AnalyteName | AnalyteDescr | CASNumber | pHab_Unit | Water_Unit | Sediment_Unit | Tox_Unit | Fish_Unit | Bivalve_Unit | Group1 | Group2 | Group3 | Group4 | Group5 | Group6 | 6-Pack Ring | 6-Pack Ring | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | FoodService | | |
AccesstoWaterbody_BikePath | AccesstoWaterbody_BikePath | 0 | none |   |   |   |   |   | Habitat | Debris | | | | |
AccesstoWaterbody_Fence | AccesstoWaterbody_Fence | 0 | none |   |   |   |   |   | Habitat | Debris | | | | |
AccesstoWaterbody_HeavyVegetation | AccesstoWaterbody_HeavyVegetation | 0 | none |   |   |   |   |   | Habitat | Debris | | | | |
AccesstoWaterbody_ParkingLot | AccesstoWaterbody_ParkingLot | 0 | none |   |   |   |   |   | Habitat | Debris | | | | |
AccesstoWaterbody_PicnicArea | AccesstoWaterbody_PicnicArea | 0 | none |   |   |   |   |   | Habitat | Debris | | | | |
AccesstoWaterbody_RestrictedAccessMaintenanceRoad | AccesstoWaterbody_RestrictedAccessMaintenanceRoad | 0 | none |   |   |   |   |   | Habitat | Debris | | | | |
AccesstoWaterbody_Roadway | AccesstoWaterbody_Roadway | 0 | none |   |   |   |   |   | Habitat | Debris | | | | |
AccesstoWaterbody_Walkway | AccesstoWaterbody_Walkway | 0 | none |   |   |   |   |   | Habitat | Debris | | | | |
Accumulation | Accumulation using Trash Protocol | 0 | score |   |   |   |   |   | Trash | | | | | |
Acenaphthene | Acenaphthene | 83329 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | LMW_PAH | Endocrine Disruptors | |
Acenaphthene-d10(Surrogate) | Surrogate: Acenaphthene-d10 | 15067262 |   | % recovery | % recovery |   | ng/g ww | ng/g dw | Organics | PAHs | SVOCs | LMW_PAH | Endocrine Disruptors | |
Acenaphthenes, C1- | C1-Acenaphthenes | 0 |   | ng/L |   |   |   |   | Organics | PAHs | | | | |
Acenaphthylene | Acenaphthylene | 208968 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | LMW_PAH | | |
Acenaphthylene-d8(IsoDilAnalogue) | Isotope Dilution Analogue: Acenaphthylene-d8 | 93951974 |   | % recovery |   |   |   |   | Organics | PAHs | IDA | | | |
Acenaphthylene-d8(Surrogate) | Surrogate: Acenaphthylene-d8 | 208968 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PAH | | | | |
Acetaminophen | Acetaminophen | 0 |   | ng/L |   |   | ng/g ww | ng/g dw | Organics | | | | | |
Acetaminophen(Surrogate) | Surrogate: Acetaminophen | 0 |   |   |   |   | % recovery | % recovery | Organics | | | | | |
Acetamiprid | Acetamiprid | 135410207 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Insecticides | | | |
Acetone | Acetone | 67641 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Acibenzolar-S-methyl | Acibenzolar-S-methyl | 135158542 |   | ng/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
Acid Neutralizing Capacity | Acid Neutralizing Capacity (ANC) | 0 |   | ueq/L |   |   |   |   | Inorganics | Conventionals | | | | |
Acid Volatile Sulfides | Acid Volatile Sulfides (AVS) | 0 |   |   | umol/g |   |   |   | Inorganics | Conventionals | | | | |
Acifluorfen | Acifluorfen | 50594666 |   | ug/L |   |   |   |   | Organics | Herbicides | | | | |
Acrolein | Acrolein | 107028 |   | ug/L |   |   |   |   | Organics | Pesticides | Herbicides | | | |
Acrylonitrile | Acrylonitrile | 0 |   | ug/L |   |   |   |   | Organics | | | | | |
Aesthetic Condition | Aesthetic Condition | 0 | none |   |   |   |   |   | Habitat | Debris | | | | |
AFDM_Algae | Ash Free Dry Mass primarily of Algae but other items may be weighed | 0 |   | mg/m3 |   |   |   |   | Inorganics | Conventionals | | | | |
Age | Age | 0 |   |   |   |   | yr |   | Tissue | | | | | |
Age Diversity and Natural Regeneration Metric | Metric assesses the age diversity and natural regeneration potential of woody species in the riparian and channel zones (excluding low-flow). | 0 | score |   |   |   |   |   | Habitat | | | | | |
Age_Pond | Age (in years) of the pond if it is created | 0 | yr |   |   |   |   |   | Habitat | | | | | |
Alachlor | Alachlor (Lasso) | 15972608 |   | ug/L | ng/g dw |   |   |   | Organics | Herbicides | Endocrine Disruptors | | | |
Aldicarb | Aldicarb | 116063 |   | ug/L | ug/Kg dw |   |   |   | Organics | Pesticides | Pest-Carbamates | Insecticides | | |
Aldicarb Sulfone | Aldicarb Sulfone | 1646884 |   | ug/L | ug/Kg dw |   |   |   | Organics | Pesticides | Pest-Carbamates | Insecticides | | |
Aldicarb Sulfoxide | Aldicarb Sulfoxide | 1646873 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-Carbamates | Insecticides | | |
Aldrin | Aldrin | 309002 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OCHs | Insecticides | Endocrine Disruptors | |
Aldrin(Surrogate) | Surrogate: Aldrin | 309002 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | Pesticides | | | | |
Aldrin-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Aldrin-13C12 | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | Pest-OCHs | IDA | | | |
Algae Cover | Percent of stream's water surface upstream of sample location estimated to be covered with algae | 0 | % |   |   |   |   |   | FieldObservations | Habitat | | | | |
Algae Cover Filamentous | Percent of stream's water surface upstream of sample location estimated to be covered with filamentous algae | 0 | % |   |   |   |   |   | FieldObservations | Habitat | | | | |
Algae-attached | Percent of substrate in wetted channel upstream of sample location estimated to be covered with Algae-attached | 0 | % |   |   |   |   |   | FieldObservations | Habitat | | | | |
Algae-floating Mats | Percent of stream's water surface upstream of sample location estimated to be covered with Algae-floating Mats | 0 | % |   |   |   |   |   | FieldObservations | Habitat | | | | |
Algal Cover Periphyton | Percent of substrate in wetted channel upstream of sample location estimated to be covered with periphyton [living community attached to substrate including algae (not green filamentous type), aquatic mosses, fungi, diatoms & sessile invertebrates] | 0 | % |   |   |   |   |   | FieldObservations | Habitat | | | | |
Alkalinity as CaCO3 | Alkalinity as CaCO3 | 471341 |   | mg/L |   |   |   |   | Inorganics | Conventionals | WaterQualityMeasurements | Habitat | | |
Allethrin | Allethrin | 584792 |   | ug/L | ug/Kg dw |   |   |   | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | |
Alpha Linolenic Acid | Alpha Linolenic Acid | 0 |   |   |   |   | mg/100g ww | mg/100g dw | Organics | Omega Fatty Acid | | | | |
Aluminum | Aluminum | 7429905 |   | ug/L | ug/g dw |   | ug/g ww | ug/g dw | Inorganics | TraceElements | Metals | | | |
Aluminum Foil | Aluminum Foil | 0 | pieces |   |   |   |   |   | Debris | Trash | Non-Plastics | Metal | | |
Aluminum, Organic Monomeric | Organic Monomeric Aluminum (Organic Reactive) | 0 |   | ug/L |   |   |   |   | Inorganics | TraceElements | Metals | | | |
Aluminum, Total Monomeric | Total Monomeric Aluminum (Organic + Inorganic Reactive) | 0 |   | ug/L |   |   |   |   | Inorganics | TraceElements | Metals | | | |
Aluminum/Steel Can | Aluminum/Steel Can | 0 | pieces |   |   |   |   |   | Debris | Trash | Non-Plastics | Metal | | |
Ametryn | Ametryn | 834128 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-Triazines | Herbicides | | |
Aminocarb | Aminocarb | 2032599 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-Carbamates | Insecticides | | |
Aminopyralid | Aminopyralid | 150114719 |   | ug/L |   |   |   |   | Organics | | | | | |
Ammonia as N | Ammonia as N | 7664417 |   | ug/L | mg/Kg dw |   |   |   | Inorganics | Conventionals | Nutrients | | | |
Ammonia as N, Unionized | Unionized Ammonia as N | 7664417 |   | mg/L |   |   |   |   | Inorganics | Conventional | Nutrients | WaterQualityMeasurements | | |
Ammonia as NH3 | Ammonia as NH3 | 7664417 |   | mg/L |   |   |   |   | Inorganics | Conventionals | Nutrients | WaterQualityMeasurements | | |
Ammonia as NH3, Unionized | Unionized Ammonia as NH3 | 7664417 |   | mg/L |   |   |   |   | Inorganics | Conventionals | Nutrients | WaterQualityMeasurements | | |
Ammonium as N | Ammonium as N (NH4) | 0 |   | mg/L |   |   |   |   | Inorganics | Conventionals | Nutrients | | | |
Amoxicillin | Amoxicillin | 26787780 |   | ng/L |   |   |   |   | | | | | | |
AMPA | Aminomethyl Phosphonic Acid (AMPA) | 1066519 |   | ug/L |   |   |   |   | Organics | Pesticides | Herbicides | | | |
AMPA(Surrogate) | Surrogate: Aminomethyl Phosphonic Acid (AMPA) | 77521290 |   | % recovery |   |   |   |   | Organics | | | | | |
Anatoxin-A | Anatoxin-A | 64285069 |   | ug/L |   |   | ng/g ww | ng/g dw | Microbiological | Cyanotoxins | | | | |
Angling Pressure | Angling Pressure | 0 | none |   |   |   |   |   | Habitat | | | | | |
Anilazine | Anilazine | 101053 |   | ug/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
Aniline | Aniline (Aminobenzene)(Phenylamine) | 0 |   | ug/L |   |   |   |   | Organics | SVOCs | | | | |
AnimalPresence | describes presence of animals which may include tracks, scat, sounds or physical presence | 0 | none |   |   |   |   |   | FieldObservations | Habitat | | | | |
Anthracene | Anthracene | 120127 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | LMW_PAH | Endocrine Disruptors | |
Anthracene-d10(IsoDilAnalogue) | Isotope Dilution Analogue: Anthracene-d10 | 1719068 |   | % recovery |   |   |   |   | | | | | | |
Anthracene-d10(Surrogate) | Surrogate: Anthracene-d10 | 120127 |   | % recovery |   |   |   |   | Organics | PAHs | SVOCs | LMW_PAH | Endocrine Disruptors | |
Anthropogenic Alt Channel Modification SubMetric | Metric assesses the impact of anthropogenic alterations based on channel modification | 0 | score |   |   |   |   |   | Habitat | | | | | |
Anthropogenic Alt Hydromodification SubMetric | Metric assesses the impact of anthropogenic alterations based on hydromodification and Channel Evolution Models (CEMS) | 0 | score |   |   |   |   |   | Habitat | | | | | |
Anthropogenic Alterations to Channel Morph Metric | Metric assesses the impact of anthropogenic alterations to channel morphology through hydromodification and channel modification. Metric is an average of the two previous submetrics. | 0 | score |   |   |   |   |   | Habitat | | | | | |
Antimony | Antimony | 7440360 |   | ug/L | ug/g dw |   | ug/g ww | ug/g dw | Inorganics | Metals | Metalloids | | | |
Appliance | Appliance | 0 | pieces |   |   |   |   |   | Debris | Trash | Non-Plastics | Large | | |
AquaticLife | AquaticLife using Trash Protocol | 0 | score |   |   |   |   |   | Trash | | | | | |
Arachidonic | Arachidonic | 0 |   |   |   |   | mg/100g ww | mg/100g dw | Organics | Omega Fatty Acid | | | | |
Area | Area | 0 | m2 |   |   |   |   |   | Tissue | Habitat | | | | |
Arsenic | Arsenic | 7440382 |   | ug/L | ug/g dw |   | ug/g ww | ug/g dw | Inorganics | TraceElements | Metals | Metalloids | | |
Arsenic, Inorganic | Inorganic Arsenic | 7440382 |   |   |   |   | ug/g ww | ug/g dw | Inorganics | TraceElements | Metals | | | |
Asbestos, Total | Total Asbestos | 0 |   | mf/L |   |   |   |   | Inorganics | Conventionals | | | | |
Ash Free Dry Mass | Ash-Free Dry Mass (AFDM, AFDW) | 0 |   | g/m2 |   |   |   |   | Inorganics | Conventionals | Benthic | | | |
Aspon | Aspon | 3244904 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-OPs | Insecticides | | |
Atenolol | Atenolol | 29122687 |   | ng/L |   |   |   |   | Organics | PPCPs | | | | |
Atorvastatin | Atorvastatin | 134523005 |   | ng/L |   |   |   |   | Organics | PPCPs | | | | |
Atraton | Atraton | 1610179 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-Triazines | Herbicides | | |
Atrazine | Atrazine | 1912249 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Pest-Triazines | Herbicides | Endocrine Disruptors | |
Atrazine-13C3(Surrogate) | Surrogate: Atrazine-13C3 | 0 |   | % recovery |   |   |   |   | Organics | Pesticides | Pest-Triazines | | | |
Atrazine-d5(Surrogate) | Surrogate: Atrazine-d5 | 163165751 |   | % recovery |   |   |   |   | Organics | Pesticides | Pest-Triazines | Herbicides | Endocrine Disruptors | |
Atrazine-Desisopropyl-2-Hydroxy | Atrazine-Desisopropyl-2-Hydroxy | 7313544 |   | ug/L |   |   |   |   | Organics | Omega Fatty Acid | | | | |
Autopart | Autopart | 0 | pieces |   |   |   |   |   | Debris | Trash | Non-Plastics | Metal | | |
Avian_GFD | Avian_GFD | 0 |   | copies/100 mL |   |   |   |   | Microbiological | | | | | |
Azinphos Ethyl | Azinphos Ethyl | 2642719 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-OPs | Insecticides | | |
Azinphos Methyl | Azinphos Methyl (Guthion) | 86500 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Pest-OPs | Insecticides | | |
Azinphos Methyl oxon | Azinphos Methyl oxon | 0 |   | ng/L |   |   |   |   | Organics | Pesticides | | | | |
Azithromycin | Azithromycin | 0 |   | ng/L |   |   | ng/g ww | ng/g dw | Organics | | | | | |
Azobenzene | Azobenzene (Diphenyl Diimide) | 0 |   | ug/L |   |   |   |   | Organics | SVOCs | | | | |
Azoxystrobin | Azoxystrobin | 131860338 |   | ug/L |   |   |   |   | Organics | Fungicides | | | | |
Back Water | Back Water present | 0 | none |   |   |   |   |   | Habitat | | | | | |
Bacteroidales, Cow | Cow Bacteroidales | 0 |   | gc/mL |   |   |   |   | Microbiological | Pathogens | Conventional | | | |
Bacteroidales, Dog | Dog Bacteroidales | 0 |   | gc/mL | copies/g dw |   |   |   | Microbiological | Pathogens | Conventional | | | |
Bacteroidales, Horse | Horse Bacteroidales | 0 |   | none |   |   |   |   | | | | | | |
Bacteroidales, Human | Human Bacteroidales | 0 |   | gc/mL | copies/g dw |   |   |   | Microbiological | Pathogens | Conventional | | | |
Bacteroidales, Human (BacH) | Human Bacteroidales Marker BacH | 0 |   | gc/mL |   |   |   |   | | | | | | |
Bacteroidales, Human (HF183/BFDrev) | Human Bacteroidales, Assay name: HF183/BFDrev, 5' ATCATGAGTTCACATGTCCG 3', 5' CGTAGGAGTTTGGACCGTGT 3' | 0 |   | copies/100mL |   |   |   |   | | | | | | |
Bacteroidales, Universal | Universal Bacteroidales | 0 |   | gc/mL |   |   |   |   | Microbiological | Pathogens | Conventional | | | |
Bag, Large/Retail | Bag, Large/Retail | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Bags/Packaging | | |
Bag, Pet Waste | Bag, Pet Waste | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Bags/Packaging | | |
Bag, Single Use Plastic | Bag, Single Use Plastic | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Bags/Packaging | | |
Bag, Takeout | Bag, Takeout | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Bags/Packaging | | |
Bags/Packaging | Bags/Packaging | 0 | L |   |   |   |   |   | Debris | Trash | Plastics | | | |
Balloon, Latex | Balloon, Latex | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Miscellaneous | | |
Balloon, Mylar | Balloon, Mylar | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Miscellaneous | | |
Bandage/Bandaid | Bandage/Bandaid | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Miscellaneous | | |
Bank Angle | Bank Angle | 0 | none |   |   |   |   |   | Habitat | | | | | |
Bank Cover | Bank Cover | 0 | none |   |   |   |   |   | Habitat | | | | | |
Bank Stability | Bank Stability (score zone 5m up and 5m downstream of transect between bankfull - wetted width) | 0 | none |   |   |   |   |   | Habitat | | | | | |
Bankfull Height | Bankfull Height | 0 | m |   |   |   |   |   | Habitat | | | | | |
Bankfull Width | Bankfull Width | 0 | m |   |   |   |   |   | Habitat | | | | | |
Bankfull Width Reach | Visual estimate of the average bankfull width of the reach | 0 | m |   |   |   |   |   | Habitat | | | | | |
Bar Present | Bar Present | 0 | none |   |   |   |   |   | Habitat | | | | | |
Bar Width | Bar Width | 0 | m |   |   |   |   |   | Habitat | | | | | |
Barban | Barban | 101279 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-Carbamates | Herbicides | | |
Barban(Surrogate) | Surrogate: Barban | 101279 |   | % recovery |   |   |   |   | Organics | Pesticides | Pest-Carbamates | | | |
Barium | Barium | 7440393 |   | ug/L | ug/g dw |   | ug/g ww | ug/g dw | Inorganics | Metals | | | | |
Barometric Pressure | Barometric Pressure | 0 |   |   |   |   |   |   | Habitat | | | | | |
Batteries, Large | Batteries, Large | 0 | pieces |   |   |   |   |   | Debris | Trash | Non-Plastics | Toxic | | |
Batteries, Small | Batteries, Small | 0 | pieces |   |   |   |   |   | Debris | Trash | Non-Plastics | Toxic | | |
Battery Voltage | Battery Voltage | 0 |   |   |   |   |   |   | FieldMeasure | | | | | |
Bearing | Bearing | 0 | degrees |   |   |   |   |   | Habitat | | | | | |
BeaufortScale | BeaufortScale | 0 | none |   |   |   |   |   | FieldObservations | Habitat | | | | |
Beaver Flow Modifications | Beaver Flow Modifications | 0 | none |   |   |   |   |   | Habitat | | | | | |
Beaver Signs | Beaver Signs | 0 | none |   |   |   |   |   | Habitat | | | | | |
Bendiocarb | Bendiocarb | 22781233 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-Carbamates | | | |
Benfluralin | Benfluralin | 1861401 |   | ug/L |   |   |   |   | Organics | Pesticides | Herbicides | | | |
Benomyl | Benomyl | 17804352 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-Carbamates | Endocrine Disruptors | Fungicides | Nematocides |
Bensulfuron Methyl | Bensulfuron Methyl | 83055996 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-Carbamates | | | |
Bensulide | Bensulide | 741582 |   | ug/L |   |   |   |   | Organics | Pesticides | Herbicides | | | |
Bentazon | Bentazon | 25057890 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-Carbamates | | | |
Benz(a)anthracene | Benz(a)anthracene | 56553 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | HMW_PAH | Endocrine Disruptors | |
Benz(a)anthracene-d12(IsoDilAnalogue) | Isotope Dilution Analogue: Benz(a)anthracene-d12 | 1718532 |   | % recovery |   |   |   |   | Organics | PAH | IDA | | | |
Benz(a)anthracene-d12(Surrogate) | Surrogate: Benz(a)anthracene-d12 | 1718532 |   | % recovery | % recovery |   | ng/g ww | ng/g dw | Organics | PAHs | SVOCs | HMW_PAH | Endocrine Disruptors | |
Benz(a)anthracenes/Chrysenes, C1- | C1-Benz(a)anthracenes/Chrysenes | 0 |   | pg/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | | | | |
Benz(a)anthracenes/Chrysenes, C2- | C2-Benz(a)anthracenes/Chrysenes | 0 |   | pg/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | | | | |
Benz(a)anthracenes/Chrysenes, C3- | C3-Benz(a)anthracenes/Chrysenes | 0 |   | pg/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | | | | |
Benz(a)anthracenes/Chrysenes, C4- | C4-Benz(a)anthracenes/Chrysenes | 0 |   | pg/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | | | | |
Benz(e)pyrene-d12(Surrogate) | Surrogate: Benz(e)pyrene-d12 | 205440820 |   | % recovery | % recovery |   |   |   | Organics | PAHs | Semi-VOAs | | | |
Benzene | Benzene | 71432 |   | ug/L |   |   |   |   | Organics | VOCs | MTBE_BTEX | | | |
Benzidine | Benzidine | 0 |   | ug/L |   |   |   |   | Organics | | | | | |
Benzo(a)fluoranthene | Benzo(a)fluoranthene | 203338 |   | ug/L | ng/g dw |   |   |   | Organics | PAHs | SVOCs | | | |
Benzo(a)pyrene | Benzo(a)pyrene | 50328 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | HMW_PAH | Endocrine Disruptors | |
Benzo(a)pyrene-d12(IsoDilAnalogue) | Isotope Dilution Analogue: Benzo(a)pyrene-d12 | 63466717 |   | % recovery |   |   |   |   | Organics | PAHs | IDA | | | |
Benzo(a)pyrene-d12(Surrogate) | Surrogate: Benzo(a)pyrene-d12 | 50328 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PAH | | | | |
Benzo(b)fluoranthene | Benzo(b)fluoranthene | 205992 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | HMW_PAH | Endocrine Disruptors | |
Benzo(b)fluoranthene-d12(IsoDilAnalogue) | Isotope Dilution Analogue: Benzo(b)fluoranthene-d12 | 93951985 |   | % recovery |   |   |   |   | Organics | PAHs | IDA | | | |
Benzo(b)fluoranthene-d12(Surrogate) | Surrogate: Benzo(b)fluoranthene-d12 | 93951985 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PAH | | | | |
Benzo(e)pyrene | Benzo(e)pyrene | 192972 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | HMW_PAH | Endocrine Disruptors | |
Benzo(e)pyrene-d12(Surrogate) | Surrogate: Benzo(e)pyrene-d12 | 205440820 |   | % recovery | % recovery |   |   |   | Organics | PAHs | SVOCs | | | |
Benzo(g,h,i)perylene | Benzo(g,h,i)perylene | 191242 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | HMW_PAH | Endocrine Disruptors | |
Benzo(g,h,i)perylene-d12(IsoDilAnalogue) | Isotope Dilution Analogue: Benzo(g,h,i)perylene-d12 | 93951667 |   | % recovery |   |   |   |   | Organics | PAHs | IDA | | | |
Benzo(g,h,i)perylene-d12(Surrogate) | Surrogate: Benzo(g,h,i)perylene-d12 | 93951667 |   | % recovery | % recovery |   | ng/g ww | ng/g dw | Organics | PAHs | SVOCs | HMW_PAH | Endocrine Disruptors | |
Benzo(j/k)fluoranthene | Benzo(j)fluoranthene/Benzo(k)fluoranthene | 0 |   | ng/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | HMW_PAH | Endocrine Disruptors | |
Benzo(k)fluoranthene | Benzo(k)fluoranthene | 207089 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | HMW_PAH | Endocrine Disruptors | |
Benzo(k)fluoranthene-d12(IsoDilAnalogue) | Isotope Dilution Analogue: Benzo(k)fluoranthene-d12 | 93952013 |   | % recovery |   |   |   |   | Organics | PAHs | IDA | | | |
Benzo(k)fluoranthene-d12(Surrogate) | Surrogate: Benzo(k)fluoranthene-d12 | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | | | | | |
Benzofluoranthenes/Benzopyrenes, C1- | C1-Benzofluoranthenes/Benzopyrenes | 0 |   | ng/L |   |   |   |   | Organics | PAHs | | | | |
Benzofluoranthenes/Benzopyrenes, C2- | C2-Benzofluoranthenes/Benzopyrenes | 0 |   | ng/L |   |   |   |   | Organics | PAHs | | | | |
Benzoic acid | Benzoic acid | 0 |   | ug/L |   |   |   |   | Organics | SVOCs | | | | |
Benzothiophene | Benzothiophene | 95158 |   | ng/L |   |   |   |   | Organics | PAHs | | | | |
Benzothiophene, C1- | C1-Benzothiophene | 0 |   | ng/L |   |   |   |   | Organics | PAHs | | | | |
Benzothiophene, C2- | C2-Benzothiophene | 0 |   | ng/L |   |   |   |   | Organics | PAHs | | | | |
Benzothiophene, C3- | C3-Benzothiophene | 0 |   | ng/L |   |   |   |   | Organics | PAHs | | | | |
Benzyl Alcohol | Benzyl Alcohol | 0 |   | ug/L |   |   |   |   | Organics | SVOCs | | | | |
Beryllium | Beryllium | 7440417 |   | ug/L | ug/g dw |   | ug/g ww | ug/g dw | Inorganics | Metals | | | | |
Bicarbonate | Bicarbonate | 71523 |   | mg/L |   |   |   |   | Inorganics | Conventionals | | | | |
Bifenox | Bifenox | 42576023 |   | ug/L |   |   |   |   | Organics | Pesticides | Herbicides | | | |
Bifenthrin | Bifenthrin | 82657043 |   | ug/L | ug/Kg dw |   |   |   | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | |
Biodegradable, Other | Biodegradable, Other | 0 | pieces |   |   |   |   |   | Debris | Natural | Non-Plastics | Biodegradable | | |
Biomass (wt/orig indiv) | Biomass (weight/original individual) | 0 |   |   |   | mg/ind |   |   | Toxicity | | | | | |
Biphenyl | Biphenyl | 92524 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | LMW_PAH | | |
Biphenyl-d10(IsoDilAnalogue) | Isotope Dilution Analogue: Biphenyl-d10 | 1486017 |   | % recovery |   |   |   |   | Organics | PAHs | IDA | | | |
Biphenyl-d10(Surrogate) | Surrogate: Biphenyl-d10 | 1486017 |   | % recovery | % recovery |   | ng/g ww | ng/g dw | Organics | PAHs | SVOCs | | | |
Biphenyls, C1- | C1-Biphenyls | 0 |   | ng/L |   |   |   |   | Organics | PAHs | | | | |
Biphenyls, C2- | C2-Biphenyls | 0 |   | ng/L |   |   |   |   | Organics | PAHs | | | | |
Bis(2-chloroethoxy)methane | Bis(2-chloroethoxy)methane | 111911 |   | ug/L |   |   |   |   | Organics | SVOCs | | | | |
Bis(2-chloroethyl)ether | Bis(2-chloroethyl)ether | 111444 |   | ug/L |   |   |   |   | Organics | SVOCs | | | | |
Bis(2-chloroisopropyl) ether | Bis(2-chloroisopropyl) ether | 39638329 |   | ug/L |   |   |   |   | Organics | SVOCs | | | | |
Bis(2-ethylhexyl)adipate | Bis(2-ethylhexyl)adipate | 0 |   | ug/L |   |   |   |   | Organics | | | | | |
Bis(2-ethylhexyl)phthalate | Bis(2-ethylhexyl)phthalate | 117817 |   | ug/L | ug/kg |   |   |   | Organics | SVOCs | Endocrine Disruptors | | | |
Bisphenol A | Bisphenol A | 0 |   | ng/L |   |   |   |   | | | | | | |
Bisphenol A-d16(IsoDilAnalogue) | Isotope Dilution Analogue: Bisphenol A-d16 | 96210876 |   | % recovery |   |   |   |   | Organics | | IDA | | | |
Bispyribac Sodium | Bispyribac Sodium | 125401925 |   | ug/L |   |   |   |   | Organics | Pesticides | Herbicides | | | |
Blue-Green Algae Phycocyanin | Blue-Green Algae Phycocyanin (BGA-PC) | 0 |   | ug/L |   |   |   |   | WaterQualityMeasurements | | | | | |
BOD | Biochemical Oxygen Demand (BOD) - 5 day test | 0 |   | mg/L |   |   |   |   | Inorganics | Conventionals | | | | |
Bolstar | Bolstar (Sulprofos) | 35400432 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Pest-OPs | Insecticides | | |
Boron | Boron | 7440428 |   | ug/L |   |   |   |   | Inorganics | Conventionals | Metals | Metalloids | | |
Boscalid | Boscalid | 188425856 |   | ug/L |   |   |   |   | Organics | Fungicides | | | | |
Bottle Cap, Metal | Bottle Cap, Metal | 0 | pieces |   |   |   |   |   | Debris | Trash | Non-Plastics | Metal | | |
Bottle Cap, Plastic | Bottle Cap, Plastic | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | FoodService | | |
Bottle, Beach | Bottle, Beach | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Toxic | | |
Bottle, Cleaning | Bottle, Cleaning | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Toxic | | |
Bottle, Glass | Bottle, Glass | 0 | pieces |   |   |   |   |   | Debris | Trash | Non-Plastics | Household | | |
Bottle, Shampoo | Bottle, Shampoo | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Household | | |
Bottle, Soda | Bottle, Soda | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | FoodService | | |
Bottle, Sport | Bottle, Sport | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | FoodService | | |
Bottle, Water | Bottle, Water | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | FoodService | | |
Brick | Brick | 0 | pieces |   |   |   |   |   | Debris | Trash | Non-Plastics | Construction | | |
Bridge | Bridge | 0 | none |   |   |   |   |   | Habitat | Debris | | | | |
Bridge Fence | Bridge Fence | 0 | none |   |   |   |   |   | Habitat | Debris | | | | |
Bridge Fence Height | Bridge Fence Height | 0 | m |   |   |   |   |   | Habitat | Debris | | | | |
Bridges, Culverts | Bridges, Culverts | 0 | none |   |   |   |   |   | Habitat | | | | | |
Bromacil | Bromacil | 314409 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-Carbamates | Herbicides | | |
Bromide | Bromide | 24959679 |   | ug/L |   |   |   |   | Inorganics | Conventionals | Nutrients | | | |
Bromo-3,5-dimethylphenyl-N-methylcarbamate, 4-(Surrogate) | Surrogate: 4-Bromo-3,5-dimethylphenyl-N-methylcarbamate (BDMC) | 672991 |   | % recovery |   |   |   |   | Organics | Pesticides | Pest-OCHs | | | |
Bromobenzene | Bromobenzene (Phenyl Bromide) | 108861 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Bromochloromethane | Bromochloromethane | 74975 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Bromodichloromethane | Bromodichloromethane (Dichlorobromomethane) | 75274 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Bromofluorobenzene, 4- | 4-Bromofluorobenzene | 460004 |   | % recovery |   |   |   |   | Organics | VOCs | | | | |
Bromofluorobenzene, 4-(Surrogate) | Surrogate: 4-Bromofluorobenzene | 460004 |   | % recovery |   |   |   |   | Organics | VOCs | | | | |
Bromoform | Bromoform (Tribromomethane) | 75252 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Bromomethane | Bromomethane (Methyl Bromide) | 74839 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Bromophenyl Phenyl Ether, 4- | 4-Bromophenyl Phenyl Ether | 101553 |   | ug/L |   |   |   |   | Organics | SVOCs | | | | |
Bromuconazole | Bromuconazole | 116255482 |   | ng/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
Bulk Density | Bulk Density | 0 |   |   | g/cm3 ww |   |   |   | | | | | | |
Butachlor | Butachlor | 23184669 |   | ug/L |   |   |   |   | Organics | Herbicides | | | | |
Butanone, 2- | 2-Butanone (Methyl Ethyl Ketone) | 78933 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Butralin | Butralin | 33629479 |   | ng/L |   |   |   |   | Organics | Pesticides | Herbicides | | | |
Butyl Benzyl Phthalate | Butyl Benzyl Phthalate | 85687 |   | ug/L | mg/Kg dw |   |   |   | Organics | SVOCs | Endocrine Disruptors | | | |
Butylate | Butylate | 2008415 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Pest-Carbamates | | | |
