	78488		ug/L					Organics	Pesticides	Pest-OPs
Tributylphosphate	Tributylphosphate (TBP)	0		ug/L
Tributylphosphate(Surrogate)	Surrogate: Tributylphosphate (Butyl Phosphate)	126738		% recovery	% recovery				Organics	Pesticides	Pest-OPs
Tributyltin as Sn	Tributyltin as Sn (TBT)	1461229		ug/L	ug/Kg dw		ng/g ww	ng/g dw	Organics	Organotins	Biocide
Tributyltin as Sn-d27(Surrogate)	Surrogate: Tributyltin as Sn-d27	0		% recovery	% recovery				Organics	Organotins	Biocide
Trichlorfon	Trichlorfon	52686		ug/L					Organics	Pesticides	Pest-OPs	Insecticides
Trichloro-1,2,2-trifluoroethane, 1,1,2-	1,1,2-Trichloro-1,2,2-trifluoroethane	79131		ug/L					Organics	VOCs
Trichloro-2-pyridinyl)oxy)acetic Acid, ((3,5,6-	((3,5,6-Trichloro-2-pyridinyl)oxy)acetic Acid (Triclopyr)	55335063		ug/L					Organics	Herbicides
Trichlorobenzene, 1,2,3-	1,2,3-Trichlorobenzene	87616		ug/L	ug/Kg dw				Organics	VOCs
Trichlorobenzene, 1,2,3-(Surrogate)	Surrogate: 1,2,3-Trichlorobenzene	0		% recovery	% recovery		% recovery	% recovery	Organics
Trichlorobenzene, 1,2,4-	1,2,4-Trichlorobenzene	120821		ug/L	ug/Kg dw				Organics	SVOCs
Trichlorobenzene, 1,3,5-	1,3,5-Trichlorobenzene	108703			ug/Kg dw
Trichlorobenzene-13C6, 1,2,3-(IsoDilAnalogue)	Isotope Dilution Analogue: 1,2,3-Trichlorobenzene-13C6	0		% recovery	% recovery		% recovery	% recovery	Organics	Pest-OCHs	IDA
Trichloroethane, 1,1,1-	1,1,1-Trichloroethane	71556		ug/L					Organics	VOCs
Trichloroethane, 1,1,2-	1,1,2-Trichloroethane	79005		ug/L					Organics	VOCs
Trichloroethylene	Trichloroethylene (Trichloroethene)	79016		ug/L					Organics	VOCs
Trichlorofluoromethane	Trichlorofluoromethane	75694		ug/L					Organics	VOCs
Trichloronate	Trichloronate	327980		ug/L	ug/g dw		ng/g ww	ng/g dw	Organics	Pesticides	Pest-OPs	Insecticides
Trichlorophenol, 2,4,5-	2,4,5-Trichlorophenol	95954		ug/L	mg/Kg dw				Organics	SVOCs	Phenols	Chlorinated Phenols
Trichlorophenol, 2,4,6-	2,4,6-Trichlorophenol	88062		ug/L	mg/Kg dw				Organics	SVOCs	Phenols	Chlorinated Phenols
Trichlorophenoxy)propionic Acid, 2-(2,4,5-	2-(2,4,5-Trichlorophenoxy)propionic Acid (2,4,5-TP) (Silvex) (Fenoprop)	93721		ug/L					Organics	Herbicides
Trichlorophenoxyacetic Acid, 2,4,5-	2,4,5-Trichlorophenoxyacetic Acid (2,4,5-T)	93765		ug/L					Organics	Herbicides
Trichlorophenoxyacetic Acid, 2,4,5-(Surrogate)	Surrogate: 2,4,5-Trichlorophenoxyacetic Acid (2,4,5-T)	93765		% recovery	% recovery				Organics	Herbicides
Trichloropropane, 1,2,3-	1,2,3-Tricloropropane	96184		ug/L					Organics	VOCs
Triclocarban	Triclocarban	101202		ng/L					Organics	PPCPs
Triclocarban-13C6(Surrogate)	Surrogate: Triclocarban-13C6	1216457769		% recovery					Organics	PPCPs
Triclopyr	Triclopyr	55335063		ug/L					Organics
Triclosan	Triclosan	3380345		ug/L					Organics	PPCPs
Triclosan-d3(IsoDilAnalogue)	Isotope Dilution Analogue: Triclosan-d3	1020719985		% recovery					Organics		IDA
Tridimephon	Triadimefon	43121433		ug/L					Organics	Pesticides	Fungicides
Trifloxystrobin	Trifloxystrobin	141517217		ug/L					Organics	Fungicides
Triflumizole	Triflumizole	68694111		ug/L					Organics	Fungicides
Trifluorotolunene, a,a,a-(Surrogate)	Surrogate: a,a,a-Trifluorotoluene	0		% recovery					Organics	VOCs
Trifluralin	Trifluralin	1582098		ug/L	ng/g dw				Organics	Herbicides
Trifluralin-d14(Surrogate)	Surrogate: Trifluralin-d14	0		% recovery					Organics	Pesticides
Trihalomethanes, Total	Total Trihalomethanes	0		ug/L					Organics	VOCs
Trimethoprim	Trimethoprim	738705		ug/L			ng/g ww	ng/g dw	Organics	PPCPs
Trimethoprim-13C3(Surrogate)	Surrogate: Trimethoprim-13C3	0					% recovery	% recovery	Organics
Trimethylbenzene, 1,2,4-	1,2,4-Trimethylbenzene	95636		ug/L					Organics	VOCs	Herbicides
Trimethylbenzene, 1,3,5-	1,3,5-Trimethylbenzene	108678		ug/L					Organics	VOCs