Butylbenzene, n- | n-Butylbenzene | 104518 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Butylbenzene, sec- | sec-Butylbenzene | 135988 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Butylbenzene, tert- | tert-Butylbenzene | 98066 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
C. coli | Campylobactor coli | 0 |   | copies/100 mL |   |   |   |   | Microbiological | | | | | |
C. jejuni | Campylobactor jejuni | 0 |   | copies/100 mL |   |   |   |   | Microbiological | | | | | |
Cadmium | Cadmium | 7440439 |   | ug/L | umol/g |   | ug/g ww | ug/g dw | Inorganics | TraceElements | Metals | | | |
Caffeine | Caffeine | 58082 |   | ug/L |   |   | ng/g ww | ng/g dw | Organics | PPCPs | | | | |
Caffeine-13C(Surrogate) | Surrogate: Caffeine-13C | 202282982 |   | % recovery |   |   | % recovery | % recovery | Organics | PPCPs | | | | |
Calcium | Calcium | 7440702 |   | ug/L |   |   |   |   | Inorganics | Conventionals | Metals | | | |
Canopy Cover | Canopy Cover | 0 | none |   |   |   |   |   | Habitat | | | | | |
Captafol | Captafol | 2425061 |   | ug/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
Captan | Captan | 133062 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-Carbamates | Insecticides | | |
Carbadox | Carbadox | 6804075 |   | ug/L |   |   | ng/g ww | ng/g dw | Organics | PPCPs | | | | |
Carbamazepine | Carbamazepine | 298464 |   | ug/L |   |   | ng/g ww | ng/g dw | Organics | PPCPs | | | | |
Carbamazepine(Surrogate) | Surrogate: Carbamazepine | 0 |   |   |   |   | % recovery | % recovery | Organics | Pesticides | | | | |
Carbaryl | Carbaryl | 63252 |   | ug/L | ug/Kg dw |   |   |   | Organics | Pesticides | Pest-Carbamates | Insecticides | Endocrine Disruptors | |
Carbazole(Surrogate) | Surrogate: Carbazole | 86748 |   | % recovery |   |   |   |   | Organics | Semi-VOAs | | | | |
Carbendazim | Carbendazim | 10605217 |   | ng/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
Carbofuran | Carbofuran | 1563662 |   | ug/L | ug/Kg dw |   |   |   | Organics | Pesticides | Pest-Carbamates | Insecticides | Nematocides | |
Carbon dioxide, free | Carbon dioxide, free | 0 |   | mg/L |   |   |   |   | | | | | | |
Carbon Dioxide, total | Carbon Dioxide, total | 0 |   | mg/L |   |   |   |   | | | | | | |
Carbon Disulfide | Carbon Disulfide | 0 |   | ug/L |   |   |   |   | | | | | | |
Carbon Tetrachloride | Carbon Tetrachloride | 56235 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Carbon-13/Carbon-12 Ratio | Carbon-13/Carbon-12 Ratio | 14762744 |   | per mil |   |   |   |   | Radiochemistry | | | | | |
Carbon-14 | Carbon-14 | 14762755 |   | % modern |   |   |   |   | Radiochemistry | | | | | |
Carbon-14 Counting Error | Carbon-14 Counting Error | 0 |   | % modern |   |   |   |   | Radiochemisty | | | | | |
Carbonate | Carbonate | 3812326 |   | mg/L |   |   |   |   | Inorganics | Conventionals | | | | |
Carbophenothion | Carbophenothion (Trithion) | 786196 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-OPs | Insecticides | | |
Carfentrazone Ethyl | Carfentrazone Ethyl | 128639021 |   | ug/L |   |   |   |   | Organics | Pesticides | | | | |
Cascade/Falls | Cascade/Falls | 0 | % |   |   |   |   |   | Habitat | | | | | |
Catellicoccus, Gull | Gull Catellicoccus | 0 |   | copies/100 mL | copies/g dw |   |   |   | | | | | | |
CD/DVD | CD/DVD | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Household | | |
CDOM | Colored Dissolved Organic Matter | 0 |   | ug/L |   |   |   |   | | | | | | |
Cefotaxime | Cefotaxime | 0 |   |   |   |   | ng/g ww | ng/g dw | Organics | | | | | |
Ceramic Pot/Shard | Ceramic Pot/Shard | 0 | pieces |   |   |   |   |   | Debris | Trash | Non-Plastics | Household | | |
Cerium | Cerium | 7440451 |   | ug/L |   |   |   |   | Inorganics | | | | | |
Channel Constraining Feature | Channel Constraining Feature | 0 | none |   |   |   |   |   | Habitat | | | | | |
Channel Constraint | Channel Constraint | 0 | none |   |   |   |   |   | Habitat | | | | | |
Channel Engineered | Channel has been modified/engineered | 0 | none |   |   |   |   |   | Habitat | FieldObservations | | | | |
Channel Margin in Contact | Channel Margin in Contact | 0 | % |   |   |   |   |   | Habitat | | | | | |
Channel Pattern | Channel Pattern | 0 | none |   |   |   |   |   | Habitat | | | | | |
Channel Unit | Channel Unit | 0 | none |   |   |   |   |   | Habitat | | | | | |
Channel Width Reach | Channel width used to define reach | 0 | m |   |   |   |   |   | Habitat | | | | | |
Channelization | Channelization | 0 | none |   |   |   |   |   | Habitat | | | | | |
Chemical Treatment | Chemical Treatment | 0 | none |   |   |   |   |   | Habitat | | | | | |
Chloramben | Chloramben | 0 |   | ug/L |   |   |   |   | | | | | | |
Chlorantraniliprole | Chlorantraniliprole | 500008457 |   | ng/L |   |   |   |   | Organics | Pesticides | Insecticides | | | |
Chlorate | Chlorate | 14866683 |   | ug/L |   |   |   |   | Inorganics | Conventionals | Nutrients | | | |
Chlordane | Chlordane, not otherwise specified | 57749 |   | ug/L | ug/Kg dw |   |   |   | Organics | Pesticides | Pest-OCHs | | | |
Chlordane, cis- | cis-Chlordane (alpha-Chlordane) | 5103719 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OCHs | Insecticides | Chlordanes | |
Chlordane, Technical | Chlordane, mixture of many related chemicals, of which 10 are major components | 12789036 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-OCHs | | | |
Chlordane, Total | Total Chlordane, sum of cis-chlordane and trans-chlordane | 0 |   | ug/L |   |   |   |   | | | | | | |
Chlordane, trans- | trans-Chlordane (gamma-Chlordane) | 5103742 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OCHs | Insecticides | Chlordanes | |
Chlordane, trans-(Surrogate) | Surrogate: trans-Chlordane (gamma-Chlordane) | 5103742 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | Pesticides | Pest-OCHs | Insecticides | Chlordanes | |
Chlordane-13C10, trans-(IsoDilAnalogue) | Isotope Dilution Analogue: trans-Chlordane-13C10 (gamma-Chlordane) | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | Pest-OCHs | IDA | | | |
Chlordene | Chlordene | 3734483 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-OCHs | Endocrine Disruptors | | |
Chlordene, cis- | cis-Chlordene (alpha-Chlordene) | 56534022 |   | ug/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | Pesticides | Pest-OCHs | Endocrine Disruptors | | |
Chlordene, trans- | trans-Chlordene (gamma-Chlordene) | 56641384 |   | ug/L | ug/Kg dw |   | ng/g ww | ng/g dw | Organics | Pesticides | Pest-OCHs | Endocrine Disruptors | | |
Chlorfenapyr | Chlorfenapyr | 122453730 |   | ug/L |   |   |   |   | Organics | Pesticides | | | | |
Chlorfenvinphos | Chlorfenvinphos | 470906 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-OPs | | | |
Chloride | Chloride | 16887006 |   | mg/L |   |   |   |   | Inorganics | Conventionals | Nutrients | | | |
Chlorimuron Ethyl | Chlorimuron Ethyl | 90982324 |   | ug/L |   |   |   |   | Organics | SVOCs | | | | |
Chlorine, Free | Free Chlorine | 0 |   | mg/L |   |   |   |   | | | | | | |
Chlorine, Total Residual | Total Residual Chlorine | 0 |   | mg/L |   |   |   |   | WaterQualityMeasurements | | | | | |
Chlorite | Chlorite | 14998277 |   | ug/L |   |   |   |   | Inorganics | Conventionals | Nutrients | | | |
Chlormefos | Chlormefos | 0 |   | % recovery |   |   |   |   | | | | | | |
Chloro-2-methylphenoxy) Butanoic Acid, 4-(4- | 4-(4-Chloro-2-methylphenoxy) Butanoic Acid (MCPB) | 94815 |   | ug/L |   |   |   |   | Organics | SVOCs | | | | |
Chloro-3-methylphenol, 4- | 4-Chloro-3-methylphenol | 59507 |   | ug/L | mg/Kg dw |   |   |   | Organics | SVOCs | Phenols | Chlorinated Phenols | Germicides | |
Chloroaniline, 4- | 4-Chloroaniline | 106478 |   | ug/L |   |   |   |   | Organics | SVOCs | | | | |
Chlorobenzene | Chlorobenzene | 108907 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Chlorobenzilate | Chlorobenzilate | 510156 |   | ug/L |   |   |   |   | Organics | Pesticides | | | | |
Chloroeicosafluoro-3-Oxaundecane-1-Sulfonic Acid, 11- | 11-Chloroeicosafluoro-3-Oxaundecane-1-Sulfonic Acid | 763051929 |   | ng/L | ng/g dw |   | ng/g ww | ng/g dw | | | | | | |
Chloroethane | Chlorethane (Ethyl Chloride) | 75003 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Chloroethyl Vinyl Ether, 2- | 2-Chloroethyl Vinyl Ether | 110758 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Chloroform | Chloroform | 67663 |   | ug/L |   |   |   |   | Organics | VOCs | Insecticides | | | |
Chlorohexadecafluoro-3-Oxanonane-1-Sulfonic Acid, 9- | 9-Chlorohexadecafluoro-3-Oxanonane-1-Sulfonic Acid | 756426581 |   | ng/L | ng/g dw |   | ng/g ww | ng/g dw | | | | | | |
Chloromethane | Chloromethane (Methyl Chloride) | 74873 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Chloronaphthalene, 2- | 2-Chloronaphthalene | 91587 |   | ug/L |   |   |   |   | Organics | SVOCs | | | | |
Chloroneb(Surrogate) | Surrogate: Chloroneb | 2675776 |   | % recovery |   |   |   |   | Organics | Pesticides | Pest-OCHs | Fungicides | | |
Chlorophenol, 2- | 2-Chlorophenol | 95578 |   | ug/L | mg/Kg dw |   |   |   | Organics | SVOCs | Phenols | Chlorinated Phenols | | |
Chlorophenyl Phenyl Ether, 4- | 4-Chlorophenyl Phenyl Ether | 7005723 |   | ug/L |   |   |   |   | Organics | SVOCs | | | | |
Chlorophenyl)-N'-methylurea, N-(4- | N-(4-Chlorophenyl)-N'-methylurea | 5352885 |   | ug/L |   |   |   |   | Organics | Herbicides | | | | |
Chlorophyll a | Chlorophyll a | 479618 |   | ug/L |   |   |   |   | WaterQualityMeasurements | Conventionals | Benthic | WaterQualityMeasurements | | |
Chlorophyll a & b | Chlorophyll a & b | 0 |   | ug/L |   |   |   |   | WaterQualityMeasurements | | | | | |
Chlorophyll b | Chlorophyll b | 0 |   | ug/L |   |   |   |   | WaterQualityMeasurements | | | | | |
Chlorophyll, Total | Total Chlorophyll | 0 |   | ug/L |   |   |   |   | WaterQualityMeasurements | | | | | |
ChlorophyllSampleVolume | Volume of material and liquid filtered to produce the chlorophyll a sample | 0 |   | mL |   |   |   |   | Habitat | | | | | |
Chloropicrin | Chloropicrin | 76062 |   | ug/L |   |   |   |   | Organics | Pesticides | | | | |
Chlorothalonil | Chlorothalonil | 1897456 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-OCHs | Algaecides | Fungicides | Nematocides |
Chlorotoluene, 2- | 2-Chlorotoluene | 95498 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Chlorotoluene, 4- | 4-Chlorotoluene | 106434 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Chloroxuron | Chloroxuron (Chloroxyfenidim) (Norex) | 1982474 |   | ug/L |   |   |   |   | Organics | Herbicides | | | | |
Chloroxuron(Surrogate) | Surrogate: Chloroxuron (Chloroxyfenidim) (Norex) | 0 |   |   | % recovery |   |   |   | Organics | | | | | |
Chlorpropham | Chlorpropham | 101213 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-Carbamates | Herbicides | | |
Chlorpyrifos | Chlorpyrifos | 2921882 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OPs | Insecticides | | |
Chlorpyrifos Methyl | Chlorpyrifos Methyl | 5598130 |   | ug/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | Pesticides | Pest-OPs | Insecticides | | |
Chlorpyrifos Methyl(Surrogate) | Surrogate: Chlorpyrifos Methyl | 5598130 |   | % recovery |   |   |   |   | Organics | Pesticides | Pest-OPs | Insecticides | | |
Chlorpyrifos oxon | Chlorpyrifos Oxon | 5598152 |   | ng/L |   |   |   |   | Organics | Pesticides | OrganophosphatePest. | Insecticides | | |
Chlortetracycline | Chlortetracycline | 57625 |   | ug/L |   |   |   |   | Organics | PPCPs | | | | |
Chromium | Chromium | 7440473 |   | ug/L | ug/g dw |   | ug/g ww | ug/g dw | Inorganics | TraceElements | Metals | | | |
Chromium III | Chromium III (Trivalent Chromium) | 18540300 |   | ug/L |   |   |   |   | Metal | | | | | |
Chromium VI | Chromium VI | 18540299 |   | ug/L |   |   |   |   | Metal | | | | | |
Chrysene | Chrysene | 218019 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | HMW_PAH | Endocrine Disruptors | |
Chrysene/Triphenylene | Chrysene/Triphenylene (CAS #EDF-359) | 0 |   |   | ng/g dw |   |   |   | Organics | PAHs | | | | |
Chrysene-d12(IsoDilAnalogue) | Isotope Dilution Analogue: Chrysene-d12 | 1719035 |   | % recovery |   |   |   |   | Organics | PAHs | IDA | | | |
Chrysene-d12(Surrogate) | Surrogate: Chrysene-d12 | 1719035 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PAHs | SVOCs | HMW_PAH | Endocrine Disruptors | |
Chrysenes, C1- | C1-Chrysenes | 0 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | HMW_PAH | Endocrine Disruptors | |
Chrysenes, C2- | C2-Chrysenes | 0 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | HMW_PAH | Endocrine Disruptors | |
Chrysenes, C3- | C3-Chrysenes | 0 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | HMW_PAH | Endocrine Disruptors | |
Chrysenes, C4- | C4-Chrysenes | 0 |   | ng/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | HMW_PAH | Endocrine Disruptors | |
Cigarette Box/Wrapper | Cigarette Box/Wrapper | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Miscellaneous | | |
Cigarette Butt | Cigarette Butt | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Toxic | | |
Cinerin-1 | Cinerin-1 | 25402066 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Pest-Pyrethroids | | | |
Cinerin-2 | Cinerin-2 (Cinerin II) | 121200 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Pest-Pyrethroids | | | |
Ciodrin | Ciodrin (Crotoxyphos) | 7700176 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-OPs | Insecticides | | |
Ciprofloxacin | Ciprofloxacin | 0 |   | ng/L |   |   | ng/g ww | ng/g dw | Organics | | | | | |
Ciprofloxacin-13C3-N15(Surrogate) | Surrogate: Ciprofloxacin-13C3-N15 | 0 |   |   |   |   | % recovery | % recovery | Organics | | | | | |
Circumference | Circumference | 0 | m |   |   |   |   |   | Habitat | | | | | |
Clarithromycin | Clarithromycin | 0 |   |   |   |   | ng/g ww | ng/g dw | Organics | | | | | |
Clay | Clay | 0 |   | % | % |   |   |   | Inorganics | Conventionals | GrainSize | | | |
Clinafloxacin | Clinafloxacin | 0 |   |   |   |   | ng/g ww | ng/g dw | Organics | | | | | |
Clomazone | Clomazone (Dimethazone) | 81777891 |   | ug/L |   |   |   |   | Organics | Pesticides | Herbicides | | | |
Clostridiales, Human (LACHNO3) | Human Clostridiales, Assay Name: LACHNO3 | 0 |   | copies/100mL |   |   |   |   | | | | | | |
Clothianidin | Clothianidin | 210880925 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Insecticide | | | |
Clothianidin-d3(Surrogate) | Surrogate: Clothianidin-d3 | 0 |   | % recovery | % recovery |   |   |   | | | | | | |
Clothing, synthetic fabric | Clothing, synthetic fabric | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Household | | |
CloudCover | Cloud cover at the time of sampling | 0 | % |   |   |   |   |   | Habitat | | | | | |
Cloxacillin | Cloxacillin | 0 |   |   |   |   | ng/g ww | ng/g dw | Organics | | | | | |
Cobalt | Cobalt | 7697372 |   | ug/L | mg/Kg nr |   | ug/g ww | ug/g dw | Inorganics | Metals | | | | |
COD | Chemical Oxygen Demand (COD) | 0 |   | mg/L |   |   |   |   | Inorganics | Conventionals | | | | |
Coliform, Fecal | Fecal Coliform | 0 |   | MPN/100 mL |   |   | MPN/g ww | MPN/g dw | Microbiological | Pathogens | Conventional | | | |
Coliform, Total | Total Coliform | 0 |   | MPN/100 mL | MPN/g dw |   | MPN/g ww | MPN/g dw | Microbiological | Pathogens | Conventional | | | |
CollSub_PlantDead | Algae collected from dead plant (including wood) substratum | 0 | none |   |   |   |   |   | Habitat | | | | | |
CollSub_PlantLive | Algae collected from live plant (including wood) substratum | 0 | none |   |   |   |   |   | Habitat | | | | | |
CollSub_Rock | Algae collected from rock (including concrete and consolidated sediment) substratum | 0 | none |   |   |   |   |   | Habitat | | | | | |
CollSub_SedSoft | Algae collected from soft sediment substratum | 0 | none |   |   |   |   |   | Habitat | | | | | |
Color | Color | 0 |   | none | none |   |   |   | FieldObservations | Habitat | | | | |
Color, True | Color of water from which turbidity has been removed | 0 |   | CU |   |   |   |   | Inorganics | Conventionals | | | | |
Commercial | Commercial | 0 | none |   |   |   |   |   | Habitat | | | | | |
Composition | Composition | 0 |   |   | none |   |   |   | FieldObservations | Habitat | | | | |
Computer | Computer | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Non-Plastics | Toxic | Large |
Concrete/Asphalt | Concrete/Asphalt | 0 | pieces |   |   |   |   |   | Debris | Trash | Non-Plastics | Construction | | |
Construction | Construction | 0 | none |   |   |   |   |   | Habitat | | | | | |
Construction Other | Construction Other | 0 | pieces |   |   |   |   |   | Debris | Trash | Non-Plastics | Construction | | |
Construction Wood/Pellets | Construction Wood/Pellets | 0 | pieces |   |   |   |   |   | Debris | Trash | Non-Plastics | Large | | |
Container, Chemical | Container, Chemical | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Toxic | | |
Container, Juice | Container, Juice | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | FoodService | | |
Container, Storage | Container, Storage | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Household | | |
Container, Styrofoam | Container, Styrofoam | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | FoodService | | |
Copper | Copper | 7440508 |   | ug/L | umol/g |   | ug/g ww | ug/g dw | Inorganics | TraceElements | Metals | | | |
Cotinine | Cotinine | 486566 |   | ng/L |   |   |   |   | Organics | PPCPs | | | | |
Coumaphos | Coumaphos | 56724 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Pest-OPs | Insecticides | | |
CPOM | Coarse particulate organic matter | 0 | none |   |   |   |   |   | Habitat | | | | | |
Cropland | Cropland | 0 | none |   |   |   |   |   | Habitat | | | | | |
Cryptosporidium | Cryptosporidium | 0 |   | cysts/L |   |   |   |   | Microbiological | Pathogens | Conventional | | | |
Cup | Cup | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | FoodService | | |
Cup, Styrofoam | Cup, Styrofoam | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Bags/Packaging | | |
Cup, Waxed Paper | Cup, Waxed Paper | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Non-Plastics | FoodService | |
Cyanazine | Cyanazine | 21725452 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-Triazines | Herbicides | | |
Cyanide | Cyanide | 57125 |   | ug/L |   |   |   |   | Inorganics | Conventionals | | | | |
Cyanobacteria | Potentially toxigenic (PTOX) genera of cyanobacteria | 0 |   | none |   |   |   |   | | | | | | |
CyanotoxinSampleVolume | Volume of material and liquid in Cyanotoxin sample | 0 |   | mL |   |   |   |   | Habitat | | | | | |
Cyantraniliprole | Cyantraniliprole | 736994631 |   | ng/L |   |   |   |   | Organics | Pesticides | Insecticides | | | |
Cyazofamid | Cyazofamid | 120116883 |   | ng/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
Cycloate | Cycloate | 1134232 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Pest-Carbamates | | | |
Cyfluthrin, beta- | beta-Cyfluthrin | 68359375 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | |
Cyfluthrin, gamma- | gamma-Cyfluthrin | 76703623 |   |   | ng/g dw |   |   |   | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | |
Cyfluthrin, Total | Total Cyfluthrin | 68359375 |   | ug/L | ug/Kg dw |   |   |   | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | |
Cyfluthrin-1 | Cyfluthrin peak 1 | 68359375 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | |
Cyfluthrin-2 | Cyfluthrin peak 2 | 68359375 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | |
Cyfluthrin-3 | Cyfluthrin peak 3 | 68359375 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | |
Cyfluthrin-4 | Cyfluthrin peak 4 | 68359375 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | |
Cyhalofop-butyl | Cyhalofop-butyl | 122008859 |   | ug/L |   |   |   |   | Organics | Pesticides | Herbicides | | | |
Cyhalothrin | Cyhalothrin | 86085858 |   | ng/L | ug/Kg dw |   |   |   | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | |
Cyhalothrin, gamma- | gamma-Cyhalothrin | 76703623 |   |   | ng/g dw |   |   |   | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | |
Cyhalothrin, lambda-1 | lambda-Cyhalothrin, peak 1 or Warrior-1 | 91465086 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | |
Cyhalothrin, lambda-2 | lambda-Cyhalothrin, peak 2 or Warrior-2 | 91465086 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | |
Cyhalothrin, Total lambda- | Total lambda-Cyhalothrin, sum peaks 1 & 2 | 91465086 |   | ug/L | ug/Kg dw |   |   |   | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | |
Cyhalothrin-d6, Total lambda-(Surrogate) | Surrogate: Total lambda-Cyhalothrin-d6 | 0 |   | % recovery |   |   |   |   | Organics | Pesticides | | | | |
Cylindrospermopsin | Cylindrospermopsin | 0 |   | ug/L |   |   |   |   | Microbiological | Cyanotoxins | | | | |
Cymene, p- | p-Cymene | 0 |   | ug/L |   |   |   |   | | | | | | |
Cymoxanil | Cymoxanil | 57966957 |   | ng/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
Cypermethrin, Total | Total Cypermethrin, sum peaks 1,2,3 & 4 | 52315078 |   | ug/L | ug/Kg dw |   |   |   | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | |
Cypermethrin-1 | Cypermethrin peak 1 | 67375308 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | |
Cypermethrin-13C6(surrogate) | Surrogate: Cypermethrin-13C6 | 0 |   | % recovery |   |   |   |   | Organics | Pesticides | | | | |
Cypermethrin-2 | Cypermethrin peak 2 | 65731842 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | |
Cypermethrin-3 | Cypermethrin peak 3 | 71697591 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | |
Cypermethrin-4 | Cypermethrin peak 4 | 52315078 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | |
Cyproconazole | Cyproconazole | 94361065 |   | ng/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
Cyprodinil | Cyprodinil | 121552612 |   | ug/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
Dacthal | Dacthal | 1861321 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OCHs | | | |
Dams | Dams | 0 | none |   |   |   |   |   | Habitat | | | | | |
DBCE(Surrogate) | Surrogate: Dibutylchlorendate | 1770805 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | Pesticides | Pest-OCHs | | | |
DCBP(p,p') | p,p'-Dichlorobenzophenone (DCBP) | 90982 |   |   | ug/kg |   | ng/g ww | ng/g dw | Organics | Pesticides | Pest-OCHs | | | |
DDD(o,p') | o,p'-DDD | 53190 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OCHs | Insecticides | DDTs | |
DDD(o,p')(Surrogate) | Surrogate: o,p'-DDD | 53190 |   | % recovery |   |   |   |   | Organics | Pesticides | OrganochlorinePest. | Semi-VOAs | Insecticides | DDTs |
DDD(p,p') | p,p'-DDD | 72548 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OCHs | Insecticides | DDTs | |
DDD(p,p')(Surrogate) | Surrogate: p,p'-DDD | 72548 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | Pesticides | Pest-OCHs | Insecticides | DDTs | |
DDD-13C(p,p')(Surrogate) | Surrogate: p,p'-DDD-C13 | 0 |   | % recovery |   |   |   |   | Organics | Pesticides | | | | |
DDD-13C12(o,p')(IsoDilAnalogue) | Isotope Dilution Analogue: o,p'-DDD-13C12 | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | Pest-OCHs | IDA | | | |
DDD-13C12(p,p')(IsoDilAnalogue) | Isotope Dilution Analogue: p,p'-DDD-13C12 | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | Pesticides | IDA | | | |
DDE(o,p') | o,p'-DDE | 3424826 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OCHs | Insecticides | DDTs | |
DDE(o,p')(Surrogate) | Surrogate: o,p'-DDE | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | | | | | |
DDE(p,p') | p,p'-DDE | 72559 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OCHs | Insecticides | DDTs | |
DDE(p,p')(Surrogate) | Surrogate: p,p'-DDE | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | Pesticides | | | | |
DDE-13C12(o,p')(IsoDilAnalogue) | Isotope Dilution Analogue: o,p'-DDE-13C12 | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | Pesticides | IDA | | | |
DDE-13C12(p,p')(IsoDilAnalogue) | Isotope Dilution Analogue: p,p'-DDE-13C12 | 201612502 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | Pesticides | IDA | | | |
DDMU(p,p') | p,p'-DDMU | 1022226 |   | ug/L | ng/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OCHs | Insecticides | DDTs | |
DDT(o,p') | o,p'-DDT | 789026 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OCHs | Insecticides | DDTs | |
DDT(o,p')(Surrogate) | Surrogate: o,p'-DDT | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | | | | | |
DDT(p,p') | p,p'-DDT | 50293 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OCHs | Insecticides | DDTs | |
DDT(p,p')(Surrogate) | Surrogate: p,p'-DDT | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | Pesticides | | | | |
DDT-13C12(o,p')(IsoDilAnalogue) | Isotope Dilution Analogue: o,p'-DDT-13C12 | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | Pesticides | IDA | | | |
DDT-13C12(p,p')(IsoDilAnalogue) | Isotope Dilution Analogue: p,p'-DDT-13C12 | 104215841 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | Pesticides | IDA | | | |
Dead Domestic Animals | Dead Domestic Animals | 0 | pieces |   |   |   |   |   | Debris | Trash | Non-Plastics | Marine Origin | | |
DebrisLandUse_Commercial | DebrisLandUse_Commercial | 0 | none |   |   |   |   |   | Habitat | Debris | | | | |
DebrisLandUse_Industrial | DebrisLandUse_Industrial | 0 | none |   |   |   |   |   | Habitat | Debris | | | | |
DebrisLandUse_LimitedTimeParking | DebrisLandUse_LimitedTimeParking | 0 | none |   |   |   |   |   | Habitat | Debris | | | | |
DebrisLandUse_OpenSpace | DebrisLandUse_OpenSpace | 0 | none |   |   |   |   |   | Habitat | Debris | | | | |
DebrisLandUse_Park | DebrisLandUse_Park | 0 | none |   |   |   |   |   | Habitat | Debris | | | | |
DebrisLandUse_ParkingLot | DebrisLandUse_ParkingLot | 0 | none |   |   |   |   |   | Habitat | Debris | | | | |
DebrisLandUse_Residential | DebrisLandUse_Residential | 0 | none |   |   |   |   |   | Habitat | Debris | | | | |
Decachlorobiphenyl(Surrogate) | Surrogate: Decachlorobiphenyl | 2051243 |   | % recovery |   |   |   |   | Organics | PCBs | | | | |
Decafluorobiphenyl(Surrogate) | Surrogate: Decafluorobiphenyl | 434902 |   | % recovery |   |   |   |   | Organics | PAHs | SVOCs | | | |
Dehydronifedipine | Dehydronifedipine | 0 |   |   |   |   | ng/g ww | ng/g dw | Organics | | | | | |
Deltamethrin | Deltamethrin | 52918635 |   | ug/L | ug/Kg dw |   |   |   | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | |
Deltamethrin/Tralomethrin | Deltamethrin/Tralomethrin | 0 |   | ug/L | ug/Kg dw |   |   |   | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | |
Deltamethrin-d6, Total(Surrogate) | Surrogate: Total Deltamethrin-d6 | 0 |   | % recovery |   |   |   |   | Organics | | | | | |
Demeton, Total | Total Demeton | 0 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Pest-Ops | | | |
Demeton-O | Demeton-O | 0 |   | ug/L |   |   |   |   | Organics | | | | | |
Demeton-s | Demeton-s | 8065483 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Pest-OPs | Insecticides | | |
Density | Density of Sample | 0 |   | sigma-t |   |   |   |   | Habitat | | | | | |
Deposits | Deposits | 0 | none |   |   |   |   |   | | | | | | |
Desethyl-Atrazine | Desethyl-Atrazine | 6190654 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-Triazines | | | |
Desethyl-desisopropyl-atrazine | Desethyl-desisopropyl-atrazine | 3397624 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-Triazines | | | |
Desisopropyl-Atrazine | Desisopropyl-Atrazine | 1007289 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-Triazines | | | |
Desmethyl-LR | Desmethyl-LR | 120011667 |   | ug/L |   |   | ng/g ww | ng/g dw | Microbiological | Cyanotoxins | | | | |
Desmethyl-RR | Desmethyl-RR | 0 |   | ug/L |   |   | ng/g ww | ng/g dw | Microbiological | Cyanotoxins | | | | |
Desmetryn | Desmetryn | 1014693 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-Triazines | | | |
Desthio-prothioconazole | Desthio-prothioconazole | 120983644 |   | ng/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
Detergent | Detergent | 0 |   | mg/L |   |   |   |   | FieldObservations | Habitat | | | | |
Deuterium/Hydrogen Ratio | Deuterium/Hydrogen Ratio | 7782390 |   | per mil |   |   |   |   | Isotopes | | | | | |
Diazepam | Diazepam | 439145 |   | ng/L |   |   |   |   | Organics | PPCPs | | | | |
Diazinon | Diazinon | 333415 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OPs | | | |
Diazinon oxon | Diazinon oxon | 0 |   | ng/L |   |   |   |   | Organics | Pesticides | | | | |
Dibenz(a,h)anthracene | Dibenz(a,h)anthracene | 53703 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | HMW_PAH | | |
Dibenz(a,h)anthracene, C1- | C1-Dibenz(a,h)anthracene | 0 |   | ng/L |   |   |   |   | Organics | PAHs | | | | |
Dibenz(a,h)anthracene, C2- | C2-Dibenz(a,h)anthracene | 0 |   | ng/L |   |   |   |   | Organics | PAHs | | | | |
Dibenz(a,h)anthracene, C3- | C3-Dibenz(a,h)anthracene | 0 |   | ng/L |   |   |   |   | Organics | PAHs | | | | |
Dibenz(a,h)anthracene-d14(IsoDilAnalogue) | Isotope Dilution Analogue: Dibenz(a,h)anthracene-d14 | 13250981 |   | % recovery |   |   |   |   | Organics | PAHs | IDA | | | |
Dibenz(a,h)anthracene-d14(Surrogate) | Surrogate: Dibenz(a,h)anthracene-d14 | 53703 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PAH | | | | |
Dibenzofuran | Dibenzofuran | 132649 |   | ug/L |   |   |   |   | Organics | SVOCs | Insecticides | | | |
Dibenzothiophene | Dibenzothiophene | 132650 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | | | |
Dibenzothiophene-d8(IsoDilAnalogue) | Isotope Dilution Analogue: Dibenzothiophene-d8 | 33262292 |   | % recovery |   |   |   |   | Organics | PAHs | IDA | | | |
Dibenzothiophene-d8(Surrogate) | Surrogate: Dibenzothiophene-d8 | 33262292 |   | % recovery | % recovery |   |   |   | Organics | PAHs | SVOCs | | | |
Dibenzothiophenes, C1- | C1-Dibenzothiophenes | 0 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | | | |
Dibenzothiophenes, C2- | C2-Dibenzothiophenes | 0 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | | | |
Dibenzothiophenes, C3- | C3-Dibenzothiophenes | 0 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | | | |
Dibenzothiophenes, C4- | C4-Dibenzothiophenes | 0 |   | ng/L |   |   |   |   | Organics | PAHs | | | | |
Dibromo-3-Chloropropane, 1,2- | 1,2-Dibromo-3-Chloropropane (DBCP) | 96128 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Dibromo-4-hydroxybenzonitrile, 3,5- | 3,5-Dibromo-4-hydroxybenzonitrile (Bromoxynil) | 1689845 |   | ug/L |   |   |   |   | Organics | SVOCs | | | | |
Dibromobiphenyl, 4,4'-(Surrogate) | Surrogate: 4,4'-Dibromobiphenyl | 92864 |   | % recovery |   |   |   |   | Organics | | | | | |
Dibromochloromethane | Dibromochloromethane | 124481 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Dibromoethane, 1,2- | 1,2-Dibromoethane | 106934 |   | ug/L |   |   |   |   | Organics | VOCs | Insecticides | | | |
Dibromofluoromethane(Surrogate) | Surrogate: Dibromofluoromethane | 186857 |   | % recovery |   |   |   |   | Organics | VOCs | | | | |
Dibromomethane | Dibromomethane | 74953 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Dibromooctafluorobiphenyl, 4,4'-(Surrogate) | Surrogate: 4,4'-Dibromooctafluorobiphenyl (DBOFB) | 10386842 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | Pesticides | Pest-OCHs | | | |
Dibromooctafluorobiphenyl, 4,4'-(Surrogate)DB-608 | Surrogate: 4,4Â’-Dibromooctafluorobiphenyl run on column DB-608 | 10386842 |   | % recovery | % recovery |   |   |   | Organics | Pesticides | Pest-OCHs | | | |
Dibromooctafluorobiphenyl, 4,4'-(Surrogate)HP-5 | Surrogate: 4,4Â’-Dibromooctafluorobiphenyl run on column HP-5 | 10386842 |   | % recovery | % recovery |   |   |   | Organics | Pesticides | Pest-OCHs | | | |
Dibromopropane, 1,2-(Surrogate) | Surrogate: 1,2-Dibromopropane | 78751 |   | % recovery |   |   |   |   | Organics | | | | | |
Dibutylchlorendate(Surrogate) | Surrogate: Dibutylchlorendate (DBCE) | 1770805 |   | % recovery | % recovery |   |   |   | Organics | Pesticides | Pest-Pyrethroids | | | |
Dibutyltin as Sn | Dibutyltin as Sn (DBT) | 683181 |   | ug/L | ug/Kg dw |   | ng/g ww | ng/g dw | Organics | Organotins | Biocide | | | |
Dicamba | Dicamba (2,5-Dichloro-6-methoxybenzoic Acid) | 1918009 |   | ug/L |   |   |   |   | Organics | Herbicides | | | | |
Dichlofenthion | Dichlofenthion | 97176 |   | ug/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | Pesticides | Pest-OPs | Insecticides | Nematocides | |
Dichlofenthion(Surrogate) | Surrogate: Dichlofenthion | 97176 |   | % recovery |   |   |   |   | Organics | Pesticides | | | | |
Dichlone | Dichlone | 117806 |   | ug/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
Dichloran | Dichloran (Botran) (Benzenamine, 2,6-dichloro-4-nitro-) | 99309 |   | ug/L | ug/Kg dw |   |   |   | Organics | Pesticides | Pyrethroid Pesticides | | | |
Dichloroacetate(Surrogate) | Surrogate: Dichloroacetate | 0 |   | % recovery |   |   |   |   | Organics | | | | | |
Dichloroaniline, 3,4- | 3,4-Dichloroaniline | 0 |   | ug/L |   |   |   |   | | | | | | |
Dichloroaniline, 3,5- | 3,5-Dichloroaniline | 626437 |   | ng/L |   |   |   |   | Organics | Pesticides | | | | |
Dichlorobenzenamine, 3,4- | 3,4-Dichlorobenzenamine (3,4-DCA) | 95761 |   | ug/L |   |   |   |   | Organics | Pesticides | | | | |
Dichlorobenzene, 1,2- | 1,2-Dichlorobenzene | 95501 |   | ug/L | ug/Kg dw |   |   |   | Organics | VOCs | SVOCs | Herbicides | | |
Dichlorobenzene, 1,3- | 1,3-Dichlorobenzene | 541731 |   | ug/L | ug/Kg dw |   |   |   | Organics | VOCs | SVOCs | Insecticides | | |
Dichlorobenzene, 1,4- | 1,4-Dichlorobenzene | 106467 |   | ug/L | ug/Kg dw |   |   |   | Organics | VOCs | SVOCs | Insecticides | | |
Dichlorobenzene-13C6,1,4-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,4-Dichlorobenzene-13C6 | 201595597 |   |   | % recovery |   | % recovery | % recovery | | | | | | |
Dichlorobenzene-d4, 1,2-(Surrogate) | Surrogate: 1,2-Dichlorobenzene-d4 | 0 |   | % recovery |   |   |   |   | Organics | | | | | |
Dichlorobenzene-d4, 1,4-(Surrogate) | Surrogate: 1,4-Dichlorobenzene-d4 | 3855821 |   | % recovery |   |   |   |   | Organics | VOCs | SVOCs | Insecticides | | |
Dichlorobenzidine, 3,3'- | 3,3'-Dichlorobenzidine | 0 |   | ug/L |   |   |   |   | Organics | SVOCs | | | | |
Dichlorobenzoic Acid, 3,5- | 3,5-Dichlorobenzoic Acid | 0 |   | ug/L |   |   |   |   | | | | | | |
Dichlorobenzonitrile, 2,6- | 2,6-Dichlorobenzonitrile (Dichlobenil) | 1194656 |   | ug/L |   |   |   |   | Organics | Pesticides | Herbicides | | | |
Dichlorodifluoromethane | Dichlorodifluoromethane | 75718 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Dichloroethane, 1,1- | 1,1-Dichloroethane | 75343 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Dichloroethane, 1,2- | 1,2-Dichloroethane | 107062 |   | ug/L |   |   |   |   | Organics | VOCs | | Insecticides | | |
Dichloroethane-d4, 1,2-(Surrogate) | Surrogate: 1,2-Dichloroethane-d4 | 17060070 |   | % recovery |   |   |   |   | Organics | VOCs | | | | |
Dichloroethylene, 1,1- | 1,1-Dichloroethylene (1,1-Dichloroethene) | 75354 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Dichloroethylene, cis 1,2- | cis-1,2-Dichloroethylene (cis-1,2-Dichloroethene) | 156592 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Dichloroethylene, trans 1,2- | trans-1,2-Dichloroethylene (trans-1,2-Dichloroethene) | 156605 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Dichlorophenol, 2,4- | 2,4-Dichlorophenol | 120832 |   | ug/L | mg/Kg dw |   |   |   | Organics | SVOCs | Phenols | Chlorinated Phenols | | |
Dichlorophenol, 2,6- | 2,6-Dichlorophenol | 0 |   | ug/L | mg/Kg dw |   |   |   | | | | | | |
Dichlorophenoxyacetic Acid, 2,3-(Surrogate) | Surrogate: 2,3-Dichlorophenoxyacetic Acid (2,3-D) | 2976741 |   | % recovery |   |   |   |   | Organics | | | | | |
Dichlorophenoxyacetic Acid, 2,4- | 2,4-Dichlorophenoxyacetic Acid (2,4-D) | 94757 |   | ug/L |   |   |   |   | Organics | Herbicides | | | | |
Dichlorophenoxybutyric Acid Methyl Ester, 2,4- | 2,4-Dichlorophenoxybutyric Acid Methyl Ester (2,4-DB Methyl Ester) | 0 |   | ug/L |   |   |   |   | Organics | Herbicides | | | | |
Dichlorophenoxybutyric Acid, 2,4- | 2,4-Dichlorophenoxybutyric Acid (2,4-DB) | 94826 |   | ug/L |   |   |   |   | Organics | Herbicides | | | | |
Dichlorophenyl Urea, 3,4- | 3,4-Dichlorophenyl Urea (DCPU) | 2327028 |   | ug/L |   |   |   |   | Organics | Pesticides | | | | |
Dichlorophenyl-3-methyl Urea, 3,4- | 3,4-Dichlorophenyl-3-methyl Urea (DCPMU) | 3567622 |   | ug/L |   |   |   |   | Organics | Pesticides | | | | |
Dichlorophenylacetic Acid, 2,4- (Surrogate) | Surrogate: 2,4-Dichlorophenylacetic Acid | 19719289 |   | % recovery |   |   |   |   | Organics | Herbicides | | | | |
Dichloroprop | Dichlorprop (2-(2,4-Dichlorophenoxy)propanoic Acid) | 120365 |   | ug/L |   |   |   |   | Organics | Herbicides | | | | |
Dichloropropane, 1,2- | 1,2-Dichloropropane | 78875 |   | ug/L |   |   |   |   | Organics | VOCs | Insecticides | Nematocides | | |
Dichloropropane, 1,3- | 1,3-Dichloropropane | 142289 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Dichloropropane, 2,2- | 2,2-Dichloropropane | 594207 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Dichloropropene, 1,1- | 1,1-Dichloropropene | 563586 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Dichloropropene, 1,3- | 1,3-Dichloropropene | 0 |   | ug/L |   |   |   |   | | | | | | |
Dichloropropene, cis 1,3- | cis-1,3-Dichloropropene | 10061015 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Dichloropropene, Total 1,3- | Total 1,3-Dichloropropene | 0 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Dichloropropene, trans 1,3- | trans-1,3-Dichloropropene | 10061026 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Dichloropropionic Acid, 2,2- | 2,2-Dichloropropionic Acid (Dalapon) | 75990 |   | ug/L |   |   |   |   | Organics | Herbicides | | | | |
Dichloro-pyridine-2-carboxylic Acid, 3,6- | 3,6-Dichloro-pyridine-2-carboxylic Acid (Clopyralid) | 1702176 |   | ug/L |   |   |   |   | Organics | Herbicides | | | | |
Dichlorvos | Dichlorvos | 62737 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Pest-OPs | Insecticides | | |
Diclofenac | Diclofenac (2-(2-(2,6-Dichlorophenylamino)phenyl)acetic Acid) | 0 |   | ng/L |   |   |   |   | | | | | | |
Dicofol | Dicofol | 115322 |   | ug/L | ug/Kg dw |   |   |   | Organics | Pesticides | Pest-OCHs | | | |
Dicrotophos | Dicrotophos | 141662 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-OPs | Insecticides | | |
Dieldrin | Dieldrin | 60571 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OCHs | Insecticides | Endocrine Disruptors | |
Dieldrin(Surrogate) | Surrogate: Dieldrin | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | | | | | |
Dieldrin-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Dieldrin-13C12 | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | Pesticides | IDA | | | |
Diesel Fuel | Diesel Fuel | 0 |   | ug/L |   |   |   |   | Organics | | | | | |
Diethatyl-Ethyl | Diethatyl-Ethyl | 38727558 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Herbicides | | | |
Diethyl phthalate | Diethyl phthalate | 84662 |   | ug/L | ug/kg |   |   |   | Organics | SVOCs | | | | |
Diethyl-3-methyl-benzamide, N,N- | N,N-Diethyl-3-methyl-benzamide | 134623 |   | ng/L |   |   |   |   | Organics | PPCPs | | | | |
Difenoconazole | Difenoconazole | 119446683 |   | ng/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
Diflubenzuron | Diflubenzuron (Difluron) | 35367385 |   | ug/L |   |   |   |   | Organics | Pesticides | | | | |
Difluoro-2,2',3,4,4'-Pentabromodiphenyl Ether, 5,6-(Surrogate) | Surrogate: 5,6-Difluoro-2,2',3,4,4'-Pentabromodiphenyl Ether | 886748330 |   |   | % recovery |   |   |   | Organics | PBDEs | | | | |
Difluoro-2,2Â’,3,3Â’,4,5,5Â’,6Â’-Octabromodiphenyl Ether 4Â’,6-(Surrogate) | Surrogate: 4Â’,6-Difluoro-2,2Â’,3,3Â’,4,5,5Â’,6Â’-Octabromodiphenyl Ether | 0 |   |   | % recovery |   |   |   | Organics | PBDEs | | | | |
Digoxigenin | Digoxigenin | 0 |   |   |   |   | ng/g ww | ng/g dw | Organics | | | | | |
Digoxin | Digoxin | 0 |   |   |   |   | ng/g ww | ng/g dw | Organics | | | | | |
Diisopropyl Ether | Diisopropyl Ether | 108203 |   | ug/L |   |   |   |   | Organics | SVOCs | | | | |
Diltiazem | Diltiazem | 0 |   |   |   |   | ng/g ww | ng/g dw | Organics | | | | | |
Dimethoate | Dimethoate | 60515 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Pest-OPs | Insecticides | Nematocides | |
Dimethomorph | Dimethomorph | 110488705 |   | ng/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
Dimethyl Phthalate | Dimethyl Phthalate | 131113 |   | ug/L | ug/kg |   |   |   | Organics | SVOCs | | | | |
Dimethyl-2-nitrobenzene, 1,3- | 1,3-Dimethyl-2-nitrobenzene | 0 |   | ug/L |   |   |   |   | Organics | | | | | |
Dimethyl-2-nitrobenzene, 1,3-(Surrogate) | Surrogate: 1,3-Dimethyl-2-nitrobenzene (2,6-Dimethylnitrobenzene) | 81209 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Dimethylchrysene, 5,9- | 5,9-Dimethylchrysene | 0 |   | ng/L |   |   |   |   | Organics | PAHs | | | | |
Dimethyldibenzothiophene, 2,4- | 2,4-Dimethyldibenzothiophene | 0 |   | ng/L |   |   |   |   | Organics | PAHs | | | | |
Dimethyldibenzothiophene, 4,6- | 4,6-Dimethyldibenzothiophene | 1207121 |   | ng/L |   |   |   |   | Organics | PAHs | | | | |
Dimethylfluorene, 1,7- | 1,7-Dimethylfluorene | 442660 |   | ng/L |   |   |   |   | Organics | PAHs | | | | |
Dimethylnaphthalene, 1,2- | 1,2-Dimethylnaphthalene | 0 |   | ng/L |   |   |   |   | Organics | SVOCs | | | | |
Dimethylnaphthalene, 2,6- | 2,6-Dimethylnaphthalene | 581420 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | LMW_PAH | | |
Dimethylnaphthalene, 2,6-(Surrogate) | Surrogate: 2,6-Dimethylnaphthalene | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | | | | | |
Dimethylnaphthalene-d12, 2,6-(IsoDilAnalogue) | Isotope Dilution Analogue: 2,6-Dimethylnaphthalene-d12 | 350820121 |   | % recovery |   |   |   |   | Organics | PAHs | IDA | | | |
Dimethylnaphthalene-d12, 2,6-(Surrogate) | Surrogate: 2,6-Dimethylnaphthalene-d12 | 581420 |   | % recovery |   |   | % recovery | % recovery | Organics | | | | | |
Dimethylphenanthrene, 1,5/1,7- | 1,5-Dimethylphenanthrene/1,7-Dimethylphenanthrene | 0 |   | ng/L |   |   |   |   | Organics | PAHs | | | | |
Dimethylphenanthrene, 1,7- | 1,7-Dimethylphenanthrene | 483874 |   | ng/L |   |   |   |   | Organics | PAHs | | | | |
Dimethylphenanthrene, 1,8- | 1,8-Dimethylphenanthrene | 7372874 |   | ng/L |   |   |   |   | Organics | PAHs | | | | |
Dimethylphenanthrene, 2,6- | 2,6-Dimethylphenanthrene | 0 |   | ng/L |   |   |   |   | Organics | PAHs | | | | |
Dimethylphenanthrene, 3,6- | 3,6-Dimethylphenanthrene | 1576676 |   | ug/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | PAHs | SVOCs | LMW_PAH | | |
Dimethylphenol, 2,4- | 2,4-Dimethylphenol | 105679 |   | ug/L | mg/Kg dw |   |   |   | Organics | SVOCs | Phenols | non-Chlorinated Phenols | | |
Dimethylxanthine, 1,7- | Dimethylxanthine, 1,7- | 0 |   |   |   |   | ng/g ww | ng/g dw | Organics | | | | | |
Di-n-butyl Phthalate | Di-n-butyl Phthalate | 84742 |   | ug/L | ug/kg |   |   |   | Organics | SVOCs | Endocrine Disruptors | | | |
Dinitro-2-methylphenol, 4,6- | 4,6-Dinitro-2-methylphenol | 534521 |   | ug/L | mg/Kg dw |   |   |   | Organics | SVOCs | Phenols | non-Chlorinated Phenols | Nitrophenols | |
Dinitrophenol, 2,4- | 2,4-Dinitrophenol | 51285 |   | ug/L | mg/Kg dw |   |   |   | Organics | SVOCs | Phenols | non-Chlorinated Phenols | Nitrophenols | |
Dinitrotoluene, 2,4- | 2,4-Dinitrotoluene | 121142 |   | ug/L | ug/kg |   |   |   | Organics | SVOCs | | | | |
Dinitrotoluene, 2,6- | 2,6-Dinitrotoluene | 606202 |   | ug/L | ug/kg |   |   |   | Organics | SVOCs | | | | |
Di-n-octyl Phthalate | Di-n-octyl Phthalate | 117840 |   | ug/L | ug/kg |   |   |   | Organics | SVOCs | | | | |
Dinoseb | Dinoseb (2,4-Dinitro-6-sec-butylphenol) | 88857 |   | ug/L |   |   |   |   | Organics | Herbicides | | | | |
Dinotefuran | Dinotefuran | 165252700 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Insecticides | | | |
Dioxa-3H-Perfluorononanoate Acid, 4,8- | 4,8-Dioxa-3H-Perfluorononanote Acid (ADONA) | 919005144 |   | ng/L | ng/g dw |   | ng/g ww | ng/g dw | | | | | | |
Dioxane, 1,4- | 1,4-Dioxane | 0 |   | ug/L |   |   |   |   | | | | | | |
Dioxathion | Dioxathion | 87342 |   | ug/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | Pesticides | Pest-OPs | Insecticides | | |
Diphenamid | Diphenamid | 957517 |   | ug/L |   |   |   |   | Organics | Pesticides | Herbicides | | | |
Diphenamid(Surrogate) | Surrogate: Diphenamid | 957517 |   | % recovery |   |   |   |   | Organics | Pesticides | | | | |
Diphenhydramine | Diphenhydramine | 0 |   |   |   |   | ng/g ww | ng/g dw | Organics | | | | | |
Diphenylamine | Diphenylamine | 122394 |   | ug/L |   |   |   |   | Organics | Pesticides | | | | |
Diphenylhydrazine, 1,2- | 1,2-Diphenylhydrazine | 0 |   | ug/L |   |   |   |   | Organics | | | | | |
Dipropetryn | Dipropetryn | 4147517 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-Triazines | | | |
Diquat | Diquat | 7440620 |   | ug/L |   |   |   |   | Organics | Pesticides | | | | |
Discharge | Discharge from a calculation | 0 |   | ft/s |   |   |   |   | WaterQualityMeasurements | | | | | |
DischargeMeasurementMethod | Method used to collect discharge (velocity) measurement | 0 | none |   |   |   |   |   | WaterQualityMeasurements | | | | | |
DischargeMeasurementRating | Code qualifying the stream discharge measurement quality in relation to the actual flow | 0 | none |   |   |   |   |   | WaterQualityMeasurements | | | | | |
Dissolved Inorganic Carbon | Dissolved Inorganic Carbon (DIC) | 0 |   | mg/L |   |   |   |   | Inorganics | Conventionals | | | | |
Dissolved Organic Carbon | Dissolved Organic Carbon (DOC) | 0 |   | mg/L |   |   |   |   | Inorganics | Conventionals | | | | |
Distance from Bank | Distance from Bank | 0 | m |   |   |   |   |   | Habitat | | | | | |
Distance to Bankfull | Distance from the wetted edge to the Bankfull mark | 0 | m |   |   |   |   |   | Habitat | | | | | |
Distance, Float | Float distance of observed object | 0 | m |   |   |   |   |   | Habitat | | | | | |
Distance, Sampled | Distance sampled within a given waterbody | 0 | m |   |   |   |   |   | Habitat | | | | | |
Disulfoton | Disulfoton | 298044 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Pest-OPs | Insecticides | | |
Dithiopyr | Dithiopyr | 97886458 |   | ng/L |   |   |   |   | Organics | Pesticides | Herbicides | | | |
Diuron | Diuron | 330541 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-Carbamates | Herbicides | | |
Diuron-d6(Surrogate) | Surrogate: Diuron-d6 | 1007536675 |   | % recovery |   |   |   |   | Organics | Pesticides | Pest-Carbamates | Herbicides | | |
Docosahexaenoic Acid | Docosahexaenoic Acid | 6217545 |   |   |   |   | mg/100g ww | mg/100g dw | Organics | Omega Fatty Acid | | | | |
Docosapentaenoic Acid | Docosapentaenoic Acid | 0 |   |   |   |   | mg/100g ww | mg/100g dw | Organics | Omega Fatty Acid | | | | |
Dodine | Dodine | 2439103 |   | ug/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
Dog_DG37 | Dog_DG37 | 0 |   | copies/100 mL |   |   |   |   | Microbiological | | | | | |
Dominant Benthic Substrate | Dominant Benthic Substrate - Specific to EMAP BA | 0 | none |   |   |   |   |   | Habitat | | | | | |
Dominant Land Use | Dominant Land Use | 0 | none |   |   |   |   |   | Habitat | | | | | |
DominantSubstrate | DominantSubstrate | 0 | none |   |   |   |   |   | FieldObservations | Habitat | | | | |
Domoic Acid | Domoic Acid | 14277975 |   | ug/L |   |   | ng/g ww | ng/g dw | Microbiological | Cyanotoxins | | | | |
Doxycycline | Doxycycline | 564250 |   | ug/L |   |   |   |   | Organics | PPCPs | | | | |
Dredging | Dredging | 0 | none |   |   |   |   |   | Habitat | | | | | |
Dry | Dry | 0 | none |   |   |   |   |   | Habitat | | | | | |
Dry Weight | Dry Weight | 0 |   |   | % |   |   |   | Tissue | | | | | |
Dumping | Dumping using Trash Protocol | 0 | score |   |   |   |   |   | Trash | | | | | |
E. coli | Escherichia coli | 0 |   | MPN/100 mL | MPN/g dw |   |   |   | Microbiological | Pathogens | Conventional | | | |
E. Coli O157:H7 | Escherichia Coli O157:H7 strain | 0 |   | none |   |   |   |   | Microbiological | Pathogens | Conventional | | | |
Eicosapentaenoate | Eicosapentaenoate | 0 |   |   |   |   | mg/100g ww | mg/100g dw | Organics | Omega Fatty Acid | | | | |
ElectricalConductivity | Electrical Conductivity | 0 |   | uS/cm |   |   |   |   | WaterQualityMeasurements | Conventionals | | | | |
Elevation Difference | Elevation Difference | 0 | cm |   |   |   |   |   | Habitat | | | | | |
Embeddedness | Embeddedness | 0 | % |   |   |   |   |   | Habitat | | | | | |
End Time | Time (hh:mm) when a given event ended | 0 | none |   |   |   |   |   | Habitat | | | | | |
Endosulfan I | Endosulfan I (alpha-Endosulfan) | 959988 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OCHs | Insecticides | Endosulfans | |
Endosulfan I(Surrogate) | Surrogate: Endosulfan I (alpha-Endosulfan) | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | | | | | |
Endosulfan I-13C9(IsoDilAnalogue) | Isotope Dilution Analogue: Endosulfan I-13C9 | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | Pesticides | IDA | | | |
Endosulfan I-d4(Surrogate) | Surrogate: Endosulfan I-d4 | 0 |   | % recovery |   |   |   |   | Organics | Pesticides | | | | |
Endosulfan II | Endosulfan II (beta-Endosulfan) | 33213659 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OCHs | Insecticides | Endosulfans | |
Endosulfan II(Surrogate) | Surrogate: Endosulfan II (beta-Endosulfan) | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | | | | | |
Endosulfan II-13C9(IsoDilAnalogue) | Isotope Dilution Analogue: Endosulfan II-13C9 | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | Pesticides | IDA | | | |
Endosulfan II-d4(Surrogate) | Surrogate: Endosulfan II-d4 | 0 |   | % recovery |   |   |   |   | Organics | Pesticides | | | | |
Endosulfan Sulfate | Endosulfan Sulfate | 1031078 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OCHs | Insecticides | Endosulfans | |
Endosulfan Sulfate-13C9(IsoDilAnalogue) | Isotope Dilution Analogue: Endosulfan Sulfate-13C9 | 0 |   |   | % recovery |   |   |   | | | | | | |
Endrin | Endrin | 72208 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OCHs | Insecticides | Endrins | |
Endrin Aldehyde | Endrin Aldehyde | 7421934 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OCHs | Insecticides | Endrins | |
Endrin Aldehyde(Surrogate) | Surrogate: Endrin Aldehyde | 0 |   |   | % recovery |   |   |   | Organics | | | | | |
Endrin Aldehyde-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Endrin Aldehyde-13C12 | 0 |   |   | % recovery |   |   |   | Organics | Pesticides | IDA | | | |
Endrin Ketone | Endrin Ketone | 53494705 |   | ug/L | ug/Kg ww |   | ng/g ww | ng/g dw | Organics | Pesticides | Pest-OCHs | Insecticides | Endrins | |
Endrin Ketone-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Endrin Ketone-13C12 | 53494705 |   |   | % recovery |   |   |   | Organics | Pesticides | IDA | | | |
Endrin(Surrogate) | Surrogate: Endrin | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | | | | | |
Endrin-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Endrin-13C12 | 72208 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | Pesticides | IDA | | | |
Enrofloxacin | Enrofloxacin | 0 |   |   |   |   | ng/g ww | ng/g dw | Organics | | | | | |
Enterococcus | Enterococcus | 0 |   | TSC/100mL | MPN/g dw |   | MPN/g ww | MPN/g dw | Microbiological | Pathogens | Conventional | | | |
Enterovirus | Enterovirus | 0 |   | copies/100 mL |   |   |   |   | Microbiological | | | | | |
EPN | EPN | 2104645 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-OPs | Insecticides | | |
EPN(Surrogate) | Surrogate: EPN | 2104645 |   | % recovery |   |   |   |   | Organics | Pesticides | OrganophosphatePest. | Semi-VOAs | Insecticides | Endrins |
EPTC | EPTC | 759944 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Herbicides | | | |
EPTC(Surrogate) | Surrogate: EPTC | 759944 |   | % recovery |   |   |   |   | Organics | Pesticides | Herbicides | | | |
Erythromycin-H2O | Erythromycin-H2O | 0 |   | ug/L |   |   | ng/g ww | ng/g dw | Organics | PPCPs | | | | |
Erythromycin-H2O-13C2(Surrogate) | Surrogate: Erythromycin-H2O-13C2 | 0 |   |   |   |   | % recovery | % recovery | Organics | | | | | |
Esfenvalerate | Esfenvalerate | 66230044 |   | ug/L | ug/Kg dw |   |   |   | Organics | | | | | |
Esfenvalerate/Fenvalerate, Total | Total Esfenvalerate/Fenvalerate, sum peaks 1 & 2 | 51630581 |   | ug/L | ug/Kg dw |   |   |   | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | |
Esfenvalerate/Fenvalerate-1 | Esfenvalerate/Fenvalerate peak 1 | 51630581 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | |
Esfenvalerate/Fenvalerate-2 | Esfenvalerate/Fenvalerate peak 2 | 66230404 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | |
Esfenvalerate-d6, Total(Surrogate) | Surrogate: Total Esfenvalerate-d6, sum peaks 1 & 2 | 0 |   | % recovery | % recovery |   |   |   | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | |
Esfenvalerate-d6-1(Surrogate) | Surrogate: Esfenvalerate-d6 peak 1 | 0 |   | % recovery | % recovery |   |   |   | Organics | Pesticides | Insecticides | Pyrethoids | | |
Esfenvalerate-d6-2(Surrogate) | Surrogate: Esfenvalerate-d6 peak 2 | 0 |   | % recovery | % recovery |   |   |   | Organics | Pesticides | Insecticides | Pyrethoids | | |
Estradiol, 17beta- | 17beta-Estradiol | 50282 |   | ug/L |   |   |   |   | Organics | PPCPs | | | | |
Estradiol-d3, 17beta-(IsoDilAnalogue) | Isotope Dilution Analogue: 17beta-Estradiol-d3 | 79037379 |   | % recovery |   |   |   |   | Organics | | IDA | | | |
Estrone | Estrone | 0 |   | ng/L |   |   |   |   | | | | | | |
Ethaboxam | Ethaboxam | 162650773 |   | ng/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
Ethafluralin | Ethafluralin | 55283686 |   | ug/L |   |   |   |   | Organics | Pesticides | Herbicides | | | |
Ethalfluralin | Ethalfluralin | 55283686 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Herbicides | | | |
Ethion | Ethion | 563122 |   | ug/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | Pesticides | Pest-OPs | Insecticides | | |
Ethion(Surrogate) | Surrogate: Ethion | 563122 |   | % recovery |   |   |   |   | Organics | Pesticides | OrganophosphatePest. | OrganochlorinePest. | Semi-VOAs | Insecticides |
Ethofenprox | Ethofenprox | 80844071 |   | ug/L |   |   |   |   | Organics | PPCPs | | | | |
Ethoprop | Ethoprop (Prophos) | 13194484 |   | ug/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | Pesticides | Pest-OPs | Insecticides | Nematocides | |
Ethyl Ether | Ethyl Ether | 60297 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Ethyl Perfluorooctane Sulfonamido Acetic Acid, N- | N-Ethyl Perfluorooctane Sulfonamido Acetic Acid (Et-PFOSA-AcOH) | 0 |   | ng/L | ng/g dw |   | ng/g ww | ng/g dw | | | | | | |
Ethyl Perfluorooctane Sulfonamido Acetic Acid-d5, N-(IsoDilAnalogue) | Isotope Dilution Analogue: N-Ethyl Perfluorooctane Sulfonamido Acetic Acid-d5 (N-EtFOSAA) | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | | IDA | | | |
Ethyl Perfluorooctane Sulfonamido Acetic Acid-d5, N-(Surrogate) | Surrogate: N-Ethyl Perfluorooctane Sulfonamido Acetic Acid-d5 | 0 |   |   |   |   | % recovery | % recovery | Organics | PFAS | PFC Precursor | | | |
Ethyl Tert-butyl Ether | Ethyl Tert-butyl Ether (ETBE) | 637923 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Ethylbenzene | Ethylbenzene | 100414 |   | ug/L |   |   |   |   | Organics | VOCs | MTBE_BTEX | | | |
Ethylene Glycol | Ethylene Glycol | 0 |   | mg/L |   |   |   |   | | | | | | |
Ethyl-perfluorooctanesulfonamide, N- | N-Ethyl-perfluorooctanesulfonamide | 0 |   | ng/L | ng/g dw |   | ng/g ww | ng/g dw | | | | | | |
Ethyl-perfluorooctanesulfonamide-d5, N-(IsoDilAnalogue) | Isotope Dilution Analogue: N-Ethyl-perfluorooctanesulfonamide-d5 (N-EtFOSA) | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PFAs | IDA | | | |
Ethyl-perfluorooctanesulfonamide-d5, N-(Surrogate) | Surrogate: Ethyl-perfluorooctanesulfonamide-d5, N- (N-EtFOSA) | 0 |   |   |   |   | % recovery | % recovery | Organics | PFAS | | | | |
Ethyl-perfluorooctanesulfonamidoethanol, N- | N-Ethyl-perfluorooctanesulfonamidoethanol | 0 |   | ng/L | ng/g dw |   | ng/g ww | ng/g dw | | | | | | |
Ethyl-perfluorooctanesulfonamidoethanol-d9, N-(IsoDilAnalogue) | Isotope Dilution Analogue: N-Ethyl-perfluorooctanesulfonamidoethanol-d9 (N-EtFOSE) | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PFAs | IDA | | | |
Ethyl-perfluorooctanesulfonamidoethanol-d9, N-(Surrogate) | Surrogate: Ethyl-perfluorooctanesulfonamidoethanol-d9, N- (N-EtFOSE) | 0 |   |   |   |   | % recovery | % recovery | Organics | PFAS | | | | |
Ethynylestradiol, 17alpha- | 17alpha-Ethynylestradiol | 0 |   | ng/L |   |   |   |   | | | | | | |