Trimethylnaphthalene, 1,6,7-	1,6,7-Trimethylnaphthalene	0			ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs
Trimethylnaphthalene, 2,3,5-	2,3,5-Trimethylnaphthalene	2245387		ug/L	ug/Kg dw		ug/Kg ww	ug/Kg dw	Organics	PAHs	SVOCs	LMW_PAH
Trimethylnaphthalene, 2,3,6-	2,3,6-Trimethylnaphthalene	829265		ng/L					Organics	PAHs
Trimethylphenanthrene, 1,2,6-	1,2,6-Trimethylphenanthrene	30436556		ng/L					Organics	PAHs
Trimethylphenol, 2,4,6-(Surrogate)	Surrogate: 2,4,6-Trimethylphenol	26998801		% recovery					Organics	PAHs	SVOCs	Phenols	Surfactants
Trinitrotoluene, 2,4,6-	2,4,6-Trinitrotoluene (TNT)	118967		ug/L	ug/kg				Organics
Tripentyltin(Surrogate)	Surrogate: Tripentyltin	0			ug/Kg dw				Organics
Triphenyl Phosphate	Triphenyl Phosphate	0		ug/L
Triphenyl phosphate(Surrogate)	Surrogate: Triphenyl Phosphate	115866		ug/L	% recovery		% recovery	% recovery	Organics	Pesticides	Pest-OPs
Tris(1,3-dichloroisopropyl)phosphate	Tris(1,3-dichloroisopropyl)phosphate (TDCPP)	13674878		ng/L					Organics	FlameRetardants
Tris(1-chloro-2-propyl)phosphate	Tris(1-chloro-2-propyl)phosphate (TCPP, multiple isomers)	13674845		ng/L					Organics	FlameRetardants
Tris(2-chloroethyl)phosphate	Tris(2-chloroethyl)phosphate (TCEP)	115968		ng/L					Organics	FlameRetardants
Triticonazole	Triticonazole	131983727		ng/L					Organics	Pesticides	Fungicides
Tritium	Tritium	10028178		pCi/L					Inorganics
Tritium 2scu	Tritium 2-sigma Combined Uncertainty	0		pCi/L					Inorganics
TrophicStatus	General classification of trophic status based on observed algae and herbaceous plant levels	0	none						Habitat
TRPH	Total Recoverable Petroleum Hydrocarbons (TRPH)	0		mg/L					Organics
Turbidity	Turbidity	0		NTU					Inorganics	ConventionalsConventionals	WaterQualityMeasurements	Habitat
Tylosin	Tylosin	1401690		ug/L			ng/g ww	ng/g dw	Organics	PPCPs
Undercut Distance	Undercut Distance	0	m						Habitat
UplandSlope	Slope of bank or upland area	0	%						Habitat
Uranium	Uranium	7440611		ug/L					Inorganics
Urea	Urea	0		ug/L					Organics	Carbamides
Utensil	Utensil	0	pieces						Debris	Trash	Plastics	FoodService
Valley Width	Valley Width	0	m						Habitat
Vanadium	Vanadium	7440622		ug/L	ug/g dw		ug/g ww	ug/g dw	Inorganics	Metals
VectorControl_Bs	Vector Control through Bs (Bacillus sphaericus) within waterbody	0	none						Habitat
VectorControl_Bti	Vector Control through Bti (Bacillus Thuringensis Israelensis) within waterbody	0	none						Habitat
VectorControl_Methoprene	Vector Control through Methoprene within waterbody	0	none						Habitat
VectorControl_Mosquitofish	Vector Control through Mosquitofish within waterbody	0	none						Habitat
VectorControl_Oil	Vector Control through Oil within waterbody	0	none						Habitat
Veg_Emergent	Percent cover of emergent vegetation within a given area	0	%						Habitat
Veg_Open	Percent cover of open space within a given area	0	%						Habitat
Veg_SubmergedAlgae	Percent cover of submerged algae within a given area	0	%						Habitat
Veg_SubmergedOther	Percent cover of submerged other (non-algae) within a given area	0	%						Habitat
Veg_SurfaceAlgae	Percent cover of surface algae within a given area	0	%						Habitat
Veg_SurfaceOther	Percent cover of surface other (non-algae) within a given area	0	%						Habitat
Vegetation Cover Bank	Percent of both bank surfaces upstream of sample location estimated to be covered by vegetation (plants & roots at water's edge)	0	none						FieldObservations	Habitat
Vegetation Cover Instream	Percent of stream's water surface upstream of sample location estimated to be covered by aquatic vegetation	0	none						FieldObservations	Habitat
Vegetation Cover Quality Metric	Metric assesses the quality of vegetation cover in the riparian and channel zones	0	score						Habitat