Ethynylestradiol-d4, 17alpha-(IsoDilAnalogue) | Isotope Dilution Analogue: 17alpha-Ethynylestradiol-d4 | 350820063 |   | % recovery |   |   |   |   | Organics | | IDA | | | |
Ev_FlowHab | Evenness of flow habitat types physical-habitat metric | 0 | none |   |   |   |   |   | Bioassessment | | | | | |
Evidence of Fire | Evidence of Fire | 0 | none |   |   |   |   |   | Habitat | | | | | |
Evidence of Fire Intensity | Evidence of Fire Intensity - Specific to EMAP BA | 0 | none |   |   |   |   |   | Habitat | | | | | |
Evidence of Illegal Connection | Evidence of Illegal Connection | 0 | none |   |   |   |   |   | | | | | | |
Evidence of Illegal Dumping | Evidence of Illegal Dumping | 0 | none |   |   |   |   |   | | | | | | |
Evidence of Recent Rainfall | Evidence of Recent Rainfall | 0 | none |   |   |   |   |   | Habitat | | | | | |
Evidence of Scour | Site is affected by recent scouring event | 0 | none |   |   |   |   |   | Habitat | FieldObservations | | | | |
E-waste | E-waste | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Toxic | | |
Fabric | Fabric | 0 | pieces |   |   |   |   |   | Debris | Trash | Non-Plastics | Biodegradable | | |
Famoxadone | Famoxadone | 131807573 |   | ng/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
Famphur | Famphur | 52857 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-OPs | Insecticides | | |
FBDE 069 | Fluorobrominated Diphenyl Ether (FBDE) 069 (4'-Fluoro-2,3',4,6-tetrabromodiphenyl ether) | 863314878 |   |   | ng/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | | | | | |
FBDE 160 | Fluorobrominated Diphenyl Ether (FBDE) 160 (4'-Fluoro-2,3,3',4,5,6-hexabromodiphenyl ether) | 863314889 |   |   | ng/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | | | | | |
Fenamidone | Fenamidone | 161326347 |   | ng/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
Fenamiphos | Fenamiphos (Phosphoramidic acid, Isopropyl-, 4-(methylthio)-m-tolyl Ethyl Ester) | 22224926 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-Ops | Insecticides | | |
Fenarimol | Fenarimol | 60168889 |   | ng/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
Fenbuconazole | Fenbuconazole | 114369436 |   | ng/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
Fenchlorphos | Fenchlorphos (Ronnel) | 299843 |   | ug/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | Pesticides | Pest-OPs | Insecticides | | |
Fenhexamid | Fenhexamid | 126833178 |   | ng/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
Fenitrothion | Fenitrothion | 122145 |   | ug/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | Pesticides | Pest-OPs | Insecticides | | |
Fenpropathrin | Fenpropathrin (Danitol) | 39515418 |   | ug/L | ug/Kg dw |   |   |   | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | |
Fenpropathrin-d6(Surrogate) | Surrogate: Fenpropathrin-d6 | 0 |   |   | % recovery |   |   |   | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | |
Fenpyroximate | Fenpyroximate | 134098616 |   | ng/L |   |   |   |   | Organics | Pesticides | Insecticides | | | |
Fensulfothion | Fensulfothion | 115902 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Pest-OPs | Insecticides | Nematocides | |
Fenthion | Fenthion (Mercaptophos) | 55389 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Pest-OPs | Insecticides | | |
Fenuron | Fenuron | 101428 |   | ug/L |   |   |   |   | Organics | Pesticides | Herbicides | | | |
Fenvalerate | Fenvalerate | 51630581 |   | ug/L | ug/Kg dw |   |   |   | Organics | | | | | |
Fenvalerate-d5(Surrogate) | Surrogate: Fenvalerate-d5 | 0 |   | % recovery | % recovery |   |   |   | Organics | | | | | |
Fertilization | Fertilization (%) | 0 |   |   |   | % |   |   | Toxicity | | | | | |
Filling Time | Time to fill a collection device with water | 0 | seconds |   |   |   |   |   | Habitat | | | | | |
Fine | Fine | 0 |   |   | % |   |   |   | Inorganics | Conventionals | GrainSize | | | |
Fipronil | Fipronil | 120068373 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Insecticides | | | |
Fipronil Amide | Fipronil Amide | 0 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Insecticides | | | |
Fipronil Desulfinyl | Fipronil Desulfinyl | 205650653 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Insecticides | | | |
Fipronil Desulfinyl Amide | Fipronil Desulfinyl Amide | 1115248093 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Insecticides | | | |
Fipronil Sulfide | Fipronil Sulfide | 120067836 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Insecticides | | | |
Fipronil Sulfone | Fipronil Sulfone | 120068362 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Insecticides | | | |
Fipronil-13C4 15N2(Surrogate) | Surrogate: Fipronil-13C4 15N2 | 0 |   | % recovery |   |   |   |   | | | | | | |
Fipronil-C13(Surrogate) | Surrogate: Fipronil-C13 | 0 |   | % recovery |   |   |   |   | Organics | Pesticides | | | | |
Fireworks | Fireworks | 0 | pieces |   |   |   |   |   | Debris | Trash | Non-Plastics | Toxic | | |
Fish Cover Artificial Structures | Fish Cover/Instream Habitat Complexity – Other Artificial Structures | 0 | none |   |   |   |   |   | Habitat | | | | | |
Fish Cover Boulders | Fish Cover/Instream Habitat Complexity – Other Boulders | 0 | none |   |   |   |   |   | Habitat | | | | | |
Fish Cover Filamentous Algae | Fish Cover/Instream Habitat Complexity - Other Filamentous Algae | 0 | none |   |   |   |   |   | Habitat | | | | | |
Fish Cover Live Trees/Roots | Fish Cover/Instream Habitat Complexity – Other Live Trees or Roots | 0 | none |   |   |   |   |   | Habitat | | | | | |
Fish Cover Macrophytes | Fish Cover/Instream Habitat Complexity - Macrophytes | 0 | none |   |   |   |   |   | Habitat | | | | | |
Fish Cover Overhang.Veg | Fish Cover/Instream Habitat Complexity – Other Overhanging Vegetation =<1 m of surface | 0 | none |   |   |   |   |   | Habitat | | | | | |
Fish Cover Undercut Banks | Fish Cover/Instream Habitat Complexity – Other Undercut Banks | 0 | none |   |   |   |   |   | Habitat | | | | | |
Fish Cover Woody Debris <0.3 m | Fish Cover/Instream Habitat Complexity – Other Woody Debris <0.3 m | 0 | none |   |   |   |   |   | Habitat | | | | | |
Fish Cover Woody Debris >0.3 m | Fish Cover/Instream Habitat Complexity – Other Woody Debris >0.3 m | 0 | none |   |   |   |   |   | Habitat | | | | | |
Fish Stocking | Fish Stocking | 0 | none |   |   |   |   |   | Habitat | | | | | |
Fishing Line/Net | Fishing Line/Net | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Miscellaneous | | |
Float Time | Float time of observed object | 0 | seconds |   |   |   |   |   | Habitat | | | | | |
Floatables | Floatables | 0 | none |   |   |   |   |   | Habitat | | | | | |
Flonicamid | Flonicamid | 158062670 |   | ng/L |   |   |   |   | Organics | Pesticides | Insecticides | | | |
Fluazinam | Fluazinam | 79622596 |   | ng/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
Flucythrinate | Flucythrinate | 0 |   | ng/L |   |   |   |   | Organics | | | | | |
Fludioxonil | Fludioxonil | 131341861 |   | ng/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
Flufenacet | Flufenacet | 142459583 |   | ng/L |   |   |   |   | Organics | Pesticides | Herbicides | | | |
Flumequine | Flumequine | 0 |   |   |   |   | ng/g ww | ng/g dw | Organics | | | | | |
Flumetralin | Flumetralin | 62924703 |   | ng/L |   |   |   |   | Organics | Pesticides | Herbicides | | | |
Flumetsulam | Flumetsulam | 98967409 |   | ug/L |   |   |   |   | Organics | Herbicides | | | | |
Flumioxazin | Flumioxazin | 103361097 |   | ug/L |   |   |   |   | Organics | Pesticides | | | | |
Fluometuron | Fluometuron | 2164172 |   | ug/L |   |   |   |   | Organics | Pesticides | Herbicides | | | |
Fluopicolide | Fluopicolide | 239110157 |   | ng/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
Fluopyram | Fluopyram | 658066354 |   | ng/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
Fluoranthene | Fluoranthene | 206440 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | HMW_PAH | | |
Fluoranthene/Pyrenes, C1- | C1-Fluoranthene/Pyrenes | 0 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | HMW_PAH | | |
Fluoranthene-d10(IsoDilAnalogue) | Isotope Dilution Analogue: Fluoranthene-d10 | 93951690 |   | % recovery |   |   |   |   | Organics | PAHs | IDA | | | |
Fluoranthene-d10(Surrogate) | Surrogate: Fluoranthene-d10 | 206440 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PAH | | | | |
Fluoranthenes/Pyrenes, C2- | C2-Fluoranthenes/Pyrenes | 0 |   | ng/L |   |   |   |   | Organics | PAHs | | | | |
Fluoranthenes/Pyrenes, C3- | C3-Fluoranthenes/Pyrenes | 0 |   | ng/L |   |   |   |   | Organics | PAHs | | | | |
Fluoranthenes/Pyrenes, C4- | C4-Fluoranthenes/Pyrenes | 0 |   | ng/L |   |   |   |   | Organics | PAHs | | | | |
Fluorene | Fluorene | 86737 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | LMW_PAH | | |
Fluorenes, C1- | C1-Fluorenes | 0 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | LMW_PAH | | |
Fluorenes, C2- | C2-Fluorenes | 0 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | LMW_PAH | | |
Fluorenes, C3- | C3-Fluorenes | 0 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | LMW_PAH | | |
Fluorescence | Fluorescence | 0 |   | none |   |   |   |   | WaterQualityMeasurements | | | | | |
Fluoride | Fluoride | 16984488 |   | mg/L |   |   |   |   | Inorganics | Conventionals | | | | |
Fluoro-2,3',6-Tribromodiphenyl Ether, 4'-(Surrogate) | Surrogate: 4'-Fluoro-2,3',6-tribromodiphenyl Ether | 863314867 |   |   | % recovery |   |   |   | Organics | PBDEs | | | | |
Fluorobiphenyl, 2- | 2-Fluorobiphenyl | 0 |   | ug/L |   |   | ng/g ww | ng/g dw | | | | | | |
Fluorobiphenyl, 2-(Surrogate) | Surrogate: 2-Fluorobiphenyl | 321608 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | SVOCs | | | | |
Fluorophenol, 2- | 2-Fluorophenol | 0 |   | ug/L |   |   |   |   | | | | | | |
Fluorophenol, 2-(Surrogate) | Surrogate: 2-Fluorophenol | 367124 |   | ug/L |   |   |   |   | Organics | SVOCs | Phenols | non-Chlorinated Phenols | | |
Fluorotelomer Carboxylic Acid, 3:3- | 3:3 Fluorotelomer carboxylic acid (2H, 2H, 3H, 3H-perfluorohexanoic acid) (3:3 FTCA) | 356025 |   | ng/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | PFAS | | | | |
Fluorotelomer Carboxylic Acid, 5:3- | 5:3 Fluorotelomer carboxylic acid (2H, 2H, 3H, 3H-perfluorooctanoic acid) (5:3 FTCA) | 0 |   | ng/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | PFAS | | | | |
Fluorotelomer Carboxylic Acid, 7:3- | 7:3 Fluorotelomer carboxylic acid (2H, 2H, 3H, 3H-perfluorodecanoic acid) (7:3 FTCA) | 812704 |   | ng/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | PFAS | | | | |
Fluorotelomer Sulfonate, 4:2- | 4:2-Fluorotelomer Sulfonate (4:2 FTS) | 757124724 |   | ng/L | ng/g dw |   | ng/g ww | ng/g dw | | | | | | |
Fluorotelomer Sulfonate, 6:2- | 6:2-Fluorotelomer Sulfonate (6:2 FTS) | 27619972 |   | ng/L | ng/g dw |   | ng/g ww | ng/g dw | | | | | | |
Fluorotelomer Sulfonate, 8:2- | 8:2-Fluorotelomer Sulfonate (8:2 FTS) | 39108344 |   | ng/L | ng/g dw |   | ng/g ww | ng/g dw | | | | | | |
Fluorotelomer Sulfonate-13C, 6:2-(Surrogate) | Surrogate: 6:2-Fluorotelomer Sulfonate-13C | 0 |   |   |   |   | % recovery | % recovery | Organics | PFAS | PFC Precursor | | | |
Fluorotelomer Sulfonate-13C2, 4:2-(IsoDilAnalogue) | Isotope Dilution Analogue: 4:2-Fluorotelomer Sulfonate-13C2 (4:2 FTS) | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PFAs | IDA | | | |
Fluorotelomer Sulfonate-13C2, 4:2-(Surrogate) | Surrogate: Fluorotelomer Sulfonate-13C2, 4:2- (4:2 FTS) | 0 |   |   |   |   | % recovery | % recovery | Organics | PFAS | | | | |
Fluorotelomer Sulfonate-13C2, 6:2-(IsoDilAnalogue) | Isotope Dilution Analogue: 6:2-Fluorotelomer Sulfonate-13C2 (6:2 FTS) | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PFAs | IDA | | | |
Fluorotelomer Sulfonate-13C2, 8:2-(IsoDilAnalogue) | Isotope Dilution Analogue: 8:2-Fluorotelomer Sulfonate-13C2 (8:2 FTS) | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PFAs | IDA | | | |
Fluorotelomer Sulfonate-13C2, 8:2-(Surrogate) | Surrogate: Fluorotelomer Sulfonate-13C2, 8:2- (8:2 FTS) | 0 |   |   |   |   | % recovery | % recovery | Organics | PFAS | | | | |
Fluoxastrobin | Fluoxastrobin | 193740760 |   | ng/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
Fluoxetine | Fluoxetine | 54910893 |   | ug/L |   |   | ng/g ww | ng/g dw | Organics | PPCPs | | | | |
Fluoxetine-d5(Surrogate) | Surrogate: Fluoxetine-d5 | 0 |   |   |   |   | % recovery | % recovery | Organics | | | | | |
Fluridone | Fluridone | 59756604 |   | ug/L |   |   |   |   | Organics | Pesticides | Herbicides | | | |
Fluridone(Surrogate) | Surrogate: Fluridone | 59756604 |   | % recovery | % recovery |   |   |   | Organics | Pesticides | Pest-Pyrethroids | | | |
Flusilazole | Flusilazole | 85509199 |   | ng/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
Flutolanil | Flutolanil | 66332965 |   | ug/L |   |   |   |   | Organics | Fungicides | | | | |
Flutriafol | Flutriafol | 76674210 |   | ng/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
Fluvalinate | Fluvalinate | 0 |   | ug/L | ug/Kg dw |   |   |   | Organics | Pesticides | | | | |
Fluxapyroxad | Fluxapyroxad | 907204313 |   | ng/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
Foam Ball | Foam Ball | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Miscellaneous | | |
Foliose Algae | Foliose Algae | 0 | pieces |   |   |   |   |   | Debris | Trash | Non-Plastics | Marine Origin | | |
Folpet | Folpet | 133073 |   | ug/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
Fonofos | Fonofos (Dyfonate) | 944229 |   | ug/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | Pesticides | Pest-OPs | Insecticides | | |
Food Service | Food Service | 0 | L |   |   |   |   |   | Debris | Trash | Plastics | | | |
Food Service, Other | Food Service, Other | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | FoodService | | |
Forest Dominant Age Class | Forest Dominant Age Class | 0 | none |   |   |   |   |   | Habitat | | | | | |
Formate(Surrogate) | Surrogate: Formate | 0 |   | % recovery |   |   |   |   | Organics | | | | | |
Furniture | Furniture | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Non-Plastics | Household | Large |
Gage Height | Water surface level measured against a staff gage within a given waterbody | 0 |   | ft |   |   |   |   | Habitat | | | | | |
Galaxolide | Galaxolide | 1222055 |   | ng/L |   |   |   |   | | | | | | |
Galaxolide-d6(Surrogate) | Surrogate: Galaxolide-d6 | 507442491 |   | % recovery |   |   |   |   | Organics | PPCPs | | | | |
Garbage Bag of Trash | Garbage Bag of Trash | 0 | pieces |   |   |   |   |   | Debris | Trash | Non-Plastics | Large | | |
Gasoline | Gasoline | 0 |   | ug/L |   |   |   |   | | | | | | |
Gemfibrozil | Gemfibrozil | 25812300 |   | ug/L |   |   |   |   | Organics | PPCPs | | | | |
Gemfibrozil-d6(IsoDilAnalogue) | Isotope Dilution Analogue: Gemfibrozil-d6 | 1184986455 |   | % recovery |   |   |   |   | Organics | | IDA | | | |
Gemfibrozil-d6(Surrogate) | Surrogate: Gemfibrozil-d6 | 25812300 |   | % recovery |   |   |   |   | Organics | PPCPs | | | | |
Germination | Germination (%) | 0 |   |   |   | % |   |   | Toxicity | | | | | |
Giardia | Giardia | 0 |   | oocysts/L |   |   |   |   | Microbiological | Pathogens | Conventional | | | |
Glass Servicewear | Glass Servicewear | 0 | pieces |   |   |   |   |   | Debris | Trash | Non-Plastics | Household | | |
Glass Shard | Glass Shard | 0 | pieces |   |   |   |   |   | Debris | Trash | Non-Plastics | Household | | |
Glide | Glide | 0 | % |   |   |   |   |   | Habitat | | | | | |
Glide/Pool Bank Stability | Glide/Pool Bank Stability (used for EMAP RBP 20-score habitat characterization) | 0 | none |   |   |   |   |   | Habitat | | | | | |
Glide/Pool Channel Alteration | Glide/Pool Channel Alteration | 0 | none |   |   |   |   |   | Habitat | | | | | |
Glide/Pool Channel Flow Status | Glide/Pool Channel Flow Status | 0 | none |   |   |   |   |   | Habitat | | | | | |
Glide/Pool Channel Sinuosity | Glide/Pool Channel Sinuosity | 0 | none |   |   |   |   |   | Habitat | | | | | |
Glide/Pool Epifaunal Substrate | Glide/Pool Epifaunal Substrate | 0 | none |   |   |   |   |   | Habitat | | | | | |
Glide/Pool Pool Substrate | Glide/Pool Pool Substrate | 0 | none |   |   |   |   |   | Habitat | | | | | |
Glide/Pool Pool Variability | Glide/Pool Pool Variability | 0 | none |   |   |   |   |   | Habitat | | | | | |
Glide/Pool Riparian Zone Width | Glide/Pool Riparian Zone Width | 0 | none |   |   |   |   |   | Habitat | | | | | |
Glide/Pool Sediment Deposition | Glide/Pool Sediment Deposition | 0 | none |   |   |   |   |   | Habitat | | | | | |
Glide/Pool Vegetative Protection | Glide/Pool Vegetative Protection | 0 | none |   |   |   |   |   | Habitat | | | | | |
Glyphosate | Glyphosate | 1071836 |   | ug/L |   |   |   |   | Organics | Pesticides | Herbicides | | | |
Granule | Granule | 0 |   | % | % |   |   |   | Inorganics | Conventionals | GrainSize | | | |
Granule + Pebble | Granule + Pebble | 0 |   |   | % |   |   |   | Inorganics | Conventionals | GrainSize | | | |
Gravel | Gravel | 0 |   |   | % |   |   |   | Inorganics | Conventionals | GrainSize | | | |
Grazing_Recent | Evidence of grazing activiy by cattle within the past year | 0 | none |   |   |   |   |   | Habitat | | | | | |
Gross Alpha | Gross Alpha | 12587461 |   | pCi/L |   |   |   |   | Radiochemistry | | | | | |
Gross Beta | Gross Beta | 12587472 |   | pCi/L |   |   |   |   | Radiochemistry | | | | | |
Growth (ash-free dry wt/surv indiv) | Growth (ash-free dry wt/surv indiv) | 0 |   |   |   |   |   |   | | | | | | |
Growth (Chlorophyll a fluorescence) | Growth (Chlorophyll a fluorescence) | 0 |   |   |   |   |   |   | | | | | | |
Growth (Chlorophyll a) | Growth (Chlorophyll a) | 0 |   |   |   |   |   |   | Organics | | | | | |
Growth (length) | Growth (length) | 0 |   |   |   | mm |   |   | Toxicity | | | | | |
Growth (wt/surv indiv) | Growth (weight/surviving individual) | 0 |   |   |   | mg/ind |   |   | Toxicity | | | | | |
Growth Ratio | Growth Ratio (final measurement / initial measurement) | 0 |   |   |   | Num/Rep |   |   | Toxicity | | | | | |
Gull_Gull2TM | Gull_Gull2TM | 0 |   | copies/100 mL |   |   |   |   | Microbiological | | | | | |
H_AqHab | Shannon diversity of natural instream cover types physical-habitat metric | 0 | none |   |   |   |   |   | Bioassessment | | | | | |
H_SubNat | Shannon diversity of natural substrate types physical-habitat metric | 0 | none |   |   |   |   |   | Bioassessment | | | | | |
HabitatType | HabitatType | 0 | none |   |   |   |   |   | FieldObservations | Habitat | | | | |
Halosulfuron Methyl | Halosulfuron Methyl | 100784201 |   | ug/L |   |   |   |   | Organics | Pesticides | Herbicides | | | |
Hard Plastic Piece, non-specific | Hard Plastic Piece, non-specific | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Bags/Packaging | | |
Hardness as CaCO3 | Hardness as CaCO3 | 0 |   | mg/L |   |   |   |   | Inorganics | Conventionals | WaterQualityMeasurements | | | |
HCH, alpha- | alpha-Hexachlorocyclohexane (HCH) (alpha-BHC) | 319846 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OCHs | Insecticides | Rodenticides | |
HCH, beta- | beta-Hexachlorocyclohexane (HCH) (beta-BHC) | 319857 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OCHs | Insecticides | Rodenticides | |
HCH, beta-(Surrogate) | Surrogate: beta-Hexachlorocyclohexane (HCH) (beta-BHC) | 319857 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | Pesticides | | | | |
HCH, delta- | delta-Hexachlorocyclohexane (HCH) (delta-BHC) | 319868 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OCHs | Insecticides | Rodenticides | |
HCH, delta-(Surrogate) | Surrogate: delta-HCH | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | | | | | |
HCH, gamma- | gamma-Hexachlorocyclohexane (HCH) (gamma-BHC) (Lindane) | 58899 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OCHs | Insecticides | Endocrine Disruptors | Rodenticides |
HCH, gamma-(Surrogate) | Surrogate: gamma-Hexachlorocyclohexane (HCH) (gamma-BHC) (Lindane) | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | Pesticides | Pest-OCHs | Insecticides | Endocrine Disruptors | Rodenticides |
HCH-13C6, alpha-(IsoDilAnalogue) | Isotope Dilution Analogue: alpha-Hexachlorocyclohexane-13C6 (HCH) (alpha-BHC) | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | Pest-OCHs | IDA | | | |
HCH-13C6, beta-(IsoDilAnalogues) | Isotope Dilution Analogue: beta-Hexachlorocyclohexane-13C6 (HCH) (beta-BHC) | 222966689 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | Pest-OCHs | IDA | | | |
HCH-13C6, delta-(IsoDilAnalogue) | Isotope Dilution Analogue: delta-Hexachlorocyclohexane-13C6 (HCH) (delta-BHC) | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | Pest-OCHs | IDA | | | |
HCH-13C6, gamma-(IsoDilAnalogue) | Isotope Dilution Analogue: gamma-Hexachlorocyclohexane-13C6 (HCH) (gamma-BHC) (Lindane) | 104215852 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | Pest-OCHs | IDA | | | |
Heptachlor | Heptachlor | 76448 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OCHs | Insecticides | Endocrine Disruptors | |
Heptachlor Epoxide | Heptachlor Epoxide | 1024573 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OCHs | Insecticides | Endocrine Disruptors | |
Heptachlor Epoxide(Surrogate) | Surrogate: Heptachlor Epoxide | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | | | | | |
Heptachlor Epoxide-13C10(IsoDilAnalogue) | Isotope Dilution Analogue: Heptachlor Epoxide-13C10 | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | Pesticides | IDA | | | |
Heptachlor(Surrogate) | Surrogate: Heptachlor | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | Pesticides | | | | |
Heptachlor-13C10(IsoDilAnalogue) | Isotope Dilution Analogue: Heptachlor-13C10 | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | Pest-OCHs | IDA | | | |
Hexachlorobenzene | Hexachlorobenzene | 118741 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OCHs | Endocrine Disruptors | Fungicides | |
Hexachlorobenzene(Surrogate) | Surrogate: Hexachlorobenzene | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | Pesticides | | | | |
Hexachlorobenzene-13C6(IsoDilAnalogue) | Isotope Dilution Analogue: Hexachlorobenzene-13C6 | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | Pesticides | IDA | | | |
Hexachlorobutadiene | Hexachlorobutadiene | 87683 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | VOCs | SVOCs | Fungicides | | |
Hexachlorocyclopentadiene | Hexachlorocyclopentadiene | 77474 |   | ug/L |   |   |   |   | Organics | SVOCs | | | | |
Hexachloroethane | Hexachloroethane | 67721 |   | ug/L |   |   |   |   | Organics | SVOCs | | | | |
Hexahydro-1,3,5-trinitro-1,3,5-triazine | Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) | 121824 |   | ug/L | ug/kg |   |   |   | Organics | | | | | |
Hexanone, 2- | 2-Hexanone | 591786 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Hexazinone | Hexazinone | 51235042 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Pest-Triazines | Herbicides | | |
HF183TMSIPP | HF183TMSIPP | 0 |   | copies/100 mL |   |   |   |   | Microbiological | | | | | |
Hiking Trails | Hiking Trails | 0 | none |   |   |   |   |   | Habitat | | | | | |
Holmium | Holmium | 7440600 |   | ug/L |   |   |   |   | Inorganics | | | | | |
Homeless Encampment, Distance from Transect | Homeless Encampment, Distance from Transect | 0 | m |   |   |   |   |   | Habitat | Debris | | | | |
Homeless Encampment, Distance from Transect Downstream | Homeless Encampment, Distance from Transect Downstream | 0 | m |   |   |   |   |   | Habitat | Debris | | | | |
Homeless Encampment, Distance from Transect Upstream | Homeless Encampment, Distance from Transect Upstream | 0 | m |   |   |   |   |   | Habitat | Debris | | | | |
Homeless Encampment, Within Transect | Homeless Encampment, Within Transect | 0 | none |   |   |   |   |   | Habitat | Debris | | | | |
Hose Piece | Hose Piece | 0 | pieces |   |   |   |   |   | Debris | Trash | Non-Plastics | Household | | |
Household | Household | 0 | L |   |   |   |   |   | Debris | Trash | Plastics | | | |
Household, Other | Household, Other | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Non-Plastics | Household | |
HpCDD, 1,2,3,4,6,7,8- | 1,2,3,4,6,7,8-Heptachlorodibenzo-p-dioxin (HpCDD) | 35822394 |   | ug/L |   |   |   |   | Organics | PCDDs/PCDFs | Dioxins/Dibenzofurans | | | |
HPCDD, 1,2,3,4,6,7,8- (TEQ ND=0) | 1,2,3,4,6,7,8-HPCDD (TEQ ND=0) | 0 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
HPCDD, 1,2,3,4,6,7,8- (TEQ ND=1/2 DL) | 1,2,3,4,6,7,8-HPCDD (TEQ ND=1/2 DL) | 0 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
HpCDD, 1,2,3,4,6,7,8-(Surrogate) | Surrogate: 1,2,3,4,6,7,8-Heptachlorodibenzo-p-dioxin (HpCDD) | 35822394 |   | % recovery |   |   |   |   | Organics | PCDDs/PCDFs | Dioxins/Dibenzofurans | | | |
HpCDD-13C, 1,2,3,4,6,7,8-(Surrogate) | Surrogate: 1,2,3,4,6,7,8-Heptachlorodibenzo-p-dioxin-13C (HpCDD) | 109719837 |   | % recovery |   |   |   |   | Organics | PCDDs/PCDFs | Dioxins/Dibenzofurans | | | |
HpCDD-13C12, 1,2,3,4,6,7,8-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3,4,6,7,8-HpCDD-13C12 | 109719837 |   | % recovery |   |   |   |   | Organics | Dioxins/Dibenzofurans | IDA | | | |
HpCDF, 1,2,3,4,6,7,8- | 1,2,3,4,6,7,8-Heptachlorodibenzofuran (HpCDF) | 67562394 |   | pg/L |   |   |   |   | Organics | PCDDs/PCDFs | Dioxins/Dibenzofurans | | | |
HPCDF, 1,2,3,4,6,7,8- (TEQ ND=0) | 1,2,3,4,6,7,8-HPCDF (TEQ ND=0) | 0 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
HPCDF, 1,2,3,4,6,7,8- (TEQ ND=1/2 DL) | 1,2,3,4,6,7,8-HPCDF (TEQ ND=1/2 DL) | 0 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
HpCDF, 1,2,3,4,6,7,8-(Surrogate) | Surrogate: 1,2,3,4,6,7,8-Heptachlorodibenzofuran | 0 |   | % recovery |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
HpCDF, 1,2,3,4,7,8,9- | 1,2,3,4,7,8,9-Heptachlorodibenzofuran (HpCDF) | 55673897 |   | pg/L |   |   |   |   | Organics | PCDDs/PCDFs | Dioxins/Dibenzofurans | | | |
HPCDF, 1,2,3,4,7,8,9- (TEQ ND=0) | 1,2,3,4,7,8,9-HPCDF (TEQ ND=0) | 0 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
HPCDF, 1,2,3,4,7,8,9- (TEQ ND=1/2 DL) | 1,2,3,4,7,8,9-HPCDF (TEQ ND=1/2 DL) | 0 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
HpCDF, 1,2,3,4,7,8,9-(Surrogate) | Surrogate: 1,2,3,4,7,8,9-Heptachlorodibenzofuran (HpCDF) | 55673897 |   | % recovery |   |   |   |   | Organics | PCDDs/PCDFs | Dioxins/Dibenzofurans | | | |
HpCDF-13C12, 1,2,3,4,6,7,8-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3,4,6,7,8-HpCDF-13C12 | 109719848 |   | % recovery |   |   |   |   | Organics | Dioxins/Dibenzofurans | IDA | | | |
HpCDF-13C12, 1,2,3,4,7,8,9-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3,4,7,8,9-HpCDF-13C12 | 109719940 |   | % recovery |   |   |   |   | Organics | Dioxins/Dibenzofurans | IDA | | | |
Human Adenovirus | Human Adenovirus | 0 |   | copies/100 mL | copies/g dw |   |   |   | Microbiological | | | | | |
Human Marker (HF183) | Human Marker (HF183) | 0 |   | gc/mL |   |   |   |   | Microbiological | | | | | |
Human Norovirus GI | Human Norovirus GI | 0 |   | copies/100 mL |   |   |   |   | Microbiological | | | | | |
Human Norovirus GII | Human Norovirus GII | 0 |   | copies/100 mL |   |   |   |   | Microbiological | | | | | |
Human Waste/Diaper | Human Waste/Diaper | 0 | pieces |   |   |   |   |   | Debris | Trash | Non-Plastics | Toxic | | |
Human_HF183TMCaMan | Human_HF183TMCaMan | 0 |   | copies/100 mL |   |   |   |   | Microbiological | | | | | |
HumanHealth | HumanHealth using Trash Protocol | 0 | score |   |   |   |   |   | Trash | | | | | |
HxCDD, 1,2,3,4,7,8- | 1,2,3,4,7,8-Hexachlorodibenzo-p-dioxin (HxCDD) | 39227286 |   | ug/L |   |   |   |   | Organics | PCDDs/PCDFs | Dioxins/Dibenzofurans | | | |
HXCDD, 1,2,3,4,7,8- (TEQ ND=0) | 1,2,3,4,7,8-HXCDD (TEQ ND=0) | 0 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
HXCDD, 1,2,3,4,7,8- (TEQ ND=1/2 DL) | 1,2,3,4,7,8-HXCDD (TEQ ND=1/2 DL) | 0 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
HxCDD, 1,2,3,4,7,8-(Surrogate) | Surrogate: 1,2,3,4,7,8-Hexachlorodibenzo-p-dioxin (HxCDD) | 39227286 |   | % recovery |   |   |   |   | Organics | PCDDs/PCDFs | Dioxins/Dibenzofurans | | | |
HxCDD, 1,2,3,6,7,8- | 1,2,3,6,7,8-Hexachlorodibenzo-p-dioxin (HxCDD) | 57653857 |   | ug/L |   |   |   |   | Organics | PCDDs/PCDFs | Dioxins/Dibenzofurans | | | |
HXCDD, 1,2,3,6,7,8- (TEQ ND=0) | 1,2,3,6,7,8-HXCDD (TEQ ND=0) | 0 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
HXCDD, 1,2,3,6,7,8- (TEQ ND=1/2 DL) | 1,2,3,6,7,8-HXCDD (TEQ ND=1/2 DL) | 0 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
HxCDD, 1,2,3,6,7,8-(Surrogate) | Surrogate: 1,2,3,6,7,8-Hexachlorodibenzo-p-dioxin (HxCDD) | 57653857 |   | % recovery |   |   |   |   | Organics | PCDDs/PCDFs | Dioxins/Dibenzofurans | | | |
HxCDD, 1,2,3,7,8,9- | 1,2,3,7,8,9-Hexachlorodibenzo-p-dioxin (HxCDD) | 19408743 |   | ug/L |   |   |   |   | Organics | PCDDs/PCDFs | Dioxins/Dibenzofurans | | | |
HXCDD, 1,2,3,7,8,9- (TEQ ND=0) | 1,2,3,7,8,9-HXCDD (TEQ ND=0) | 0 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
HXCDD, 1,2,3,7,8,9- (TEQ ND=1/2 DL) | 1,2,3,7,8,9-HXCDD (TEQ ND=1/2 DL) | 0 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
HxCDD-13C, 1,2,3,6,7,8-(Surrogate) | Surrogate: 1,2,3,6,7,8-Hexachlorodibenzo-p-dioxin-13C (HxCDD) | 109719815 |   | % recovery |   |   |   |   | Organics | PCDDs/PCDFs | Dioxins/Dibenzofurans | | | |
HxCDD-13C12, 1,2,3,4,7,8-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3,4,7,8-HxCDD-13C12 | 109719804 |   | % recovery |   |   |   |   | Organics | Dioxins/Dibenzofurans | IDA | | | |
HxCDD-13C12, 1,2,3,6,7,8-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3,6,7,8-HxCDD-13C12 | 109719815 |   | % recovery |   |   |   |   | Organics | Dioxins/Dibenzofurans | IDA | | | |
HxCDF, 1,2,3,4,7,8- | 1,2,3,4,7,8-Hexachlorodibenzofuran (HxCDF) | 70648269 |   | pg/L |   |   |   |   | Organics | PCDDs/PCDFs | Dioxins/Dibenzofurans | | | |
HXCDF, 1,2,3,4,7,8- (TEQ ND=0) | 1,2,3,4,7,8-HXCDF (TEQ ND=0) | 0 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
HXCDF, 1,2,3,4,7,8- (TEQ ND=1/2 DL) | 1,2,3,4,7,8-HXCDF (TEQ ND=1/2 DL) | 0 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
HxCDF, 1,2,3,4,7,8-(Surrogate) | Surrogate: 1,2,3,4,7,8-Hexachlorodibenzofuran (HxCDF) | 70648269 |   | % recovery |   |   |   |   | Organics | PCDDs/PCDFs | Dioxins/Dibenzofurans | | | |
HxCDF, 1,2,3,6,7,8- | 1,2,3,6,7,8-Hexachlorodibenzofuran (HxCDF) | 57117449 |   | pg/L |   |   |   |   | Organics | PCDDs/PCDFs | Dioxins/Dibenzofurans | | | |
HXCDF, 1,2,3,6,7,8- (TEQ ND=0) | 1,2,3,6,7,8-HXCDF (TEQ ND=0) | 0 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
HXCDF, 1,2,3,6,7,8- (TEQ ND=1/2 DL) | 1,2,3,6,7,8-HXCDF (TEQ ND=1/2 DL) | 0 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
HxCDF, 1,2,3,6,7,8-(Surrogate) | Surrogate: 1,2,3,6,7,8-Hexachlorodibenzofuran (HxCDF) | 57117449 |   | % recovery |   |   |   |   | Organics | PCDDs/PCDFs | Dioxins/Dibenzofurans | | | |
HxCDF, 1,2,3,7,8,9- | 1,2,3,7,8,9-Hexachlorodibenzofuran (HxCDF) | 72918219 |   | pg/L |   |   |   |   | Organics | PCDDs/PCDFs | Dioxins/Dibenzofurans | | | |
HXCDF, 1,2,3,7,8,9- (TEQ ND=0) | 1,2,3,7,8,9-HXCDF (TEQ ND=0) | 0 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
HXCDF, 1,2,3,7,8,9- (TEQ ND=1/2 DL) | 1,2,3,7,8,9-HXCDF (TEQ ND=1/2 DL) | 0 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
HxCDF, 1,2,3,7,8,9-(Surrogate) | Surrogate: 1,2,3,7,8,9-Hexachlorodibenzofuran (HxCDF) | 72918219 |   | % recovery |   |   |   |   | Organics | PCDDs/PCDFs | Dioxins/Dibenzofurans | | | |
HxCDF, 2,3,4,6,7,8- | 2,3,4,6,7,8-Hexachlorodibenzofuran (HxCDF) | 60851345 |   | pg/L |   |   |   |   | Organics | PCDDs/PCDFs | Dioxins/Dibenzofurans | | | |
HXCDF, 2,3,4,6,7,8- (TEQ ND=0) | 2,3,4,6,7,8-HXCDF (TEQ ND=0) | 0 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
HXCDF, 2,3,4,6,7,8- (TEQ ND=1/2 DL) | 2,3,4,6,7,8-HXCDF (TEQ ND=1/2 DL) | 0 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
HXCDF, 2,3,4,6,7,8-(Surrogate) | Surrogate: 2,3,4,6,7,8-Hexachlorodibenzofuran (HxCDF) | 60851345 |   | % recovery |   |   |   |   | Organics | PCDDs/PCDFs | Dioxins/Dibenzofurans | | | |
HxCDF-13C12, 1,2,3,4,7,8-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3,4,7,8-HxCDF-13C12 | 114423982 |   | % recovery |   |   |   |   | Organics | Dioxins/Dibenzofurans | IDA | | | |
HxCDF-13C12, 1,2,3,6,7,8-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3,6,7,8-HxCDF-13C12 | 116843039 |   | % recovery |   |   |   |   | Organics | Dioxins/DibenzofuransDioxins/Dibenzofurans | IDA | | | |
HxCDF-13C12, 1,2,3,7,8,9-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3,7,8,9-HxCDF-13C12 | 116843040 |   | % recovery |   |   |   |   | Organics | Dioxins/Dibenzofurans | IDA | | | |
HxCDF-13C12, 2,3,4,6,7,8-(IsoDilAnalogue) | Isotope Dilution Analogue: 2,3,4,6,7,8-HxCDF-13C12 | 116843051 |   | % recovery |   |   |   |   | Organics | Dioxins/Dibenzofurans | IDA | | | |
Hydraulic Height | Height from bottom of stream to top of bankfull height or the summation of station water depth and bankfull height | 0 | m |   |   |   |   |   | Habitat | | | | | |
Hydrolyzable Phosphorus + Orthophosphate as P | Hydrolyzable Phosphorus + Orthophosphate as P | 0 |   | mg/L |   |   |   |   | Inorganics | Conventionals | | | | |
Hydroperiod | Hydroperiod of the waterbody | 0 | none |   |   |   |   |   | Habitat | | | | | |
Hydroxide | Hydroxide | 14280309 |   | mg/L |   |   |   |   | Inorganics | Conventionals | | | | |
Hydroxyatrazine, 2- | 2-Hydroxyatrazine | 2163689 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-Triazines | | | |
Hydroxycarbofuran, 3- | 3-Hydroxycarbofuran | 16655826 |   | ug/L | ug/Kg dw |   |   |   | Organics | Pesticides | Pest-Carbamates | | | |
Hydroxy-ibuprofen, 2- | 2-Hydroxy-ibuprofen | 0 |   | ng/L |   |   |   |   | | | | | | |
Hydroxy-Imidacloprid, 5- | 5-Hydroxy-Imidacloprid | 380912094 |   | ug/L |   |   |   |   | | | | | | |
Ibuprofen | Ibuprofen | 15687271 |   | ug/L |   |   |   |   | Organics | PPCPs | | | | |
Ibuprofen-d3(IsoDilAnalogue) | Isotope Dilution Analogue: Ibuprofen-d3 | 121662144 |   | % recovery |   |   |   |   | Organics | | IDA | | | |
Imazalil | Imazalil | 35554440 |   | ug/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
Imazamox | Imazamox | 114311329 |   | ug/L |   |   |   |   | Organics | | | | | |
Imazapyr | Imazapyr | 0 |   | ug/L |   |   |   |   | | | | | | |
Imazaquin | Imazaquin | 81335377 |   | ug/L |   |   |   |   | Organics | Herbicides | | | | |
Imazethapyr | Imazethapyr | 81335775 |   | ug/L |   |   |   |   | Organics | Herbicides | | | | |
Imidacloprid | Imidacloprid | 138261413 |   | ug/L | ng/g dw |   |   |   | Organics | PPCPs | | | | |
Imidacloprid-d4(Surrogate) | Surrogate: Imidacloprid-d4 | 0 |   | % recovery |   |   |   |   | Organics | Pesticides | Insecticides | | | |
Incised Height | Incised Height | 0 | m |   |   |   |   |   | Habitat | | | | | |
Increment | Increment | 0 | m |   |   |   |   |   | Habitat | | | | | |
Indeno(1,2,3-c,d)pyrene | Indeno(1,2,3-c,d)pyrene | 193395 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | HMW_PAH | Endocrine Disruptors` | |
Indeno(1,2,3-c,d)pyrene-d12(IsoDilAnalogue) | Isotope Dilution Analogue: Indeno(1,2,3-c,d)pyrene-d12 | 203578330 |   | % recovery |   |   |   |   | Organics | PAHs | IDA | | | |
Indeno(1,2,3-c,d)pyrene-d12(Surrogate) | Surrogate: Indeno(1,2,3-c,d)pyrene-d12 | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PAH | | | | |
Indoxacarb | Indoxacarb | 173584446 |   | ug/L |   |   |   |   | Organics | Pesticides | Ozadiazine | | | |
Industrial Plants | Industrial Plants | 0 | none |   |   |   |   |   | Habitat | | | | | |
Instream Plant Cover | Instream Plant Cover | 0 | none |   |   |   |   |   | Habitat | | | | | |
IntertidalSubstrateCharacteristics_Mud | IntertidalSubstrateCharacteristics_Mud | 0 | none |   |   |   |   |   | Habitat | Debris | | | | |
IntertidalSubstrateCharacteristics_Rocky | IntertidalSubstrateCharacteristics_Rocky | 0 | none |   |   |   |   |   | Habitat | Debris | | | | |
IntertidalSubstrateCharacteristics_Sand | IntertidalSubstrateCharacteristics_Sand | 0 | none |   |   |   |   |   | Habitat | Debris | | | | |
IntertidalSubstrateCharacteristics_Vegetated | IntertidalSubstrateCharacteristics_Vegetated | 0 | none |   |   |   |   |   | Habitat | Debris | | | | |
Iopromide | Ioprmide | 0 |   | ng/L |   |   |   |   | | | | | | |
Iopromide-d3(IsoDilAnalogue) | Isotope Dilution Analogue: Iopromide-d3 | 1189947736 |   | % recovery |   |   |   |   | Organics | | | | | |
Ipconazole | Ipconazole | 125225287 |   | ng/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
IPI | Score for the Index of Physical-habitat Integrity (IPI) | 0 | score |   |   |   |   |   | Bioassessment | | | | | |
IPI_Ev_FlowHab_qa | Quality assurance metric for the evenness of flow habitat types physical-habitat metric, calculated as the percent of expected measurements present in the input data | 0 | count |   |   |   |   |   | Bioassessment | | | | | |
IPI_Ev_FlowHab_score | Scored evenness of flow habitat types physical-habitat metric | 0 | score |   |   |   |   |   | Bioassessment | | | | | |
IPI_H_AqHab_pred | Predicted Shannon diversity of natural instream cover types physical-habitat metric | 0 | none |   |   |   |   |   | Bioassessment | | | | | |
IPI_H_AqHab_qa | Quality assurance metric for the Shannon diversity of natural instream cover types physical-habitat metric, calculated as the percent of expected measurements present in the input data | 0 | count |   |   |   |   |   | Bioassessment | | | | | |
IPI_H_AqHab_score | Scored Shannon diversity of natural instream cover types physical-habitat metric | 0 | score |   |   |   |   |   | Bioassessment | | | | | |
IPI_H_SubNat_qa | Quality assurance metric for the Shannon diversity of natural substrate types physical-habitat metric, calculated as the percent of expected measurements present in the input data | 0 | count |   |   |   |   |   | Bioassessment | | | | | |
IPI_H_SubNat_score | Scored Shannon diversity of natural substrate types physical-habitat metric | 0 | score |   |   |   |   |   | Bioassessment | | | | | |
IPI_IPI_qa | Quality assurance metric for the Index of Physical-habitat Integrity score, calculated as the minimum of other quality assurance metric values | 0 | count |   |   |   |   |   | Bioassessment | | | | | |
IPI_PCT_SAFN_pred | Predicted percent sands and fines streambed substrate physical-habitat metric | 0 | % |   |   |   |   |   | Bioassessment | | | | | |
IPI_PCT_SAFN_qa | Quality assurance metric for the percent sands and fines physical-habitat metric, calculated as the percent of expected measurements present in the input data | 0 | count |   |   |   |   |   | Bioassessment | | | | | |
IPI_PCT_SAFN_score | Scored percent sands and fines streambed substrate physical-habitat metric | 0 | score |   |   |   |   |   | Bioassessment | | | | | |
IPI_XCMG_pred | Predicted riparian cover as sum of three layers physical-habitat metric | 0 | % |   |   |   |   |   | Bioassessment | | | | | |
IPI_XCMG_qa | Quality assurance metric for the riparian cover metric, calculated as the percent of expected measurements present in the input data | 0 | count |   |   |   |   |   | Bioassessment | | | | | |
IPI_XCMG_score | Scored riparian cover as sum of three layers physical-habitat metric | 0 | score |   |   |   |   |   | Bioassessment | | | | | |
Iprodione | Iprodione | 36734197 |   | ug/L |   |   |   |   | Organics | Fungicides | | | | |
Iron | Iron | 7439896 |   | ug/L | ug/g dw |   | ug/g ww | ug/g dw | Inorganics | Conventionals | Metals | | | |
Irrigation Equipment | Irrigation Equipment | 0 | none |   |   |   |   |   | Habitat | | | | | |
Isofenphos | Isofenphos | 25311711 |   | ug/L |   |   |   |   | Organics | Pesticides | | | | |
Isophorone | Isophorone | 78591 |   | ug/L | mg/Kg dw |   |   |   | Organics | SVOCs | | | | |
Isopropylbenzene | Isopropylbenzene (Cumene) | 98828 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Isopropyltoluene, p- | p-Isopropyltoluene | 99876 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Isoxaben | Isoxaben (Flexidor) (Gallery) | 82558507 |   | ug/L |   |   |   |   | Organics | | | | | |
Isoxaben(Surrogate) | Surrogate: Isoxaben (Flexidor) (Gallery) | 82558507 |   | % recovery |   |   |   |   | Organics | Herbicides | | | | |
Jasmolin-1 | Jasmolin-1 (Jasmolin I) | 4466142 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Pest-Pyrethroids | | | |
Jasmolin-2 | Jasmolin-2 (Jasmolin II) | 1172630 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Pest-Pyrethroids | | | |
Kelp holdfast | Kelp holdfast | 0 | pieces |   |   |   |   |   | Debris | Natural | Non-Plastics | Marine Origin | | |
Kelp Stipe/Blade | Kelp Stipe/Blade | 0 | pieces |   |   |   |   |   | Debris | Natural | Non-Plastics | Marine Origin | | |
Kepone | Kepone (Chlordecone) | 143500 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Pest-OCHs | | | |
Ketocarbofuran, 3- | 3-Ketocarbofuran | 16709301 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-Carbamates | | | |
Keyboard | Keyboard | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Toxic | | |
Kresoxim-methyl | Kresoxim-methyl | 143390890 |   | ng/L |   |   |   |   | Organics | Fungicides | | | | |
Large/Unmovable, Other | Large/Unmovable, Other | 0 | pieces |   |   |   |   |   | Debris | Trash | Non-Plastics | Large | | |
Lead | Lead | 7439921 |   | ug/L | umol/g |   | ug/g ww | ug/g dw | Inorganics | TraceElements | Metals | | | |
Length | Length | 0 | m |   |   |   |   |   | Tissue | Habitat | | | | |
Length Downstream | Length Downstream from X location | 0 | m |   |   |   |   |   | Habitat | | | | | |
Length Pool | Length Pool | 0 | m |   |   |   |   |   | Habitat | | | | | |
Length Reach | Length Reach | 0 | m |   |   |   |   |   | Habitat | | | | | |
Length Riffle | Length Riffle | 0 | m |   |   |   |   |   | Habitat | | | | | |
Length Upstream | Length Upstream from X location | 0 | m |   |   |   |   |   | Habitat | | | | | |
Length, Segment | Segment Length | 0 | m |   |   |   |   |   | Habitat | | | | | |
Leptophos | Leptophos | 21609905 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-OPs | Insecticides | | |
Level Of Trash | Level Of Trash using Trash Protocol | 0 | score |   |   |   |   |   | Trash | | | | | |
Lid | Lid | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | FoodService | | |
Lighter | Lighter | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Toxic | | |
Liming | Liming | 0 | none |   |   |   |   |   | Habitat | | | | | |
Lincomycin | Lincomycin | 154212 |   | ug/L |   |   | ng/g ww | ng/g dw | Organics | PPCPs | | | | |
Linuron | Linuron | 330552 |   | ug/L |   |   |   |   | Organics | Pesticides | Herbicides | | | |
Linuron-d6(Surrogate) | Surrogate: Linuron-d6 | 1219804768 |   | % recovery |   |   |   |   | Organics | Pesticides | Herbicides | | | |
Lipid | Lipid | 0 |   | % recovery |   |   | % ww | % dw | Organics | Inorganics | Conventional | | | |
Lithium | Lithium | 7439932 |   | ug/L |   |   |   |   | Inorganics | | | | | |
Littering | Littering using Trash Protocol | 0 | score |   |   |   |   |   | Trash | | | | | |
Livestock Use | Livestock Use | 0 | none |   |   |   |   |   | Habitat | | | | | |
Logging | Logging | 0 | none |   |   |   |   |   | Habitat | | | | | |
Lomefloxacin | Lomefloxacin | 0 |   |   |   |   | ng/g ww | ng/g dw | Organics | | | | | |
Loss On Ignition | Loss On Ignition | 0 |   |   | % |   |   |   | Inorganics | | | | | |
LWD >0.8 DLE, Length >15m | LWD >0.8 DLE, Length >15m | 0 | count |   |   |   |   |   | Habitat | | | | | |
LWD >0.8m DLE, Length 1.5-5m | LWD >0.8m DLE, Length 1.5-5m | 0 | count |   |   |   |   |   | Habitat | | | | | |
LWD >0.8m DLE, Length 5-15m | LWD >0.8m DLE, Length 5-15m | 0 | count |   |   |   |   |   | Habitat | | | | | |
LWD 0.1-<0.3m DLE, Length >15m | LWD 0.1-<0.3m DLE, Length >15m | 0 | count |   |   |   |   |   | Habitat | | | | | |
LWD 0.1-<0.3m DLE, Length 1.5-5m | LWD 0.1-<0.3m DLE, Length 1.5-5m | 0 | count |   |   |   |   |   | Habitat | | | | | |
LWD 0.1-<0.3m DLE, Length 5-15m | LWD 0.1-<0.3m DLE, Length 5-15m | 0 | count |   |   |   |   |   | Habitat | | | | | |
LWD 0.3-<0.6m DLE, Length >15 | LWD 0.3-<0.6m DLE, Length >15 | 0 | count |   |   |   |   |   | Habitat | | | | | |
LWD 0.3-<0.6m DLE, Length 1.5-5m | LWD 0.3-<0.6m DLE, Length 1.5-5m | 0 | count |   |   |   |   |   | Habitat | | | | | |
LWD 0.3-<0.6m DLE, Length 5-15m | LWD 0.3-<0.6m DLE, Length 5-15m | 0 | count |   |   |   |   |   | Habitat | | | | | |
LWD 0.6-<0.8m DLE, Length >15m | LWD 0.6-<0.8m DLE, Length >15m | 0 | count |   |   |   |   |   | Habitat | | | | | |
LWD 0.6-<0.8m DLE, Length 1.5-5m | LWD 0.6-<0.8m DLE, Length 1.5-5m | 0 | count |   |   |   |   |   | Habitat | | | | | |
LWD 0.6-<0.8m DLE, Length 5-15 | LWD 0.6-<0.8m DLE, Length 5-15 | 0 | count |   |   |   |   |   | Habitat | | | | | |
LWD A | Large Woody Debris in the A class of corresponding Diameter and Length categories | 0 | count |   |   |   |   |   | Habitat | | | | | |
LWD L | Large Woody Debris in the L class of corresponding Diameter and Length categories | 0 | count |   |   |   |   |   | Habitat | | | | | |
LWD M | Large Woody Debris in the M class of corresponding Diameter and Length categories | 0 | count |   |   |   |   |   | Habitat | | | | | |
LWD S | Large Woody Debris in the S class of corresponding Diameter and Length categories | 0 | count |   |   |   |   |   | Habitat | | | | | |
LWD T | Large Woody Debris in the T class of corresponding Diameter and Length categories | 0 | count |   |   |   |   |   | Habitat | | | | | |
Lyngbyatoxin-a | Lyngbyatoxin-a | 0 |   | ug/L |   |   |   |   | Microbiological | Cyanotoxins | | | | |
Macroalgae Cover, Attached | Presence/Absence of attached macroalgae at a point along a transect | 0 | none |   |   |   |   |   | Habitat | | | | | |
Macroalgae Cover, Unattached | Presence/Absence of unattached macroalgae at a point along a transect | 0 | none |   |   |   |   |   | Habitat | | | | | |
Macroinvertebrate Habitat Patch Richness Metric | Metric assesses macroinvertebrate habitat patch richness along the channel edge and bank within the assessment area. | 0 | score |   |   |   |   |   | Habitat | | | | | |
Macrophyte Cover | Presence/Absence of macrophytes at a point along a transect | 0 | none |   |   |   |   |   | Habitat | | | | | |
Magnesium | Magnesium | 7439954 |   | ug/L |   |   |   |   | Inorganics | Conventionals | Metals | AlkalineEarthMetals | | |
Maintained Lawns | Maintained Lawns | 0 | none |   |   |   |   |   | Habitat | | | | | |
Malaoxon | Malaoxon | 1634782 |   | ng/L |   |   |   |   | Organics | Pesticides | | | | |
Malathion | Malathion | 121755 |   | ug/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | Pesticides | Pest-OPs | Insecticides | Endocrine Disruptors | |
Mandipropamid | Mandipropamid | 374726622 |   | ng/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
Manganese | Manganese | 7439965 |   | ug/L | mg/Kg nr |   | ug/g ww | ug/g dw | Inorganics | TraceElements | Metals | Conventionals | | |
Marine, Other | Marine, Other | 0 | pieces |   |   |   |   |   | Debris | Natural | Non-Plastics | Marine Origin | | |
MBAS | MBAS (Methylene Blue Active Substances) | 0 |   | ug/L |   |   |   |   | Inorganics | Surfactants | | | | |
MCPA | MCPA (2-Methyl-4-chlorophenoxy)Acetic Acid) (2,4-MCPA) | 94746 |   | ug/L |   |   |   |   | Organics | Herbicides | | | | |
MCPP | MCPP (2-(2-Methyl-4-chlorophenoxy) Propionic Acid) | 93652 |   | ug/L |   |   |   |   | Organics | Herbicides | | | | |
Mean Percent Normal Alive | The observed number of normal larvae divided by the mean number of live embryos inoculated at the beginning of the test | 0 |   |   |   | % |   |   | Toxicity | Endpoint | | | | |
Mechanical Pencil | Mechanical Pencil | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Household | | |
Medical Device | Medical Device | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Toxic | | |
Meprobamate | Meprobamate | 57534 |   | ng/L |   |   |   |   | Organics | PPCPs | | | | |
Mercury | Mercury | 7439976 |   | ug/L | ug/Kg dw |   | ug/g ww | ug/g dw | Inorganics | TraceElements | Metals | | | |
Mercury, Methyl | Methyl Mercury | 22967926 |   | ug/L |   |   | ug/g ww | ug/g dw | Inorganics | TraceElements | Metals | | | |
Merphos | Merphos (Tributylphosphorotrithioite) | 150505 |   | ug/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | Pesticides | Pest-OPs | | | |
Metal Object | Metal Object | 0 | pieces |   |   |   |   |   | Debris | Trash | Non-Plastics | Metal | | |
Metal Pipe/Bar | Metal Pipe/Bar | 0 | pieces |   |   |   |   |   | Debris | Trash | Non-Plastics | Metal | | |
Metal, Other | Metal, Other | 0 | pieces |   |   |   |   |   | Debris | Trash | Non-Plastics | Metal | | |
Metalaxyl | Metalaxyl | 57837191 |   | ug/L |   |   |   |   | Organics | Herbicides | | | | |
Metconazole | Metconazole | 125116236 |   | ug/L |   |   |   |   | Organics | Fungicides | | | | |
MeterAveragingInterval | Time period (seconds) upon which the meter reading is averaged internally to attain a result | 0 |   | seconds |   |   |   |   | WaterQualityMeasurements | | | | | |
Methadone | Methadone | 76993 |   | ng/L |   |   |   |   | | | | | | |
Methamidophos | Methamidophos (O,S-Dimethyl thiophosphate) | 10265926 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Pest-OPs | Insecticides | | |
Methidathion | Methidathion | 950378 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Pest-OPs | Insecticides | | |
Methiocarb | Methiocarb | 2032657 |   | ug/L | ug/Kg dw |   |   |   | Organics | Pesticides | Pest-Carbamates | Insecticides | | |
Methomyl | Methomyl | 16752775 |   | ug/L | ug/Kg dw |   |   |   | Organics | Pesticides | Pest-OPs | Insecticides | | |
Methoprene | Methoprene | 40596698 |   | ng/L |   |   |   |   | Organics | Pesticides | | | | |
Methoxychlor | Methoxychlor | 72435 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OCHs | Insecticides | Endocrine Disruptors | |
Methoxychlor(Surrogate) | Surrogate: Methoxychlor | 0 |   |   | % recovery |   |   |   | Organics | | | | | |
Methoxychlor-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Methoxychlor-13C12 | 0 |   |   | % recovery |   |   |   | Organics | Pesticides | IDA | | | |
Methoxyfenozide | Methoxyfenozide | 161050584 |   | ng/L |   |   |   |   | Organics | Pesticides | Insecticides | | | |
Methyl 3-Amino-2,5-dichlorobenzoate | Methyl 3-Amino-2,5-dichlorobenzoate (Chloramben Methyl) | 7286842 |   | ug/L |   |   |   |   | Organics | Herbicides | | | | |
Methyl Perfluorooctane Sulfonamido Acetic Acid, N- | N-Methyl Perfluorooctane Sulfonamido Acetic Acid (Me-PFOSA-AcOH) | 0 |   | ng/L | ng/g dw |   | ng/g ww | ng/g dw | | | | | | |
Methyl Perfluorooctane Sulfonamido Acetic Acid-d3, N-(IsoDilAnalogue) | Isotope Dilution Analogue: N-Methyl Perfluorooctane Sulfonamido Acetic Acid-d3 (N-MeFOSAA) | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | | IDA | | | |
Methyl Perfluorooctane Sulfonamido Acetic Acid-d3, N-(Surrogate) | Surrogate: N-Methyl Perfluorooctane Sulfonamido Acetic Acid-d3 | 0 |   |   |   |   | % recovery | % recovery | Organics | PFAS | PFC Precursor | | | |
Methyl Tert-butyl Ether | Methyl Tert-butyl Ether (MTBE) | 1634044 |   | ug/L |   |   |   |   | Organics | VOCs | MTBE_BTEX | | | |
Methyl-2-pentanone, 4- | 4-Methyl-2-pentanone (Methyl Isobutyl Ketone) | 108101 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Methylanthracene | Methylanthracene | 0 |   | ng/L |   |   |   |   | Organics | PAHs | | | | |
Methylanthracene, 2- | 2-Methylanthracene | 613127 |   |   |   |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | Semi-VOAs | | | |
Methylbenzo(a)pyrene, 7- | 7-Methylbenzo(a)pyrene | 63041770 |   | ng/L |   |   |   |   | Organics | PAHs | | | | |
Methylchlolanthrene, 3- | Methylchlolanthrene, 3- | 0 |   | ng/L |   |   |   |   | Organics | PAHs | | | | |
Methylchrysene, 1- | 1-Methylchrysene | 3351288 |   | ng/L |   |   |   |   | Organics | PAHs | | | | |
Methylchrysene, 5/6- | 5-Methylchrysene/6-Methylchrysene | 0 |   | ng/L |   |   |   |   | Organics | PAHs | | | | |
Methyldibenzothiophene, 2- | 2-Methyldibenzothiophene | 20928023 |   | ng/L |   |   |   |   | Organics | PAHs | | | | |
Methyldibenzothiophene, 4- | 4-Methyldibenzothiophene | 7372885 |   | ug/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | PAHs | SVOCs | | | |
Methyldibenzothiophenes, 2/3- | 2-Methyldibenzothiophene/3-Methyldibenzothiophene | 0 |   | ng/L |   |   |   |   | Organics | PAHs | | | | |
Methylene Chloride | Methylene Chloride (Dichloromethane) | 75092 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Methylfluoranthene, 2- | 2-Methylfluoranthene | 33543316 |   | ug/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | PAHs | SVOCs | HMW_PAH | | |
Methylfluoranthene, 3- | 3-Methylfluoranthene | 2523399 |   | ng/L |   |   |   |   | Organics | PAHs | | | | |
Methylfluoranthene, 3-/Benzo(a)fluorene | 3-Methylfluoranthene/Benzo(a)fluorene | 0 |   | ng/L |   |   |   |   | Organics | PAHs | | | | |
Methylfluorene, 1- | 1-Methylfluorene | 1730376 |   | ug/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | PAHs | SVOCs | | | |
Methylfluorene, 2- | 2-Methylfluorene | 1430973 |   | ng/L |   |   |   |   | Organics | PAHs | | | | |
Methylnaphthalene, 1- | 1-Methylnaphthalene | 90120 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | LMW_PAH | | |
Methylnaphthalene, 2- | 2-Methylnaphthalene | 91576 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | LMW_PAH | | |
Methylnaphthalene-d10, 2-(IsoDilAnalogue) | Isotope Dilution Analogue: 2-Methylnaphthalene-d10 | 7297452 |   | % recovery |   |   |   |   | Organics | PAHs | IDA | | | |
Methylnaphthalene-d10, 2-(Surrogate) | Surrogate: 2-Methylnaphthalene-d10 | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PAH | | | | |
Methyl-perfluorooctanesulfonamide, N- | N-Methyl-perfluorooctanesulfonamide | 0 |   | ng/L | ng/g dw |   | ng/g ww | ng/g dw | | | | | | |
Methyl-perfluorooctanesulfonamide-d3, N-(IsoDilAnalogue) | Isotope Dilution Analogue: N-Methyl-perfluorooctanesulfonamide-d3 (N-MeFOSA) | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PFAs | IDA | | | |
Methyl-perfluorooctanesulfonamide-d3, N-(Surrogate) | Surrogate: Methyl-perfluorooctanesulfonamide-d3, N- (N-MeFOSA) | 0 |   |   |   |   | % recovery | % recovery | Organics | PFAS | | | | |
Methyl-perfluorooctanesulfonamidoethanol, N- | N-Methyl-perfluorooctanesulfonamidoethanol | 0 |   | ng/L | ng/g dw |   | ng/g ww | ng/g dw | | | | | | |
Methyl-perfluorooctanesulfonamidoethanol-d7, N-(IsoDilAnalogue) | Isotope Dilution Analogue: N-Methyl-perfluorooctanesulfonamidoethanol-d7 (N-MeFOSE) | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PFAs | IDA | | | |
Methyl-perfluorooctanesulfonamidoethanol-d7, N-(Surrogate) | Surrogate: N-Methyl-perfluorooctanesulfonamidoethanol-d7 | 0 |   |   |   |   | % recovery | % recovery | Organics | PFAS | | | | |
Methylphenanthrene | Methylphenanthrene | 0 |   | ng/L |   |   |   |   | Organics | | | | | |
Methylphenanthrene, 1- | 1-Methylphenanthrene | 832699 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | LMW_PAH | | |
Methylphenanthrene, 2- | 2-Methylphenanthrene | 2531842 |   |   |   |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | LMW_PAH | | |
Methylphenanthrene, 3- | 3-Methylphenanthrene | 832713 |   |   |   |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | LMW_PAH | | |
Methylphenanthrene, 3/4- | 3/4-Methylphenanthrene | 0 |   |   |   |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | | | | |
Methylphenanthrene, 9/4- | 9/4-Methylphenanthrene | 0 |   | ng/L |   |   |   |   | Organics | PAHs | | | | |
Methylphenol, 2- | 2-Methylphenol | 95487 |   | ug/L | mg/Kg dw |   |   |   | Organics | SVOCs | Phenols | non-Chlorinated Phenols | | |
Methylphenol, 3- | 3-Methylphenol | 0 |   | ug/L |   |   |   |   | Organics | SVOCs | | | | |
Methylphenol, 3/4- | 3-Methylphenol/4-Methylphenol | 106445 |   | ug/L | mg/Kg dw |   |   |   | Organics | SVOCs | Phenols | non-Chlorinated Phenols | | |
Methylphenol, 4- | 4-Methylphenol | 0 |   | ug/L |   |   |   |   | Organics | SVOCs | | | | |
Metolachlor | Metolachlor | 51218452 |   | ug/L | ng/g dw |   |   |   | Organics | Herbicides | | | | |
Metolachlor, S- | S-Metolachlor | 87392129 |   | ug/L |   |   |   |   | Organics | Pesticides | | | | |
Metribuzin | Metribuzin | 21087649 |   | ug/L |   |   |   |   | Organics | Herbicides | | | | |
Metsulfuron Methyl | Metsulfuron Methyl | 74223646 |   | ug/L |   |   |   |   | Organics | Herbicides | | | | |
Mevinphos | Mevinphos (Phosdrin) | 7786347 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Pest-OPs | Insecticides | | |