Vegetation Cover Structure Metric	Metric assesses structural complexity of the riparian environment in the riparian and channel zones (excluding low-flow) and includes any kind of tree, bush, shrub, or helophyte. Grasses are excluded.	0	score						Habitat
Velocity	Velocity	0		m/s					WaterQualityMeasurements
Vinclozolin	Vinclozolin	50471448		ug/L					Organics	Pesticides	Fungicides
Vinyl Chloride	Vinyl Chloride	75014		ug/L					Organics	VOCs
Virginiamycin	Virginiamycin	0					ng/g ww	ng/g dw	Organics
Volume	Volume	0		L					Habitat
W1_HALL_SWAMP	Riparian human disturbance index, all types, proximity-weighted sum	0	none						Bioassessment
Wadeability	Wadeability	0	none						FieldObservations	Habitat
Warfarin-d5(Surrogate)	Warfarin-d5(Surrogate)	791013224			% recovery				Organics	Pesticides	Insecticides
Waste, Food	Waste, Food	0	pieces						Debris	Natural	Non-Plastics	Biodegradable	Marine Origin
Waste, Pet	Waste, Pet	0	pieces						Debris	Natural	Non-Plastics	Toxic
Waste, Yard	Waste, Yard	0	pieces						Debris	Natural	Non-Plastics	Biodegradable	Marine Origin
Water level below Reference Point	Distance from reference point to water surface	0	m						Habitat
Water Level Fluctuations	Water Level Fluctuations	0	none						Habitat
Water Withdrawal	Water Withdrawal	0	none						Habitat
Waterbody Appeal	Waterbody Appeal	0	none						Habitat
Waterbody Disturbance	Waterbody Disturbance	0	none						Habitat
WaterbodyOrigin	Origin of the waterbody	0	none						Habitat
WaterClarity	WaterClarity	0		none					FieldObservations	Habitat
Wave Height	Wave Height	0	ft
WaveAction	Wind Movement of Water on Surface	0	none
Weight	Weight	0				mg/ind			Toxicity
WetlandClass	Class or type of wetland	0	none						Habitat
WetlandFunction_FloodControl	Function of the wetland for flood control use	0	none						Habitat
WetlandFunction_HumanUse	Function of the wetland for human use	0	none						Habitat
WetlandFunction_Stormwater	Function of the wetland for stormwater use	0	none						Habitat
WetlandFunction_Wildlife	Function of the wetland for wildlife use	0	none						Habitat
Wetted Width	Wetted Width	0	m						Habitat
Width	Width	0	m						Habitat
WindDirection	WindDirection	0	none						FieldObservations	Habitat
WindIntensity	Intensity of wind at the time of sampling	0	none						Habitat
WindSpeed	WindSpeed	0	none						FieldObservations	Habitat
Wire	Wire	0	pieces						Debris	Trash	Non-Plastics	Metal
Wood Debris	Wood Debris	0	pieces						Debris	Natural	Non-Plastics	Construction	Marine Origin
Wrapper, Food	Wrapper, Food	0	pieces						Debris	Trash	Plastics	Bags/Packaging
Wrapper, Other	Wrapper, Other	0	pieces						Debris	Trash	Plastics	Bags/Packaging
Wrapper, Plastic Straw	Wrapper, Plastic Straw	0	pieces						Debris	Trash	Plastics	Bags/Packaging
XBKF_W	Mean bankfull width of reach	0	m						Bioassessment
XCDENMID	Mean percent mid-channel canopy density	0	%						Bioassessment
XCMG	Riparian cover as sum of three layers physical-habitat metric	0	%						Bioassessment
XCMGW	Mean riparian woody cover as sum of three layers	0	none						Bioassessment
XFC_NAT_SWAMP	Mean sum of natural instream cover types	0	none						Bioassessment
XSLOPE	Mean slope (water surface gradient) of reach	0	%						Bioassessment
Xylene, m/p-	m-Xylene/p-Xylene	179601231		ug/L					Organics	VOCs	MTBE_BTEX	Xylenes
Xylene, o-	o-Xylene	95476		ug/L					Organics	VOCs	MTBE_BTEX	Xylenes
Xylenes, Total	Total Xylenes	1330207		ug/L					Organics	VOCs	MTBE_BTEX	Xylenes
Young/female	Young/female (#)	0				Num/Rep			Toxicity
Ytterbium	Ytterbium	7440644		ug/L					Inorganics
Yttrium	Yttrium	7440655		ug/L					Inorganics
Z-Bifenthrin-d5, (rac-cis)-(Surrogate)	Surrogate: (rac-cis)-Z-Bifenthrin-d5	0		% recovery	% recovery				Organics
Zinc	Zinc	7440666		ug/L	umol/g		ug/g ww	ug/g dw	Inorganics	TraceElements	Metals
Ziram	Ziram	137304		ug/L					Organics	Pesticides	Fungicides
Zoxamide	Zoxamide	156052685		ng/L					Organics	Pesticides	Fungicides