Mexacarbate | Mexacarbate | 315184 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-Carbamates | Insecticides | | |
Miconazole | Miconazole | 0 |   |   |   |   | ng/g ww | ng/g dw | Organics | | | | | |
Microalgae Thickness | Thickness of microalgae (if present) at a point along a transect | 0 | none |   |   |   |   |   | Habitat | | | | | |
Microcystin-LA | Microcystin-LA (MCY-LA) | 96180799 |   | ug/L |   |   | ng/g ww | ng/g dw | Microbiological | Cyanotoxins | | | | |
Microcystin-LF | Microcystin-LF (MCY-LF) | 154037704 |   | ug/L |   |   | ng/g ww | ng/g dw | Microbiological | Cyanotoxins | | | | |
Microcystin-LR | Microcystin-LR (MCY-LR) | 101043372 |   | ug/L |   |   | ng/g ww | ng/g dw | Microbiological | Cyanotoxins | | | | |
Microcystin-LW | Microcystin-LW (MCY-LW) | 157622021 |   | ug/L |   |   | ng/g ww | ng/g dw | Microbiological | Cyanotoxins | | | | |
Microcystin-LY | Microcystin-LY (MCY-LY) | 123304109 |   | ug/L |   |   | ng/g ww | ng/g dw | Microbiological | Cyanotoxins | | | | |
Microcystin-RR | Microcystin-RR (MCY-RR) | 111755374 |   | ug/L |   |   | ng/g ww | ng/g dw | Microbiological | Cyanotoxins | | | | |
Microcystins, Total | Total Microcystins | 0 |   | ug/L |   |   |   |   | Microbiological | Cyanotoxins | | | | |
Microcystin-YR | Microcystin-YR (MCY-YR) | 101064486 |   | ug/L |   |   | ng/g ww | ng/g dw | Microbiological | Cyanotoxins | | | | |
Milk Carton | Milk Carton | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | FoodService | | |
Mines, Quaries | Mines, Quaries | 0 | none |   |   |   |   |   | Habitat | | | | | |
Mirex | Mirex | 2385855 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OCHs | Insecticides | Endocrine Disruptors | |
Mirex(Surrogate) | Surrogate: Mirex | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | | | | | |
Mirex-13C10(IsoDilAnalogue) | Isotope Dilution Analogue: Mirex-13C10 | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | Pesticides | IDA | | | |
Miscellaneous | Miscellaneous using Trash Protocol | 0 | L |   |   |   |   |   | Trash | | | | | |
Miscellaneous, Other | Miscellaneous, Other | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Miscellaneous | | |
Moisture | Moisture | 0 |   | % recovery | % ww |   | % ww | % dw | Organics | Inorganics | Conventional | | | |
Molinate | Molinate (Ordram) | 2212671 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Pest-OPs | | | |
Molybdenum | Molybdenum | 7459987 |   | ug/L | mg/Kg nr |   |   |   | Inorganics | Metals | | | | |
Molybdenum, Acid Labile | Acid Labile Molybdenum | 0 |   | mg/L |   |   |   |   | Inorganics | Metals | | | | |
Monobutyltin as Sn | Monobutyltin as Sn (MBT) | 78763549 |   |   | ug/Kg dw |   |   |   | Organics | Organotins | Biocide | | | |
Monocrotophos | Monocrotophos | 6923224 |   | ug/L |   |   |   |   | Organics | Pesticides | Insecticides | Organophosphorous | | |
Monuron | Monuron | 150685 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-Carbamates | Herbicides | | |
Monuron(Surrogate) | Surrogate: Monuron | 150685 |   | % recovery |   |   |   |   | Organics | | | | | |
Mortality/Normality | Mortality/Normality (%) | 0 |   |   |   | % |   |   | Toxicity | | | | | |
Motor Oil | Motor Oil | 0 |   | ug/L |   |   |   |   | Organics | | | | | |
Myclobutanil | Myclobutanil | 88671890 |   | ug/L |   |   |   |   | Organics | Fungicides | | | | |
Nail/Screw/Bolt | Nail/Screw/Bolt | 0 | pieces |   |   |   |   |   | Debris | Trash | Non-Plastics | Metal | | |
Naled | Naled (Dibrom) | 300765 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Pest-OPs | Insecticides | Rodenticides | |
Naphthalene | Naphthalene | 91203 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | LMW_PAH | VOCs | |
Naphthalene-d8(IsoDilAnalogue) | Isotope Dilution Analogue: Naphthalene-d8 | 1146652 |   | % recovery |   |   |   |   | Organics | PAHs | IDA | | | |
Naphthalene-d8(Surrogate) | Surrogate: Naphthalene-d8 | 1146652 |   | % recovery | % recovery |   | ng/g ww | ng/g dw | Organics | PAHs | SVOCs | Insecticides | | |
Naphthalenes, C1- | C1-Naphthalenes | 0 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | LMW_PAH | | |
Naphthalenes, C2- | C2-Naphthalenes | 0 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | LMW_PAH | | |
Naphthalenes, C3- | C3-Naphthalenes | 0 |   | uS/cm | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | LMW_PAH | | |
Naphthalenes, C4- | C4-Naphthalenes | 0 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | LMW_PAH | | |
Naphthobenzothiophene | Naphthobenzothiophene | 0 |   | ng/L |   |   |   |   | Organics | PAHs | | | | |
Naphthobenzothiophene, C1- | C1-Naphthobenzothiophene | 0 |   | ng/L |   |   |   |   | Organics | PAHs | | | | |
Naphthobenzothiophene, C2- | C2-Naphthobenzothiophene | 0 |   | ng/L |   |   |   |   | Organics | PAHs | | | | |
Naphthobenzothiophene, C3- | C3-Naphthobenzothiophene | 0 |   | ng/L |   |   |   |   | Organics | PAHs | | | | |
Napropamide | Napropamide | 15299997 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Herbicides | | | |
Naproxen | Naproxen | 0 |   | ng/L |   |   |   |   | | | | | | |
Naproxen-d3(IsoDilAnalogue) | Isotope Dilution Analogue: Naproxen-d3 | 958293771 |   | % recovery |   |   |   |   | Organics | | IDA | | | |
Natural, cotton/wool | Natural, cotton/wool | 0 | pieces |   |   |   |   |   | Debris | Trash | Non-Plastics | Biodegradable | | |
Neburon | Neburon | 555373 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-Carbamates | Herbicides | | |
Neodymium | Neodymium | 7440008 |   | ug/L |   |   |   |   | Inorganics | | | | | |
Nickel | Nickel | 7440020 |   | ug/L | umol/g |   | ug/g ww | ug/g dw | Inorganics | TraceElements | Metals | | | |
Nicosulfuron | Nicosulfuron | 111991094 |   | ug/L |   |   |   |   | Organics | Herbicides | | | | |
NID as CTAS | 4-Nitro-Inden-1-One (NID) as Cobalt Thiocyanate Active Substances (CTAS) | 0 |   | mg/L |   |   |   |   | | | | | | |
Nitrate + Nitrite as N | Nitrate + Nitrite as N | 0 |   | ug/L |   |   |   |   | Inorganics | Conventionals | Nutrients | | | |
Nitrate as N | Nitrate as N | 14797558 |   | ug/L | mg/Kg nr |   |   |   | Inorganics | Conventionals | Nutrients | WaterQualityMeasurements | | |
Nitrite as N | Nitrite as N | 14797650 |   | ug/L | mg/Kg dw |   |   |   | Inorganics | Conventionals | Nutrients | | | |
Nitroaniline, 2- | 2-Nitroaniline | 88744 |   | ug/L |   |   |   |   | Organics | SVOCs | | | | |
Nitroaniline, 3- | 3-Nitroaniline | 99092 |   | ug/L |   |   |   |   | Organics | SVOCs | | | | |
Nitroaniline, 4- | 4-Nitroaniline | 100016 |   | ug/L |   |   |   |   | Organics | SVOCs | | | | |
Nitrobenzene | Nitrobenzene | 98953 |   | ug/L | ug/kg |   |   |   | Organics | VOCs | | | | |
Nitrobenzene-d5(Surrogate) | Surrogate: Nitrobenzene-d5 | 4165600 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | SVOCs | | | | |
Nitrogen Oxide | Nitrogen Oxide | 10102439 |   | mg/L |   |   |   |   | Inorganics | Conventional | | | | |
Nitrogen, Inorganic | Inorganic Nitrogen as N | 0 |   | mg/L |   |   |   |   | Inorganics | | | | | |
Nitrogen, Organic | Organic Nitrogen as N | 10102400 |   | mg/L | mg/Kg nr |   |   |   | Inorganics | Conventional | | | | |
Nitrogen, Total | Total Nitrogen | 0 |   | ug/L | % dw |   |   |   | Inorganics | Conventionals | Nutrients | WaterQualityMeasurements | | |
Nitrogen, Total Kjeldahl | Total Kjeldahl Nitrogen (TKN) | 7727379 |   | ug/L | mg/Kg dw |   |   |   | Inorganics | Conventionals | Nutrients | | | |
Nitrogen-15/Nitrogen-14 Ratio | Nitrogen-15/Nitrogen-14 Ratio (Delta 15N nitrate isotope) | 0 |   | per mil |   |   |   |   | | | | | | |
Nitrophenol, 2- | 2-Nitrophenol | 88755 |   | ug/L | mg/Kg dw |   |   |   | Organics | SVOCs | Phenols | non-Chlorinated Phenols | Nitrophenols | |
Nitrophenol, 4- | 4-Nitrophenol | 100027 |   | ug/L | mg/Kg dw |   |   |   | Organics | SVOCs | Phenols | non-Chlorinated Phenols | Nitrophenols | |
Nitrosodimethylamine, N- | N-Nitrosodimethylamine | 0 |   | ug/L |   |   |   |   | Organics | SVOCs | | | | |
Nitrosodi-n-propylamine, N- | N-Nitrosodi-n-propylamine | 621647 |   | ug/L |   |   |   |   | Organics | SVOCs | | | | |
Nitrosodiphenylamine, N- | N-Nitrosodiphenylamine | 0 |   | ug/L |   |   |   |   | Organics | SVOCs | | | | |
No Debris Collected | No Debris Collected | 0 | pieces |   |   |   |   |   | Debris | Trash | Survey | | | |
No Debris Present | No Debris Present | 0 | pieces |   |   |   |   |   | Debris | Trash | Survey | | | |
Nodularin | Nodularin | 118399227 |   | ug/L |   |   | ng/g ww | ng/g dw | Microbiological | Cyanotoxins | | | | |
NoItems | Number of Items using Trash Protocol | 0 | score |   |   |   |   |   | Trash | | | | | |
Nonachlor, cis- | cis-Nonachlor | 5103731 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OCHs | Endocrine Disruptors | | |
Nonachlor, cis-(Surrogate) | Surrogate: cis-Nonachlor | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | | | | | |
Nonachlor, trans- | trans-Nonachlor | 39765805 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OCHs | Endocrine Disruptors | | |
Nonachlor, trans-(Surrogate) | Surrogate: trans-Nonachlor | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | Pesticides | | | | |
Nonachlor-13C10, cis-(IsoDilAnalogue) | Isotope Dilution Analogue: cis-Nonachlor-13C10 | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | Pesticides | IDA | | | |
Nonachlor-13C10, trans-(IsoDilAnalogue) | Isotope Dilution Analogue: trans-Nonachlor-13C10 | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | Pest-OCHs | IDA | | | |
Nonylphenol | Nonylphenol | 25154523 |   | ug/L |   |   |   |   | Organics | Surfactants | Phenols | non-Chlorinated Phenols | Endocrine Disruptors | |
Nonylphenol, 4-n- | 4-n-Nonylphenol | 104405 |   | ug/L |   |   |   |   | Organics | | | | | |
Nonylphenol, tech- | tech-Nonylphenol (Branched p-nonylphenol) | 84852153 |   | ug/L |   |   |   |   | Organics | Pesticides | | | | |
Nonylphenolethoxylate | Nonylphenolethoxylate | 9016459 |   | ug/L |   |   |   |   | Organics | Surfactants | Phenols | non-Chlorinated Phenols | Endocrine Disruptors | |
Norfloxacin | Norfloxacin | 0 |   |   |   |   | ng/g ww | ng/g dw | Organics | | | | | |
Norflurazon | Norflurazon (3(2H)-Pyridazinone, 4-chloro-5-(methylamino)-2-[3-(trifluoromethyl)phenyl]-) (Telok) | 27314132 |   | ug/L |   |   |   |   | Organics | Pesticides | Herbicides | | | |
Norgestimate | Norgestimate | 0 |   |   |   |   | ng/g ww | ng/g dw | Organics | | | | | |
Normal Development | Normal Development (%) | 0 |   |   |   | % |   |   | Toxicity | | | | | |
Novaluron | Novaluron | 116714466 |   | ng/L |   |   |   |   | Organics | Pesticides | Herbicides | | | |
O,O,O-Triethyl phosphorothioate | O,O,O-Triethyl phosphorothioate | 0 |   | ug/L |   |   |   |   | | | | | | |
ObservedChannelFlowLevel | ObservedChannelFlowLevel | 0 | none |   |   |   |   |   | FieldObservations | Habitat | | | | |
ObservedFlow | ObservedFlow | 0 | none | cfs |   |   |   |   | FieldObservations | Habitat | | | | |
OCDD, 1,2,3,4,6,7,8,9- | 1,2,3,4,6,7,8,9-Octachlordibenzo-p-dioxin (OCDD) | 3268879 |   | ug/L |   |   |   |   | Organics | PCDDs/PCDFs | Dioxins/Dibenzofurans | | | |
OCDD, 1,2,3,4,6,7,8,9- (TEQ ND=0) | 1,2,3,4,6,7,8,9-OCDD (TEQ ND=0) | 0 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
OCDD, 1,2,3,4,6,7,8,9- (TEQ ND=1/2 DL) | 1,2,3,4,6,7,8,9-OCDD (TEQ ND=1/2 DL) | 0 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
OCDD, 1,2,3,4,6,7,8,9-(Surrogate) | Surrogate: 1,2,3,4,6,7,8,9-Octachlordibenzo-p-dioxin (OCDD) | 3268879 |   | % recovery |   |   |   |   | Organics | PCDDs/PCDFs | Dioxins/Dibenzofurans | | | |
OCDD-13C, 1,2,3,4,6,7,8,9-(Surrogate) | Surrogate: 1,2,3,4,6,7,8,9-Octachlordibenzo-p-dioxin-13C (OCDD) | 114423971 |   | % recovery |   |   |   |   | Organics | PCDDs/PCDFs | Dioxins/Dibenzofurans | | | |
OCDD-13C12, 1,2,3,4,6,7,8,9-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3,4,6,7,8,9-OCDD-13C12 | 114423971 |   | % recovery |   |   |   |   | Organics | Dioxins/Dibenzofurans | IDA | | | |
OCDF, 1,2,3,4,6,7,8,9- | 1,2,3,4,6,7,8,9-Octachlordibenzofuran (OCDF) | 39001020 |   | pg/L |   |   |   |   | Organics | PCDDs/PCDFs | Dioxins/Dibenzofurans | | | |
OCDF, 1,2,3,4,6,7,8,9- (TEQ ND=0) | 1,2,3,4,6,7,8,9-OCDF (TEQ ND=0) | 0 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
OCDF, 1,2,3,4,6,7,8,9- (TEQ ND=1/2 DL) | 1,2,3,4,6,7,8,9- OCDF (TEQ ND=1/2 DL) | 0 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
OCDF, 1,2,3,4,6,7,8,9-(Surrogate) | Surrogate: 1,2,3,4,6,7,8,9-Octachlordibenzofuran (OCDF) | 39001020 |   | % recovery |   |   |   |   | Organics | PCDDs/PCDFs | Dioxins/Dibenzofurans | | | |
Octacosane, n- | n-Octacosane | 0 |   | % recovery |   |   |   |   | Organics | Alkanes | | | | |
Odor | Odor | 0 | none | TON | none |   |   |   | FieldObservations | Habitat | | | | |
Odor Intensity | Odor Intensity - Specific to EMAP BA (characterizes intensity of odor) | 0 | none |   |   |   |   |   | Habitat | | | | | |
Ofloxacin | Ofloxacin | 0 |   |   |   |   | ng/g ww | ng/g dw | Organics | | | | | |
Oil, Gas Wells | Oil, Gas Wells | 0 | none |   |   |   |   |   | Habitat | | | | | |
OilandGrease | Oil & Grease | 0 |   | mg/L |   |   |   |   | Inorganics | Conventionals | | | | |
OilandGrease; HEM | Oil and Grease, N-Hexane Extractable Material | 0 |   | mg/L |   |   |   |   | Inorganics | Conventionals | | | | |
OilandGrease; SGT-HEM | Oil and Grease, Silica Gel Treated N-Hexane Extractable Material (Non-Polar Material Not Adsorbed by Silica Gel) | 0 |   | mg/L |   |   |   |   | Inorganics | Conventionals | | | | |
Okadaic Acid | Okadaic Acid | 78111178 |   | ug/L |   |   | ng/g ww | ng/g dw | Microbiological | Cyanotoxins | | | | |
Orchards | Orchards | 0 | none |   |   |   |   |   | Habitat | | | | | |
Ormetoprim | Ormetoprim | 0 |   |   |   |   | ng/g ww | ng/g dw | Organics | | | | | |
OrthoPhosphate as P | Reactive Phosphorous (PO4) | 14265442 |   | ug/L |   |   |   |   | Inorganics | Conventionals | Nutrients | | | |
Oryzalin | Oryzalin (Rycelan) (Ryzelan) (Surflan) | 19044883 |   | ug/L |   |   |   |   | Organics | Herbicides | | | | |
o-Terphenyl(Surrogate) | Surrogate: o-Terphenyl | 84151 |   | % recovery | % recovery |   |   |   | Organics | SVOCs | | | | |
OtherPresence | OtherPresence | 0 | none |   |   |   |   |   | FieldObservations | Habitat | | | | |
Outfall Accessibility | Outfall Accessibility | 0 | none |   |   |   |   |   | | | | | | |
Outfall Structural Cond | Structural condition of the outfall | 0 | none |   |   |   |   |   | | | | | | |
Outfall, Distance from Transect | Outfall, Distance from Transect | 0 | m |   |   |   |   |   | Habitat | Debris | | | | |
Outfall, Within Transect | Outfall, Within Transect | 0 | none |   |   |   |   |   | Habitat | Debris | | | | |
OverlandRunoffLast24hrs | Influence of overland runoff during last 24 hours | 0 | none |   |   |   |   |   | FieldObservations | Habitat | | | | |
Oxacillin | Oxacillin | 0 |   |   |   |   | ng/g ww | ng/g dw | Organics | | | | | |
Oxadiazon | Oxadiazon | 19666309 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OCHs | | | |
Oxamyl | Oxamyl | 23135220 |   | ug/L | ug/Kg dw |   |   |   | Organics | Pesticides | Pest-Carbamates | Insecticides | Nematocides | |
Oxidation-Reduction Potential | Oxidation-Reduction Potential (OPR) | 0 |   | mV |   |   |   |   | WaterQualityMeasurements | Conventionals | Inorganics | | | |
Oxolinic Acid | Oxolinic Acid | 0 |   |   |   |   | ng/g ww | ng/g dw | Organics | | | | | |
Oxychlordane | Oxychlordane | 27304138 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OCHs | Endocrine Disruptors | | |
Oxychlordane(Surrogate) | Surrogate: Oxychlordane | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | | | | | |
Oxychlordane-13C10(IsoDilAnalogue) | Isotope Dilution Analogue: Oxychlordane-13C10 | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | Pest-OCHs | IDA | | | |
Oxychlordane-13C10(Surrogate) | Surrogate: Oxychlordane-13C10 | 0 |   | % recovery |   |   |   |   | Organics | | | | | |
Oxyfluorfen | Oxyfluorfen (Goal) | 42874033 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Pest-OCHs | | | |
Oxygen, Dissolved | Dissolved Oxygen (DO) | 0 |   | mg/L |   |   |   |   | WaterQualityMeasurements | Conventionals | | | | |
Oxygen, Saturation | Oxygen, Saturation | 0 |   | % |   |   |   |   | WaterQualityMeasurements | Conventionals | | | | |
Oxygen-18/Oxygen-16 Ratio | Oxygen-18/Oxygen-16 Ratio (Delta 18O nitrate isotope) | 14797718 |   | per mil |   |   |   |   | Isotopes | | | | | |
Oxytetracycline | Oxytetracycline | 79572 |   | ug/L |   |   |   |   | Organics | PPCPs | | | | |
Paclobutrazol | Paclobutrazol | 76738620 |   | ng/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
Paper/Cardboard | Paper/Cardboard | 0 | pieces |   |   |   |   |   | Debris | Trash | Non-Plastics | Biodegradable | | |
PAR | Photosynthetically Active Radiation (PAR) | 0 |   | mE/m2/s |   |   |   |   | WaterQualityMeasurements | | | | | |
Paraquat | Paraquat | 4685150 |   | ug/L |   |   |   |   | Organics | Pesticides | Herbicides | | | |
Parathion, Ethyl | Ethyl Parathion (Parathion) | 56382 |   | ug/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | Pesticides | Pest-OPs | Insecticides | | |
Parathion, Methyl | Methyl Parathion | 298000 |   | ug/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | Pesticides | Pest-OPs | Insecticides | | |
Parathion, Total | Total Parathion | 0 |   | ug/L |   |   |   |   | Organics | | | | | |
Parks, Campgrounds | Parks, Campgrounds | 0 | none |   |   |   |   |   | Habitat | | | | | |
Particulate Organic Carbon | Particulate Organic Carbon (POC) | 0 |   | mg/L |   |   |   |   | Inorganics | Conventionals | | | | |
Pasture | Pasture | 0 | none |   |   |   |   |   | Habitat | | | | | |
PBDE 007 | Polybrominated Diphenyl Ether (PBDE) 7 | 0 |   | pg/sample | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | FlameRetardants | | | | |
PBDE 008 | Polybrominated Diphenyl Ether (PBDE) 8 | 0 |   | pg/sample | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | FlameRetardants | | | | |
PBDE 008/11 | Polybrominated Diphenyl Ether (PBDE) 8/11 | 0 |   | pg/L |   |   | pg/g ww | pg/g dw | Organics | PBDEs | FlameRetardants | | | |
PBDE 010 | Polybrominated Diphenyl Ether (PBDE) 10 | 0 |   | pg/sample | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | FlameRetardants | | | | |
PBDE 011 | Polybrominated Diphenyl Ether (PBDE) 11 | 0 |   | pg/sample | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | FlameRetardants | | | | |
PBDE 012 | Polybrominated Diphenyl Ether (PBDE) 12 | 0 |   | pg/sample | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | FlameRetardants | | | | |
PBDE 012/13 | Polybrominated Diphenyl Ether (PBDE) 12/13 | 0 |   | pg/L |   |   | pg/g ww | pg/g dw | Organics | PBDEs | FlameRetardants | | | |
PBDE 013 | Polybrominated Diphenyl Ether (PBDE) 13 | 0 |   | pg/sample | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | FlameRetardants | | | | |
PBDE 015 | Polybrominated Diphenyl Ether (PBDE) 15 | 0 |   | pg/sample | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | FlameRetardants | | | | |
PBDE 015(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 15 | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | FlameRetardants | | | | |
PBDE 017 | Polybrominated Diphenyl Ether (PBDE) 17 | 49690940 |   | ug/L | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | PBDEs | FlameRetardants | | | |
PBDE 017/25 | Polybrominated Diphenyl Ether (PBDE) 17/25 | 0 |   | ug/L | ng/g dw |   | ug/Kg ww | ug/Kg dw | Organics | PBDEs | FlameRetardants | | | |
PBDE 025 | Polybrominated Diphenyl Ether (PBDE) 25 | 0 |   | ug/L | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | PBDEs | FlameRetardants | | | |
PBDE 028 | Polybrominated Diphenyl Ether (PBDE) 28 | 6430906 |   | ug/L | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | PBDEs | FlameRetardants | | | |
PBDE 028(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 28 | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | FlameRetardants | | | | |
PBDE 028/33 | Polybrominated Diphenyl Ether (PBDE) 28/33 | 0 |   | ug/L | ng/g dw |   | pg/g ww | pg/g dw | Organics | PBDEs | FlameRetardants | | | |
PBDE 028-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 028-13C12 | 0 |   |   | % recovery |   | % recovery | % recovery | Organics | PBDE | IDA | | | |
PBDE 030 | Polybrominated Diphenyl Ether (PBDE) 30 | 0 |   | ug/L | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | PBDEs | FlameRetardants | | | |
PBDE 032 | Polybrominated Diphenyl Ether (PBDE) 32 | 0 |   | pg/sample | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | FlameRetardants | | | | |
PBDE 033 | Polybrominated Diphenyl Ether (PBDE) 33 | 0 |   | ug/L | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | PBDEs | FlameRetardants | | | |
PBDE 035 | Polybrominated Diphenyl Ether (PBDE) 35 | 0 |   | pg/sample | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | FlameRetardants | | | | |
PBDE 037 | Polybrominated Diphenyl Ether (PBDE) 37 | 0 |   | pg/sample | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | FlameRetardants | | | | |
PBDE 047 | Polybrominated Diphenyl Ether (PBDE) 47 | 5436431 |   | ug/L | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | PBDEs | FlameRetardants | | | |
PBDE 047(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 47 | 5436430 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | FlameRetardants | | | | |
PBDE 047-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 047-13C12 | 0 |   |   | % recovery |   | % recovery | % recovery | Organics | PBDE | IDA | | | |
PBDE 049 | Polybrominated Diphenyl Ether (PBDE) 49 | 0 |   | ug/L | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | PBDEs | FlameRetardants | | | |
PBDE 051 | Polybrominated Diphenyl Ether (PBDE) 51 | 0 |   | pg/sample | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | FlameRetardants | | | | |
PBDE 066 | Polybrominated Diphenyl Ether (PBDE) 66 | 84303457 |   | ug/L | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | PBDEs | FlameRetardants | | | |
PBDE 071 | Polybrominated Diphenyl Ether (PBDE) 71 | 0 |   | pg/sample | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | FlameRetardants | | | | |
PBDE 075 | Polybrominated Diphenyl Ether (PBDE) 75 | 0 |   | pg/sample | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | FlameRetardants | | | | |
PBDE 077 | Polybrominated Diphenyl Ether (PBDE) 77 | 0 |   | pg/sample | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | FlameRetardants | | | | |
PBDE 077(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 77 | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | FlameRetardants | | | | |
PBDE 079 | Polybrominated Diphenyl Ether (PBDE) 79 | 0 |   | pg/sample | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | FlameRetardants | | | | |
PBDE 085 | Polybrominated Diphenyl Ether (PBDE) 85 | 182346210 |   | ug/L | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | PBDEs | FlameRetardants | | | |
PBDE 099 | Polybrominated Diphenyl Ether (PBDE) 99 | 60348609 |   | ug/L | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | PBDEs | FlameRetardants | | | |
PBDE 099(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 99 | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | FlameRetardants | | | | |
PBDE 099-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 099-13C12 | 0 |   |   | % recovery |   | % recovery | % recovery | Organics | PBDE | IDA | | | |
PBDE 100 | Polybrominated Diphenyl Ether (PBDE) 100 | 97038976 |   | ug/L | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | PBDEs | FlameRetardants | | | |
PBDE 100(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 100 | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | FlameRetardants | | | | |
PBDE 100-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 100-13C12 | 0 |   |   | % recovery |   | % recovery | % recovery | Organics | | IDA | | | |
PBDE 100-L(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 100-Labeled | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PBDEs | FlameRetardants | | | |
PBDE 105 | Polybrominated Diphenyl Ether (PBDE) 105 | 0 |   | pg/sample | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | FlameRetardants | | | | |
PBDE 116 | Polybrominated Diphenyl Ether (PBDE) 116 | 0 |   | pg/sample | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | FlameRetardants | | | | |
PBDE 119 | Polybrominated Diphenyl Ether (PBDE) 119 | 0 |   | pg/sample | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | FlameRetardants | | | | |
PBDE 119/120 | Polybrominated Diphenyl Ether (PBDE) 119/120 | 0 |   | pg/L |   |   | pg/g ww | pg/g dw | Organics | PBDEs | FlameRetardants | | | |
PBDE 120 | Polybrominated Diphenyl Ether (PBDE) 120 | 0 |   | pg/sample | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | FlameRetardants | | | | |
PBDE 126 | Polybrominated Diphenyl Ether (PBDE) 126 | 0 |   | pg/sample | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | FlameRetardants | | | | |
PBDE 126(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 126 | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | FlameRetardants | | | | |
PBDE 128 | Polybrominated Diphenyl Ether (PBDE) 128 | 0 |   | pg/sample | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | FlameRetardants | | | | |
PBDE 138 | Polybrominated Diphenyl Ether (PBDE) 138 | 67888986 |   | ug/L | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | PBDEs | FlameRetardants | | | |
PBDE 138(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 138 | 67888986 |   | % recovery | % recovery |   |   |   | Organics | PBDEs | FlameRetardants | | | |
PBDE 138/166 | Polybrominated Diphenyl Ether (PBDE) 138/166 | 0 |   | pg/L |   |   | pg/g ww | pg/g dw | Organics | PBDEs | FlameRetardants | | | |
PBDE 139(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 139 | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | FlameRetardants | | | | |
PBDE 139-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 139-13C12 | 0 |   |   | % recovery |   | % recovery | % recovery | Organics | | IDA | | | |
PBDE 140 | Polybrominated Diphenyl Ether (PBDE) 140 | 0 |   | pg/sample | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | FlameRetardants | | | | |
PBDE 153 | Polybrominated Diphenyl Ether (PBDE) 153 | 68631492 |   | ug/L | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | PBDEs | FlameRetardants | | | |
PBDE 153(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 153 | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | FlameRetardants | | | | |
PBDE 153-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 153-13C12 | 0 |   |   | % recovery |   | % recovery | % recovery | Organics | | IDA | | | |
PBDE 154 | Polybrominated Diphenyl Ether (PBDE) 154 | 36402150 |   | ug/L | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | PBDEs | FlameRetardants | | | |
PBDE 154(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 154 | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | FlameRetardants | | | | |
PBDE 154-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 154-13C12 | 0 |   |   | % recovery |   | % recovery | % recovery | Organics | | IDA | | | |
PBDE 155 | Polybrominated Diphenyl Ether (PBDE) 155 | 0 |   | pg/sample | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | FlameRetardants | | | | |
PBDE 166 | Polybrominated Diphenyl Ether (PBDE) 166 | 0 |   | pg/sample | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | FlameRetardants | | | | |
PBDE 179 | Polybrominated Diphenyl Ether (PBDE) 179 | 0 |   | ug/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | PBDEs | FlameRetardants | | | |
PBDE 181 | Polybrominated Diphenyl Ether (PBDE) 181 | 0 |   | pg/sample | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | FlameRetardants | | | | |
PBDE 183 | Polybrominated Diphenyl Ether (PBDE) 183 | 68928803 |   | ug/L | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | PBDEs | FlameRetardants | | | |
PBDE 183(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 183 | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | FlameRetardants | | | | |
PBDE 183-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 183-13C12 | 0 |   |   | % recovery |   | % recovery | % recovery | Organics | | IDA | | | |
PBDE 184 | Polybrominated Diphenyl Ether (PBDE) 184 | 0 |   | ug/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | PBDEs | FlameRetardants | | | |
PBDE 188 | Polybrominated Diphenyl Ether (PBDE) 188 | 0 |   | ug/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | PBDEs | FlameRetardants | | | |
PBDE 190 | Polybrominated Diphenyl Ether (PBDE) 190 | 79682250 |   | ug/L | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | PBDEs | FlameRetardants | | | |
PBDE 197(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 197 | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | FlameRetardants | | | | |
PBDE 200 | Polybrominated Diphenyl Ether (PBDE) 200 | 0 |   | ug/L | ng/g dw |   |   |   | Organics | PBDEs | FlameRetardants | | | |
PBDE 200/203 | Polybrominated Diphenyl Ether (PBDE) 200/203 | 0 |   | ug/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | PBDEs | FlameRetardants | | | |
PBDE 201 | Polybrominated Diphenyl Ether (PBDE) 201 | 0 |   | ug/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | PBDEs | FlameRetardants | | | |
PBDE 202 | Polybrominated Diphenyl Ether (PBDE) 202 | 0 |   | ug/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | PBDEs | FlameRetardants | | | |
PBDE 203 | Polybrominated Diphenyl Ether (PBDE) 203 | 0 |   | ug/L | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | PBDEs | FlameRetardants | | | |
PBDE 206 | Polybrominated Diphenyl Ether (PBDE) 206 | 0 |   | ug/L | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | PBDEs | FlameRetardants | | | |
PBDE 207 | Polybrominated Diphenyl Ether (PBDE) 207 | 0 |   | ug/L | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | PBDEs | FlameRetardants | | | |
PBDE 208 | Polybrominated Diphenyl Ether (PBDE) 208 | 0 |   | ug/L | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | PBDEs | FlameRetardants | | | |
PBDE 209 | Polybrominated Diphenyl Ether (PBDE) 209 | 0 |   | ug/L | pg/g dw |   | ug/Kg ww | ug/Kg dw | Organics | PBDEs | FlameRetardants | | | |
PBDE 209(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 209 | 2051240 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | FlameRetardants | | | | |
PBDE 209-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 209-13C12 | 0 |   |   | % recovery |   | % recovery | % recovery | Organics | | IDA | | | |
PCB 001 | PCB 1 Congener | 0 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 001(Surrogate) | Surrogate: PCB 1 Congener | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | | | | |
PCB 001-13C(surrogate) | Surrogate: PCB 001-13C Congener | 0 |   | % recovery |   |   |   |   | Organics | | | | | |
PCB 001-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 001-13C12 | 234432850 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | IDA | | | |
PCB 002 | PCB 2 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 003 | PCB 3 Congener | 2051629 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 003(Surrogate) | Surrogate: PCB 3 Congener | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | | | | |
PCB 003-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 003-13C12 | 208263778 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | IDA | | | |
PCB 004 | PCB 4 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 004(Surrogate) | Surrogate: PCB 4 Congener | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | | | | |
PCB 004/10 | PCB 4/10 Congener | 0 |   | pg/L |   |   |   |   | Organics | PCBs | | | | |
PCB 004-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 004-13C12 | 234432861 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | IDA | | | |
PCB 005 | PCB 5 Congener | 16605917 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 005/8 | PCB 5/8 Congener | 0 |   | ug/L | ng/g dw |   |   |   | Organics | PCBx | | | | |
PCB 006 | PCB 6 Congener | 25569806 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 007 | PCB 7 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 007/9 | PCB 7/9 Congener | 0 |   | pg/L |   |   |   |   | Organics | PCBs | | | | |
PCB 008 | PCB 8 Congener | 34883437 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 008(Surrogate) | Surrogate: PCB 8 Congener | 34883400 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | Congeners | | | |
PCB 009 | PCB 9 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 009-13C(Surrogate) | Surrogate: PCB 009-13C Congener | 0 |   | % recovery |   |   |   |   | Organics | PCBs | | | | |
PCB 009-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 9-13C12 | 250694894 |   | % recovery |   |   |   |   | Organics | PCBs | IDA | | | |
PCB 010 | PCB 10 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 011 | PCB 11 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 011-13C(Surrogate) | Surrogate: PCB 011-13C Congener | 0 |   | % recovery |   |   |   |   | Organics | PCBs | | | | |
PCB 012 | PCB 12 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 012/13 | PCB 12/13 Congener | 0 |   | pg/L | ug/Kg dw |   |   |   | Organics | PCBs | | | | |
PCB 013 | PCB 13 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 014 | PCB 14 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 015 | PCB 15 Congener | 2050682 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 015(Surrogate) | Surrogate: PCB 15 Congener | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | | | | |
PCB 015-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 015-13C12 | 208263676 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | IDA | | | |
PCB 016 | PCB 16 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 016/32 | PCB 16/32 Congener | 0 |   | pg/L |   |   |   |   | Organics | PCBs | | | | |
PCB 017 | PCB 17 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 018 | PCB 18 Congener | 37680652 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 018/30 | PCB 18/30 Congener | 0 |   | pg/L | ug/Kg ww |   |   |   | Organics | PCBs | | | | |
PCB 019 | PCB 19 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 019(Surrogate) | Surrogate: PCB 19 Congener | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | | | | |
PCB 019-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 019-13C12 | 234432872 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | IDA | | | |
PCB 020 | PCB 20 Congener | 38444800 |   | pg/sample | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 020/21/33 | PCB 020/21/33 Congener | 0 |   | ug/L |   |   |   |   | Organics | PCBs | Congeners | | | |
PCB 020/28 | PCB 20/28 Congener | 0 |   | pg/L | ug/Kg ww |   |   |   | Organics | PCBs | | | | |
PCB 021 | PCB 21 Congener | 55702500 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 021/33 | PCB 21/33 Congener | 0 |   | pg/L | ug/Kg dw |   |   |   | Organics | PCBs | | | | |
PCB 022 | PCB 22 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 023 | PCB 23 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 024 | PCB 24 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 024/27 | PCB 24/27 Congener | 0 |   | pg/L |   |   |   |   | Organics | PCBs | | | | |
PCB 025 | PCB 25 Congener | 55712373 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 026 | PCB 26 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 026/29 | PCB 26/29 Congener | 0 |   | pg/L | ug/Kg dw |   |   |   | Organics | PCBs | | | | |
PCB 027 | PCB 27 Congener | 38444767 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 028 | PCB 28 Congener | 7012375 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 028(Surrogate) | Surrogate: PCB 28 Congener | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | | | | |
PCB 028/31 | PCB 28/31 Congener | 0 |   | ng/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | PCBs | Congeners | | | |
PCB 028-13C(Surrogate) | Surrogate: PCB 028-13C Congener | 0 |   | % recovery |   |   |   |   | Organics | PCBs | | | | |
PCB 028-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 028-13C12 | 208263767 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | IDA | | | |
PCB 029 | PCB 29 Congener | 15862074 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 030 | PCB 30 Congener | 0 |   | pg/sample | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 030(Surrogate) | Surrogate: PCB 30 Congener | 35693926 |   | ug/L | % recovery |   | % recovery | % recovery | Organics | PCBs | Congeners | | | |
PCB 031 | PCB 31 Congener | 16606023 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 031(Surrogate) | Surrogate: PCB 31 Congener | 16606023 |   | % recovery |   |   | % recovery | % recovery | Organics | PCBs | Congeners | | | |
PCB 031-13C(Surrogate) | Surrogate: PCB 31-13C Congener | 0 |   | % recovery |   |   |   |   | Organics | | | | | |
PCB 031-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 031-13C12 | 0 |   | % recovery |   |   |   |   | Organics | PCBs | IDA | | | |
PCB 032 | PCB 32 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 032-13C(Surrogate) | Surrogate: PCB 32-13C Congener | 0 |   | % recovery |   |   |   |   | Organics | PCBs | Congeners | | | |
PCB 032-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 32-13C12 | 0 |   | % recovery |   |   |   |   | Organics | PCBs | IDA | | | |
PCB 033 | PCB 33 Congener | 38444869 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 034 | PCB 34 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 035 | PCB 35 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 036 | PCB 36 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 037 | PCB 37 Congener | 38444905 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 037(Surrogate) | Surrogate: PCB 37 Congener | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | | | | |
PCB 037-13C(surrogate) | Surrogate: PCB 037-13C Congener | 0 |   | % recovery |   |   |   |   | Organics | | | | | |
PCB 037-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 037-13C12 | 208263790 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | IDA | | | |
PCB 038 | PCB 38 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 039 | PCB 39 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 040 | PCB 40 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 040/41 | PCB 40/41 Congener | 0 |   | pg/L | ug/Kg dw |   |   |   | Organics | PCBs | | | | |
PCB 040/41/71 | PCB 40/41/71 Congener | 0 |   | pg/L | ng/g nr |   |   |   | | | | | | |
PCB 040/71 | PCB 40/71 Congener | 0 |   | pg/L | ug/Kg dw |   |   |   | Organics | PCBs | | | | |
PCB 041 | PCB 41 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 041/64/71/72 | PCB 041/64/71/72 Congener | 0 |   | pg/L |   |   |   |   | Organics | PCBs | | | | |
PCB 041/71/40 | PCB 41/71/40 Congener | 0 |   | pg/L |   |   |   |   | | | | | | |
PCB 042 | PCB 42 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 042/59 | PCB 042/59 Congener | 0 |   | pg/L |   |   |   |   | Organics | PCBs | | | | |
PCB 043 | PCB 43 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 043/49 | PCB 43/49 Congener | 0 |   | ug/L |   |   |   |   | Organics | PCBs | Congeners | | | |
PCB 043/73 | PCB 43/73 Congener | 0 |   | pg/L |   |   |   |   | | | | | | |
PCB 044 | PCB 44 Congener | 41464395 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 044/47 | PCB 44/47 Congener | 0 |   | pg/L | ug/Kg ww |   |   |   | Organics | PCBs | | | | |
PCB 044/47/65 | PCB 44/47/65 | 0 |   | pg/L | ng/g nr |   |   |   | | | | | | |
PCB 044/65 | PCB 44/65 Congener | 0 |   | pg/L | ug/Kg ww |   |   |   | Organics | PCBs | | | | |
PCB 045 | PCB 45 Congener | 0 |   | pg/sample | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 045/51 | PCB 45/51 Congener | 0 |   | pg/L | ug/Kg ww |   |   |   | Organics | PCBs | | | | |
PCB 046 | PCB 46 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 047 | PCB 47 Congener | 0 |   | pg/sample | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 047-13C(Surrogate) | Surrogate: PCB 47-13C Congener | 0 |   | % recovery |   |   |   |   | Organics | PCBs | Congeners | | | |
PCB 047-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 47-13C12 | 0 |   | % recovery |   |   |   |   | Organics | PCBs | IDA | | | |
PCB 048 | PCB 48 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 048/75 | PCB 048/75 Congener | 0 |   | pg/L |   |   |   |   | Organics | PCBs | | | | |
PCB 049 | PCB 49 Congener | 41464408 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 049/69 | PCB 49/69 Congener | 0 |   | pg/L | ug/Kg ww |   |   |   | Organics | PCBs | | | | |
PCB 050 | PCB 50 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 050/53 | PCB 50/53 Congener | 0 |   | pg/L | ug/Kg dw |   |   |   | Organics | PCBs | | | | |
PCB 051 | PCB 51 Congener | 0 |   | pg/sample | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 052 | PCB 52 Congener | 35693993 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 052/69 | PCB 52/69 Congener | 0 |   | ug/L |   |   |   |   | Organics | PCBs | Congeners | | | |
PCB 052-13C(Surrogate) | Surrogate: PCB 052-13C Congener | 0 |   | % recovery |   |   |   |   | Organics | PCBs | | | | |
PCB 052-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 52-13C12 | 208263803 |   | % recovery |   |   |   |   | Organics | PCBs | IDA | | | |
PCB 053 | PCB 53 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 054 | PCB 54 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 054(Surrogate) | Surrogate: PCB 54 Congener | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | | | | |
PCB 054-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 054-13C12 | 234432883 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | IDA | | | |
PCB 055 | PCB 55 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 056 | PCB 56 Congener | 41464431 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 056/60 | PCB 56/60 Congener | 0 |   | ug/L | ug/g dw |   | ng/g ww | ng/g dw | Organics | PCBs | Congeners | | | |
PCB 057 | PCB 57 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 058 | PCB 58 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 059 | PCB 59 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 059/62 | PCB 59/62 Congener | 0 |   | pg/L | ug/Kg dw |   |   |   | Organics | PCBs | | | | |
PCB 059/62/75 | PCB 59/62/75 Congener | 0 |   | pg/L | ng/g nr |   |   |   | | | | | | |
PCB 059/75 | PCB 59/75 Congener | 0 |   | pg/L | ug/Kg dw |   |   |   | Organics | PCBs | | | | |
PCB 060 | PCB 60 Congener | 33025411 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 061 | PCB 61 Congener | 33284500 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 061/70 | PCB 61/70 Congener | 0 |   | ug/L | ug/Kg dw |   |   |   | Organics | PCBs | Congeners | | | |
PCB 061/70/74/76 | PCB 61/70/74/76 Congener | 0 |   | pg/L | ng/g nr |   |   |   | | | | | | |
PCB 061/74 | PCB 61/74 Congener | 0 |   | pg/L |   |   |   |   | Organics | PCBs | | | | |
PCB 061/76 | PCB 61/76 Congener | 0 |   | pg/L |   |   |   |   | Organics | PCBs | | | | |
PCB 062 | PCB 62 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 063 | PCB 63 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 064 | PCB 64 Congener | 52663588 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 065 | PCB 65 Congener | 33284500 |   | pg/sample | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 065(Surrogate) | Surrogate: PCB 65 Congener | 33284547 |   |   | % recovery |   | % recovery | % recovery | Organics | PCBs | Congeners | | | |
PCB 066 | PCB 66 Congener | 32598100 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 066/76 | PCB 66/76 Congener | 0 |   | ug/L |   |   |   |   | Organics | PCBs | Congeners | | | |
PCB 067 | PCB 67 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 068 | PCB 68 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 069 | PCB 69 Congener | 60233200 |   | pg/sample | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 070 | PCB 70 Congener | 32598111 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 070/61/74/76 | PCB 70/61/74/76 Congener | 0 |   | pg/L |   |   |   |   | | | | | | |
PCB 070/74 | PCB 070/74 | 0 |   |   | ug/Kg dw |   |   |   | Organics | PCBs | | | | |
PCB 070/76 | PCB 070/76 | 0 |   |   | ug/Kg dw |   |   |   | Organics | PCBs | | | | |
PCB 070-13C(Surrogate) | Surrogate: PCB 70-13C Congener | 0 |   | % recovery |   |   |   |   | Organics | PCBs | Congeners | | | |
PCB 070-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 70-13C12 | 208263814 |   | % recovery |   |   |   |   | Organics | PCBs | IDA | | | |
PCB 071 | PCB 71 Congener | 41464464 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 072 | PCB 72 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 073 | PCB 73 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 074 | PCB 74 Congener | 32690930 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 075 | PCB 75 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 076 | PCB 76 Congener | 70362500 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 077 | PCB 77 Congener | 32598133 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 077 (TEQ ND=0) | PCB 077 (TEQ ND=0) | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 077 (TEQ ND=1/2 DL) | PCB 077 (TEQ ND=1/2 DL) | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 077 (TEQ ND=DL) | PCB 077 (TEQ ND=DL) | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 077(Surrogate) | Surrogate: PCB 77 Congener | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | | | | |
PCB 077-13C(Surrogate) | Surrogate: PCB 77-13C Congener | 0 |   | % recovery |   |   |   |   | Organics | PCBs | | | | |
PCB 077-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 077-13C12 | 105600235 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | IDA | | | |
PCB 078 | PCB 78 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 079 | PCB 79 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 079-13C(Surrogate) | Surrogate: PCB 79-13C Congener | 0 |   | % recovery |   |   |   |   | Organics | PCBs | Congeners | | | |
PCB 079-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 79-13C12 | 0 |   | % recovery |   |   |   |   | Organics | PCBs | IDA | | | |
PCB 080 | PCB 80 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 080-13C(Surrogate) | Surrogate: PCB 80-13C Congener | 0 |   | % recovery |   |   |   |   | Organics | PCBs | Congeners | | | |
PCB 080-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 80-13C12 | 0 |   | % recovery |   |   |   |   | Organics | PCBs | IDA | | | |
PCB 081 | PCB 81 Congener | 70362504 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 081 (TEQ ND=0) | PCB 081 (TEQ ND=0) | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 081 (TEQ ND=1/2 DL) | PCB 081 (TEQ ND=1/2 DL) | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 081 (TEQ ND=DL) | PCB 081 (TEQ ND=DL) | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 081(Surrogate) | Surrogate: PCB 81 Congener | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | | | | |
PCB 081-13C(surrogate) | Surrogate: PCB 081-13C Congener | 0 |   | % recovery |   |   |   |   | Organics | | | | | |
PCB 081-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 081-13C12 | 208461249 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | IDA | | | |
PCB 082 | PCB 82 Congener | 52663624 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 083 | PCB 83 Congener | 0 |   | pg/sample | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 083/99 | PCB 83/99 Congener | 0 |   | pg/L | ug/Kg ww |   |   |   | Organics | PCBs | | | | |
PCB 084 | PCB 84 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 084/92 | PCB 084/92 Congener | 0 |   | pg/L |   |   |   |   | Organics | PCBs | | | | |
PCB 085 | PCB 85 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 085/110/115/116/117 | PCB 85/110/115/116/117 Congener | 0 |   | pg/L |   |   |   |   | Organics | PCBs | Congeners | | | |
PCB 085/116 | PCB 85/116 Congener | 0 |   | pg/L | ug/Kg dw |   |   |   | Organics | PCBs | | | | |
PCB 085/116/117 | PCB 85/116/117 Congener | 0 |   | pg/L | ng/g nr |   |   |   | | | | | | |
PCB 085/117 | PCB 85/117 Congener | 0 |   | pg/L | ug/Kg dw |   |   |   | Organics | PCBs | | | | |
PCB 086 | PCB 86 Congener | 55312700 |   | pg/sample | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 086/108 | PCB 86/108 Congener | 0 |   | pg/L |   |   |   |   | Organics | PCBs | | | | |
PCB 086/119 | PCB 86/119 Congener | 0 |   | pg/L |   |   |   |   | Organics | PCBs | | | | |
PCB 086/125 | PCB 86/125 Congener | 0 |   | pg/L |   |   |   |   | Organics | PCBs | | | | |
PCB 086/87 | PCB 86/87 Congener | 0 |   | pg/L | ug/Kg ww |   |   |   | Organics | PCBs | | | | |
PCB 086/87/97/109/119/125 | PCB 86/87/97/109/119/125 Congener | 0 |   | pg/L | ng/g nr |   |   |   | | | | | | |
PCB 086/97 | PCB 86/97 Congener | 0 |   | pg/L |   |   |   |   | Organics | PCBs | | | | |
PCB 087 | PCB 87 Congener | 38380028 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 087/108 | PCB 087/108 | 0 |   |   | ug/Kg ww |   |   |   | Organics | PCBs | | | | |
PCB 087/117/125 | PCB 87/117/125 Congener | 0 |   | ug/L |   |   |   |   | Organics | PCBs | Congeners | | | |
PCB 087/119 | PCB 087/119 | 0 |   |   | ug/Kg ww |   |   |   | Organics | PCBs | | | | |
PCB 087/125 | PCB 087/125 | 0 |   |   | ug/Kg ww |   |   |   | Organics | PCBs | | | | |
PCB 087/97 | PCB 087/97 | 0 |   |   | ug/Kg ww |   |   |   | Organics | PCBs | | | | |
PCB 088 | PCB 88 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 088/91 | PCB 88/91 Congener | 0 |   | pg/L | ug/Kg dw |   |   |   | Organics | PCBs | | | | |
PCB 089 | PCB 89 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 090 | PCB 90 Congener | 68194100 |   | pg/sample | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 090/101 | PCB 90/101 Congener | 0 |   | ug/L | ug/Kg ww |   |   |   | Organics | PCBs | | | | |
PCB 090/101/113 | PCB 90/101/113 Congener | 0 |   | pg/L | ng/g nr |   |   |   | | | | | | |
PCB 090/113 | PCB 90/113 Congener | 0 |   | pg/L |   |   |   |   | Organics | PCBs | | | | |
PCB 091 | PCB 91 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 092 | PCB 92 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 093 | PCB 93 Congener | 73575600 |   | pg/sample | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 093/100 | PCB 93/100 Congener | 0 |   | pg/L |   |   |   |   | Organics | PCBs | | | | |
PCB 093/102 | PCB 93/102 Congener | 0 |   | pg/L |   |   |   |   | Organics | PCBs | | | | |
PCB 093/95 | PCB 93/95 Congener | 0 |   | pg/L | ug/Kg ww |   |   |   | Organics | PCBs | | | | |
PCB 093/95/100 | PCB 93/95/100 Congener | 0 |   | pg/L |   |   |   |   | | | | | | |
PCB 093/95/98/100/102 | PCB 93/95/98/100/102 Congener | 0 |   | pg/L |   |   |   |   | | | | | | |
PCB 093/98 | PCB 93/98 Congener | 0 |   | pg/L |   |   |   |   | Organics | PCBs | | | | |
PCB 093/98/100/102 | PCB 93/98/100/102 Congener | 0 |   |   | ng/g nr |   |   |   | | | | | | |
PCB 094 | PCB 94 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 095 | PCB 95 Congener | 38379996 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 095(Surrogate) | Surrogate: PCB 95 Congener | 38379996 |   | % recovery |   |   | % recovery | % recovery | Organics | PCBs | Congeners | | | |
PCB 095/100 | PCB 095/100 | 0 |   |   | ug/Kg ww |   |   |   | Organics | PCBs | | | | |
PCB 095/102 | PCB 095/102 | 0 |   |   | ug/Kg ww |   |   |   | Organics | PCBs | | | | |
PCB 095/98 | PCB 095/98 | 0 |   |   | ug/Kg ww |   |   |   | Organics | PCBs | | | | |
PCB 095/98/102 | PCB 95/98/102 Congener | 0 |   | ug/L |   |   |   |   | Organics | PCBs | Congeners | | | |
PCB 095-13C(Surrogate) | Surrogate: PCB 095-13C Congener | 0 |   | % recovery |   |   |   |   | Organics | PCBs | | | | |
PCB 095-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 095-13C12 | 0 |   | % recovery |   |   |   |   | Organics | PCBs | IDA | | | |
PCB 096 | PCB 96 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 097 | PCB 97 Congener | 41464511 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 097-13C(Surrogate) | Surrogate: PCB 97-13C Congener | 0 |   | % recovery |   |   |   |   | Organics | PCBs | Congeners | | | |
PCB 097-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 97-13C12 | 0 |   | % recovery |   |   |   |   | Organics | PCBs | IDA | | | |
PCB 098 | PCB 98 Congener | 60233300 |   | pg/sample | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 098/102 | PCB 98/102 Congener | 0 |   | pg/L |   |   |   |   | | | | | | |
PCB 099 | PCB 99 Congener | 38380017 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 100 | PCB 100 Congener | 39485800 |   | pg/sample | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 101 | PCB 101 Congener | 37680732 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 101(Surrogate) | Surrogate: PCB 101 Congener | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | | | | |
PCB 101/113 | PCB 101/113 | 0 |   |   | ug/Kg ww |   |   |   | Organics | PCBs | | | | |
PCB 101-13C(Surrogate) | Surrogate: PCB 101-13C Congener | 0 |   | % recovery |   |   |   |   | Organics | PCBs | | | | |
PCB 101-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 101-13C12 | 104130394 |   | % recovery |   |   |   |   | Organics | PCBs | IDA | | | |
PCB 102 | PCB 102 Congener | 68194100 |   | pg/sample | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 103 | PCB 103 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 104 | PCB 104 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 104(Surrogate) | Surrogate: PCB 104 Congener | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | | | | |
PCB 104-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 104-13C12 | 234432894 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | IDA | | | |
PCB 105 | PCB 105 Congener | 32598144 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 105 (TEQ ND=0) | PCB 105 (TEQ ND=0) | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 105 (TEQ ND=1/2 DL) | PCB 105 (TEQ ND=1/2 DL) | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 105 (TEQ ND=DL) | PCB 105 (TEQ ND=DL) | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 105(Surrogate) | Surrogate: PCB 105 Congener | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | | | | |
PCB 105-13C(Surrogate) | Surrogate: PCB 105-13C Congener | 0 |   | % recovery |   |   |   |   | Organics | PCBs | | | | |
PCB 105-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 105-13C12 | 208263621 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | IDA | | | |
PCB 106 | PCB 106 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 106/118 | PCB 106/118 Congener | 0 |   | ug/L |   |   |   |   | Organics | PCBs | Congeners | | | |
PCB 107 | PCB 107 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 107/109 | PCB 107/109 Congener | 0 |   | pg/L |   |   |   |   | Organics | PCBs | | | | |
PCB 107/124 | PCB 107/124 Congener | 0 |   | pg/L | ug/Kg dw |   |   |   | Organics | PCBs | | | | |
PCB 108 | PCB 108 Congener | 70362400 |   | pg/sample | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 108/112 | PCB 108/112 Congener | 0 |   | pg/L |   |   |   |   | Organics | PCBs | | | | |
PCB 108/124 | PCB 108/124 Congener | 0 |   | pg/L | ng/g nr |   |   |   | | | | | | |
PCB 109 | PCB 109 Congener | 0 |   | pg/sample | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 110 | PCB 110 Congener | 38380039 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 110/115 | PCB 110/115 Congener | 0 |   | pg/L | ug/Kg ww |   |   |   | Organics | PCBs | | | | |
PCB 110/151 | PCB 110/151 Congener | 0 |   | ug/L |   |   |   |   | Organics | PCBs | Congeners | | | |
PCB 111 | PCB 111 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 111(Surrogate) | Surrogate: PCB 111 Congener | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | | | | |
PCB 111/115 | PCB 111/115 Congener | 0 |   | pg/L |   |   |   |   | Organics | PCBs | | | | |
PCB 111-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 111-13C12 | 235416292 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | IDA | | | |
PCB 112 | PCB 112 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 112(Surrogate) | Surrogate: PCB 112 Congener | 74472369 |   | ug/L | % recovery |   | % recovery | % recovery | Organics | PCBs | Congeners | | | |
PCB 113 | PCB 113 Congener | 68194100 |   | pg/sample | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 114 | PCB 114 Congener | 74472370 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 114 (TEQ ND=0) | PCB 114 (TEQ ND=0) | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 114 (TEQ ND=1/2 DL) | PCB 114 (TEQ ND=1/2 DL) | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 114 (TEQ ND=DL) | PCB 114 (TEQ ND=DL) | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 114(Surrogate) | Surrogate: PCB 114 Congener | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | | | | |
PCB 114-13C(surrogate) | Surrogate: PCB 114-13C Congener | 0 |   | % recovery |   |   |   |   | Organics | | | | | |
PCB 114-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 114-13C12 | 208263632 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | IDA | | | |
PCB 115 | PCB 115 Congener | 74472400 |   | pg/sample | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 116 | PCB 116 Congener | 18259100 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 117 | PCB 117 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 118 | PCB 118 Congener | 31508084 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 118 (TEQ ND=0) | PCB 118 (TEQ ND=0) | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 118 (TEQ ND=1/2 DL) | PCB 118 (TEQ ND=1/2 DL) | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 118 (TEQ ND=DL) | PCB 118 (TEQ ND=DL) | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 118(Surrogate) | Surrogate: PCB 118 Congener | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | | | | |
PCB 118-13C(Surrogate) | Surrogate: PCB 118-13C Congener | 0 |   | % recovery |   |   |   |   | Organics | PCBs | | | | |
PCB 118-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 118-13C12 | 104130407 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | IDA | | | |
PCB 119 | PCB 119 Congener | 56558179 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 120 | PCB 120 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 121 | PCB 121 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 122 | PCB 122 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 123 | PCB 123 Congener | 65510443 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 123 (TEQ ND=0) | PCB 123 (TEQ ND=0) | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 123 (TEQ ND=1/2 DL) | PCB 123 (TEQ ND=1/2 DL) | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 123 (TEQ ND=DL) | PCB 123 (TEQ ND=DL) | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 123(Surrogate) | Surrogate: PCB 123 Congener | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | | | | |
PCB 123-13C(Surrogate) | Surrogate: PCB 123-13C Congener | 0 |   | % recovery |   |   |   |   | Organics | PCBs | | | | |
PCB 123-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 123-13C12 | 208263643 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | IDA | | | |
PCB 124 | PCB 124 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 125 | PCB 125 Congener | 74472400 |   | pg/sample | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 126 | PCB 126 Congener | 57465288 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 126 (TEQ ND=0) | PCB 126 (TEQ ND=0) | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 126 (TEQ ND=1/2 DL) | PCB 126 (TEQ ND=1/2 DL) | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 126 (TEQ ND=DL) | PCB 126 (TEQ ND=DL) | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 126(Surrogate) | Surrogate: PCB 126 Congener | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | | | | |
PCB 126-13C(Surrogate) | Surrogate: PCB 126-13C Congener | 0 |   | % recovery |   |   |   |   | Organics | PCBs | | | | |
PCB 126-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 126-13C12 | 208263654 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | IDA | | | |
PCB 127 | PCB 127 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 127-13C(Surrogate) | Surrogate: PCB 127-13C Congener | 0 |   | % recovery |   |   |   |   | Organics | PCBs | | | | |
PCB 128 | PCB 128 Congener | 38380073 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 128/162 | PCB 128/162 Congener | 0 |   | ug/L |   |   |   |   | Organics | PCBs | Congeners | | | |
PCB 128/166 | PCB 128/166 | 0 |   | pg/L | ug/Kg ww |   |   |   | Organics | PCBs | | | | |
PCB 128/167 | PCB 128/167 Congener | 0 |   |   | ng/g dw |   |   |   | Organics | PCBs | Congeners | | | |
PCB 129 | PCB 129 Congener | 0 |   | pg/sample | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 129/138 | PCB 129/138 Congener | 0 |   | pg/L | ug/Kg ww |   |   |   | Organics | PCBs | | | | |
PCB 129/138/163 | PCB 129/138/163 Congener | 0 |   | pg/L | ng/g nr |   |   |   | | | | | | |
PCB 129/160 | PCB 129/160 Congener | 0 |   | pg/L |   |   |   |   | Organics | PCBs | | | | |
PCB 129/163 | PCB 129/163 Congener | 0 |   | pg/L |   |   |   |   | Organics | PCBs | | | | |
PCB 129/166 | PCB 129/166 Congener | 0 |   | pg/L |   |   |   |   | Organics | PCBs | | | | |
PCB 130 | PCB 130 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 131 | PCB 131 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 131/133 | PCB 131/133 | 0 |   | pg/L |   |   |   |   | Organics | | | | | |
PCB 132 | PCB 132 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 132/153 | PCB 132/153 | 0 |   | ug/L | ug/kg |   | ug/Kg ww | ug/Kg dw | | | | | | |
PCB 132/161 | PCB 132/161 Congener | 0 |   | ug/L |   |   |   |   | Organics | PCBs | Congeners | | | |
PCB 132/168 | PCB 132/168 Congener | 0 |   | ug/L | ug/g dw |   |   |   | Organics | PCBs | | | | |
PCB 133 | PCB 133 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 134 | PCB 134 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 134/143 | PCB 134/143 Congener | 0 |   | pg/L | ug/Kg dw |   |   |   | Organics | PCBs | | | | |
PCB 135 | PCB 135 Congener | 0 |   | pg/sample | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 135/151 | PCB 135/151 Congener | 0 |   | pg/L | ug/Kg ww |   |   |   | Organics | PCBs | | | | |
PCB 135/151/154 | PCB 135/151/154 Congener
PCB 135/151/154 | 0 |   | pg/L |   |   |   |   | | | | | | |
PCB 135/154 | PCB 135/154 Congener | 0 |   | pg/L |   |   |   |   | Organics | PCBs | | | | |
PCB 136 | PCB 136 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 137 | PCB 137 Congener | 35694065 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 138 | PCB 138 Congener | 35065282 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 138/158 | PCB 138/158 Congener | 0 |   | ug/L | ng/g dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 138/160 | PCB 138/160 | 0 |   |   | ug/Kg ww |   |   |   | Organics | PCBs | | | | |
PCB 138/163 | PCB 138/163 | 0 |   |   | ug/Kg ww |   |   |   | Organics | PCBs | | | | |
PCB 138/163/164 | PCB 138/163/164 Congener | 0 |   | ug/L |   |   |   |   | Organics | PCBs | Congeners | | | |
PCB 138-13C(Surrogate) | Surrogate: PCB 138-13C Congener | 0 |   | % recovery |   |   |   |   | Organics | PCBs | | | | |
PCB 138-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 138-13C12 | 208263665 |   | % recovery |   |   |   |   | Organics | PCBs | IDA | | | |
PCB 139 | PCB 139 Congener | 56030600 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 139/140 | PCB 139/140 Congener | 0 |   | pg/L | ug/Kg dw |   |   |   | Organics | PCBs | | | | |
PCB 139/149 | PCB 139/149 Congener | 0 |   | ug/L |   |   |   |   | Organics | PCBs | Congeners | | | |
PCB 140 | PCB 140 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 141 | PCB 141 Congener | 52712046 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 141-13C(Surrogate) | Surrogate: PCB 141-13C Congener | 0 |   | % recovery |   |   |   |   | Organics | PCBs | Congeners | | | |
PCB 141-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 141-13C12 | 0 |   | % recovery |   |   |   |   | Organics | PCBs | IDA | | | |
PCB 142 | PCB 142 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 143 | PCB 143 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 144 | PCB 144 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 145 | PCB 145 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 146 | PCB 146 Congener | 51908168 |   | pg/sample | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 146/165 | PCB 146/165 Congener | 0 |   | pg/L |   |   |   |   | Organics | PCBs | | | | |
PCB 147 | PCB 147 Congener | 68194100 |   | pg/sample | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 147/149 | PCB 147/149 Congener | 0 |   | pg/L | ug/Kg ww |   |   |   | Organics | PCBs | | | | |
PCB 148 | PCB 148 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 149 | PCB 149 Congener | 38380040 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 150 | PCB 150 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 151 | PCB 151 Congener | 52663635 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 151/154 | PCB 151/154 | 0 |   |   | ug/Kg ww |   |   |   | Organics | PCBs | | | | |
PCB 152 | PCB 152 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 153 | PCB 153 Congener | 35065271 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 153(Surrogate) | Surrogate: PCB 153 Congener | 35065271 |   | % recovery |   |   | % recovery | % recovery | Organics | PCBs | Congeners | | | |
PCB 153/168 | PCB 153/168 Congener | 0 |   | pg/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 153-13C(Surrogate) | Surrogate: PCB 153-13C Congener | 0 |   | % recovery |   |   |   |   | Organics | PCBs | | | | |
PCB 153-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 153-13C12 | 185376583 |   | % recovery |   |   |   |   | Organics | PCBs | IDA | | | |
PCB 154 | PCB 154 Congener | 60145200 |   | pg/sample | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 155 | PCB 155 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 155(Surrogate) | Surrogate: PCB 155 Congener | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | | | | |
PCB 155-13C(Surrogate) | Surrogate: PCB 155-13C Congener | 0 |   | % recovery |   |   |   |   | Organics | PCBs | | | | |
PCB 155-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 155-13C12 | 34432907 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | IDA | | | |
PCB 156 | PCB 156 Congener | 38380084 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 156 (TEQ ND=0) | PCB 156 (TEQ ND=0) | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 156 (TEQ ND=1/2 DL) | PCB 156 (TEQ ND=1/2 DL) | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 156 (TEQ ND=DL) | PCB 156 (TEQ ND=DL) | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 156(Surrogate) | Surrogate: PCB 156 Congener | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | | | | |
PCB 156/157 | PCB 156/157 Congener | 0 |   | pg/L | ug/Kg ww |   |   |   | Organics | PCBs | | | | |
PCB 156/157 (TEQ ND=0) | PCB 156/157 (TEQ ND=0) | 0 |   | pg/sample | ug/Kg dw |   |   |   | Organics | PCBs | | | | |
PCB 156/157 (TEQ ND=1/2 DL) | PCB 156/157 (TEQ ND=1/2 DL) | 0 |   | pg/sample | ug/Kg dw |   |   |   | Organics | PCBs | | | | |
PCB 156/157 (TEQ ND=DL) | PCB 156/157 (TEQ ND=DL) | 0 |   | pg/sample | ug/Kg dw |   |   |   | Organics | PCBs | | | | |
PCB 156/157(Surrogate) | Surrogate: PCB 156/157 | 0 |   | % recovery | % recovery |   |   |   | Organics | PCBs | | | | |
PCB 156-13C(Surrogate) | Surrogate: PCB 156-13C Congener | 0 |   | % recovery |   |   |   |   | Organics | PCBs | | | | |
PCB 156-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 156-13C12 | 208263687 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | IDA | | | |
PCB 157 | PCB 157 Congener | 69782907 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 157 (TEQ ND=0) | PCB 157 (TEQ ND=0) | 0 |   | pg/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 157 (TEQ ND=1/2 DL) | PCB 157 (TEQ ND=1/2 DL) | 0 |   | pg/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 157 (TEQ ND=DL) | PCB 157 (TEQ ND=DL) | 0 |   | pg/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 157(Surrogate) | Surrogate: PCB 157 Congener | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | | | | |
PCB 157-13C(surrogate) | Surrogate: PCB 157-13C Congener | 0 |   | % recovery |   |   |   |   | Organics | | | | | |
PCB 157-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 157-13C12 | 235416305 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | IDA | | | |
PCB 158 | PCB 158 Congener | 74472427 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 158/160 | PCB 158/160 Congener | 0 |   | ug/L |   |   |   |   | Organics | PCBs | Congeners | | | |
PCB 159 | PCB 159 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 159(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 159 | 0 |   | % recovery |   |   |   |   | Organics | PCBs | IDA | | | |
PCB 159(Surrogate) | Surrogate: PCB 159 Congener | 39635353 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | | | | |
PCB 159-13C(Surrogate) | Surrogate: PCB 159-13C Congener | 0 |   | % recovery |   |   |   |   | Organics | PCBs | | | | |
PCB 159-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 159-13C12 | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | IDA | | | |
PCB 160 | PCB 160 Congener | 41411600 |   | pg/sample | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 161 | PCB 161 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 162 | PCB 162 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 163 | PCB 163 Congener | 74472400 |   | pg/sample | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 164 | PCB 164 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 165 | PCB 165 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 166 | PCB 166 Congener | 41411600 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 167 | PCB 167 Congener | 52663726 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 167 (TEQ ND=0) | PCB 167 (TEQ ND=0) | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 167 (TEQ ND=1/2 DL) | PCB 167 (TEQ ND=1/2 DL) | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 167 (TEQ ND=DL) | PCB 167 (TEQ ND=DL) | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 167(Surrogate) | Surrogate: PCB 167 Congener | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | | | | |
PCB 167-13C(surrogate) | Surrogate: PCB 167-13C Congener | 0 |   | % recovery |   |   |   |   | Organics | | | | | |
PCB 167-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 167-13C12 | 208263698 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | IDA | | | |
PCB 168 | PCB 168 Congener | 59291655 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 169 | PCB 169 Congener | 32774166 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 169 (TEQ ND=0) | PCB 169 (TEQ ND=0) | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 169 (TEQ ND=1/2 DL) | PCB 169 (TEQ ND=1/2 DL) | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 169 (TEQ ND=DL) | PCB 169 (TEQ ND=DL) | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 169(Surrogate) | Surrogate: PCB 169 Congener | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | | | | |
PCB 169-13C(Surrogate) | Surrogate: PCB 169-13C Congener | 0 |   | % recovery |   |   |   |   | Organics | PCBs | | | | |
PCB 169-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 169-13C12 | 208263701 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | IDA | | | |
PCB 170 | PCB 170 Congener | 35065306 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 170(Surrogate) | Surrogate: PCB 170 Congener | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | | | | |
PCB 170-13C(Surrogate) | Surrogate: PCB 170-13C Congener | 0 |   | % recovery |   |   |   |   | Organics | PCBs | | | | |
PCB 170-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 170-13C12 | 160901804 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | IDA | | | |
PCB 171 | PCB 171 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 171/173 | PCB 171/173 Congener | 0 |   | pg/L | ug/Kg dw |   |   |   | Organics | PCBs | | | | |
PCB 172 | PCB 172 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 173 | PCB 173 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 174 | PCB 174 Congener | 38411255 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 175 | PCB 175 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 176 | PCB 176 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 177 | PCB 177 Congener | 52663704 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 178 | PCB 178 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 178(Surrogate) | Surrogate: PCB 178 Congener | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | | | | |
PCB 178-13C(Surrogate) | Surrogate: PCB 178-13C Congener | 0 |   | % recovery |   |   |   |   | Organics | PCBs | | | | |
PCB 178-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 178-13C12 | 232919674 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | IDA | | | |
PCB 179 | PCB 179 Congener | 52663646 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 180 | PCB 180 Congener | 35065293 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 180(Surrogate) | Surrogate: PCB 180 Congener | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | | | | |
PCB 180/193 | PCB 180/193 Congener | 0 |   | pg/L | ug/Kg ww |   |   |   | Organics | PCBs | | | | |
PCB 180-13C(Surrogate) | Surrogate: PCB 180-13C Congener | 0 |   | % recovery |   |   |   |   | Organics | PCBs | | | | |
PCB 180-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 180-13C12 | 160901826 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | IDA | | | |
PCB 181 | PCB 181 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 182 | PCB 182 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 182/187 | PCB 182/187 Congener | 0 |   | ug/L |   |   |   |   | Organics | PCBs | Congeners | | | |
PCB 183 | PCB 183 Congener | 52663691 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 183/185 | PCB 183/185 Congener | 0 |   | pg/L | ug/Kg ww |   |   |   | Organics | PCBs | | | | |
PCB 184 | PCB 174 Congener | 0 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 185 | PCB 185 Congener | 0 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 186 | PCB 176 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 187 | PCB 187 Congener | 52663680 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 188 | PCB 188 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 188(Surrogate) | Surrogate: PCB 188 Congener | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | | | | |
PCB 188-13C(Surrogate) | Surrogate: PCB 188-13C Congener | 0 |   | % recovery |   |   |   |   | Organics | PCBs | | | | |
PCB 188-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 188-13C12 | 234432918 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | IDA | | | |
PCB 189 | PCB 189 Congener | 39635319 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 189 (TEQ ND=0) | PCB 189 (TEQ ND=0) | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 189 (TEQ ND=1/2 DL) | PCB 189 (TEQ ND=1/2 DL) | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 189 (TEQ ND=DL) | PCB 189 (TEQ ND=DL) | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 189(Surrogate) | Surrogate: PCB 189 Congener | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | | | | |
PCB 189-13C(surrogate) | Surrogate: PCB 189-13C Congener | 0 |   | % recovery |   |   |   |   | Organics | | | | | |
PCB 189-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 189-13C12 | 208263734 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | IDA | | | |
PCB 190 | PCB 190 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 191 | PCB 191 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 192 | PCB 192 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 193 | PCB 193 Congener | 0 |   | pg/sample | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 194 | PCB 194 Congener | 35694087 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 194-13C(Surrogate) | Surrogate: PCB 194-13C Congener | 0 |   | % recovery |   |   |   |   | Organics | PCBs | | | | |
PCB 194-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 194-13C12 | 208263745 |   | % recovery |   |   |   |   | Organics | PCBs | IDA | | | |
PCB 195 | PCB 195 Congener | 52663782 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 196 | PCB 196 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 196/203 | PCB 196/203 Congener | 0 |   | ug/L |   |   |   |   | Organics | PCBs | | | | |
PCB 197 | PCB 197 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 197/200 | PCB 197/200 Congener | 0 |   | pg/L | ug/Kg dw |   |   |   | Organics | PCBs | | | | |
PCB 198 | PCB 198 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 198(Surrogate) | Surrogate: PCB 198 Congener | 68194172 |   | ug/L | % recovery |   | % recovery | % recovery | Organics | PCBs | Congeners | | | |
PCB 198/199 | PCB 198/199 Congener | 0 |   | pg/L | ug/Kg dw |   | ng/g ww | ng/g dw | Organics | PCBs | Congeners | | | |
PCB 199 | PCB 199 Congener | 0 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 199/200 | PCB 199/200 Congener | 0 |   | ug/L | ug/g dw |   |   |   | | | | | | |
PCB 200 | PCB 200 Congener | 52663737 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 201 | PCB 201 Congener | 40186718 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 202 | PCB 202 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 202(Surrogate) | Surrogate: PCB 202 Congener | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | | | | |
PCB 202-13C(Surrogate) | Surrogate: PCB 202-13C Congener | 0 |   | % recovery |   |   |   |   | Organics | PCBs | | | | |
PCB 202-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 202-13C12 | 105600268 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | IDA | | | |
PCB 203 | PCB 203 Congener | 52663760 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 204 | PCB 204 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 205 | PCB 205 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 205(Surrogate) | Surrogate: PCB 205 Congener | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | | | | |
PCB 205-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 205-13C12 | 234446641 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | IDA | | | |
PCB 206 | PCB 206 Congener | 40186729 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 206(Surrogate) | Surrogate: PCB 206 Congener | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | | | | |
PCB 206-13C(surrogate) | Surrogate: PCB 206-13C Congener | 0 |   | % recovery |   |   |   |   | Organics | | | | | |
PCB 206-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 206-13C12 | 208263756 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | IDA | | | |
PCB 207 | PCB 207 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 207(Surrogate) | Surrogate: PCB 207 Congener | 52663771 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | Congeners | | | |
PCB 208 | PCB 208 Congener | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB 208(Surrogate) | Surrogate: PCB 208 Congener | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | | | | |
PCB 208-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 208-13C12 | 234432929 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | IDA | | | |
PCB 209 | PCB 209 Congener (Decachlorobiphenyl) (DCB) | 2051243 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 209(Surrogate) | Surrogate: PCB 209 Congener (Decachlorobiphenyl) (DCB) | 2051243 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | Congeners | | | |
PCB 209(Surrogate)DB-608 | Surrogate: PCB 209 run on DB-608 (Decachlorobiphenyl) (DCB) | 2051243 |   | % recovery | % recovery |   |   |   | Organics | PCBs | | | | |
PCB 209(Surrogate)HP-5 | Surrogate: PCB 209 run on HP-5 (Decachlorobiphenyl) (DCB) | 2051243 |   | % recovery | % recovery |   |   |   | Organics | PCBs | | | | |
PCB 209-13C(surrogate) | Surrogate: PCB 209-13C Congener | 0 |   | % recovery |   |   |   |   | Organics | | | | | |
PCB 209-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 209-13C12 | 105600279 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | PCBs | IDA | | | |
PCB 209-L(Surrogate) | Surrogate: PCB 209 Congener (Decachlorobiphenyl) (DCB)-Labeled not defined | 0 |   | ug/L |   |   |   |   | Organics | | | | | |
PCB AROCLOR 1016 | PCB Aroclor 1016 | 12674112 |   | ug/L | ug/Kg ww |   | ng/g ww | ng/g dw | Organics | PCBs | Aroclors | | | |
PCB AROCLOR 1221 | PCB Aroclor 1221 | 11104282 |   | ug/L | ug/Kg ww |   | ng/g ww | ng/g dw | Organics | PCBs | Aroclors | | | |
PCB AROCLOR 1232 | PCB Aroclor 1232 | 11141165 |   | ug/L | ug/Kg ww |   | ng/g ww | ng/g dw | Organics | PCBs | Aroclors | | | |
PCB AROCLOR 1242 | PCB Aroclor 1242 | 53469219 |   | ug/L | ug/Kg ww |   | ng/g ww | ng/g dw | Organics | PCBs | Aroclors | | | |
PCB AROCLOR 1248 | PCB Aroclor 1248 | 12672296 |   | ug/L | ug/Kg ww |   | ng/g ww | ng/g dw | Organics | PCBs | Aroclors | | | |
PCB AROCLOR 1254 | PCB Aroclor 1254 | 11097691 |   | ug/L | ug/Kg ww |   | ng/g ww | ng/g dw | Organics | PCBs | Aroclors | | | |
PCB AROCLOR 1260 | PCB Aroclor 1260 | 11096825 |   | ug/L | ug/Kg ww |   | ng/g ww | ng/g dw | Organics | PCBs | Aroclors | | | |
PCB TOTAL (TEQ ND=0) | PCB TOTAL (TEQ ND=0) | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB TOTAL (TEQ ND=1/2 DL) | PCB TOTAL (TEQ ND=1/2 DL) | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCB TOTAL (TEQ ND=DL) | PCB TOTAL (TEQ ND=DL) | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
PCT AROCLOR 5432 | Polychlorinated Terphenyl AROCLOR 5432 | 0 |   |   | ug/Kg dw |   |   |   | | | | | | |
PCT AROCLOR 5442 | Polychlorinated Terphenyl AROCLOR 5442 | 0 |   |   | ug/Kg dw |   |   |   | | | | | | |
PCT AROCLOR 5460 | Polychlorinated Terphenyl AROCLOR 5460 | 0 |   |   | ug/Kg dw |   |   |   | | | | | | |
PCT_DR | Percent dry channel | 0 | % |   |   |   |   |   | Bioassessment | | | | | |
PCT_FAST | Percent fast-water habitat of reach | 0 | % |   |   |   |   |   | Bioassessment | | | | | |
PCT_POOL | Percent pool habitat of reach | 0 | % |   |   |   |   |   | Bioassessment | | | | | |
PCT_RC | Percent concrete or asphalt streambed substrate physical-habitat metric | 0 | % |   |   |   |   |   | Bioassessment | | | | | |
PCT_SAFN | Percent sands and fines streambed substrate physical-habitat metric | 0 | % |   |   |   |   |   | Bioassessment | | | | | |
PCT_SLOW | Percent slow-water habitat of reach | 0 | % |   |   |   |   |   | Bioassessment | | | | | |
Pebble | Pebble | 0 |   |   | % |   |   |   | Inorganics | Conventionals | GrainSize | | | |
Pebulate | Pebulate (PEBC) | 1114712 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Pest-Carbamates | | | |
PeCDD, 1,2,3,7,8- | 1,2,3,7,8-Pentachlorodibenzo-p-dioxin (PeCDD) | 40321764 |   | ug/L |   |   |   |   | Organics | PCDDs/PCDFs | Dioxins/Dibenzofurans | | | |
PECDD, 1,2,3,7,8- (TEQ ND=0) | 1,2,3,7,8-PECDD (TEQ ND=0) | 0 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
PECDD, 1,2,3,7,8- (TEQ ND=1/2 DL) | 1,2,3,7,8-PECDD (TEQ ND=1/2 DL) | 0 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
PeCDD, 1,2,3,7,8-(Surrogate) | Surrogate: 1,2,3,7,8-Pentachlorodibenzo-p-dioxin (PeCDD) | 40321764 |   | % recovery |   |   |   |   | Organics | PCDDs/PCDFs | Dioxins/Dibenzofurans | | | |
PeCDD-13C, 1,2,3,7,8-(Surrogate) | Surrogate: 1,2,3,7,8-Pentachlorodibenzo-p-dioxin-13C (PeCDD) | 109719791 |   | % recovery |   |   |   |   | Organics | PCDDs/PCDFs | Dioxins/Dibenzofurans | | | |
PeCDD-13C12, 1,2,3,7,8-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3,7,8-PeCDD-13C12 | 109719791 |   | % recovery |   |   |   |   | Organics | Dioxins/Dibenzofurans | IDA | | | |
PeCDF, 1,2,3,7,8- | 1,2,3,7,8-Pentachlorodibenzofuran (PeCDF) | 57117416 |   | pg/L |   |   |   |   | Organics | PCDDs/PCDFs | Dioxins/Dibenzofurans | | | |
PECDF, 1,2,3,7,8- (TEQ ND=0) | 1,2,3,7,8-PECDF (TEQ ND=0) | 0 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
PECDF, 1,2,3,7,8- (TEQ ND=1/2 DL) | 1,2,3,7,8-PECDF (TEQ ND=1/2 DL) | 0 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
PeCDF, 1,2,3,7,8-(Surrogate) | Surrogate: 1,2,3,7,8-Pentachlorodibenzofuran (PeCDF) | 57117416 |   | % recovery |   |   |   |   | Organics | PCDDs/PCDFs | Dioxins/Dibenzofurans | | | |
PeCDF, 2,3,4,7,8- | 2,3,4,7,8-Pentachlorodibenzofuran (PeCDF) | 57117314 |   | pg/L |   |   |   |   | Organics | PCDDs/PCDFs | Dioxins/Dibenzofurans | | | |
PECDF, 2,3,4,7,8- (TEQ ND=0) | 2,3,4,7,8-PECDF (TEQ ND=0) | 0 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
PECDF, 2,3,4,7,8- (TEQ ND=1/2 DL) | 2,3,4,7,8-PECDF (TEQ ND=1/2 DL) | 0 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
PeCDF, 2,3,4,7,8-(Surrogate) | Surrogate: 2,3,4,7,8-Pentachlorodibenzofuran (PeCDF) | 57117314 |   | % recovery |   |   |   |   | Organics | PCDDs/PCDFs | Dioxins/Dibenzofurans | | | |
PeCDF-13C12, 1,2,3,7,8-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3,7,8-PeCDF-13C12 | 109719779 |   | % recovery |   |   |   |   | Organics | Dioxins/Dibenzofurans | IDA | | | |
PeCDF-13C12, 2,3,4,7,8-(IsoDilAnalogue) | Isotope Dilution Analogue: 2,3,4,7,8-PeCDF-13C12 | 116843028 |   | % recovery |   |   |   |   | Organics | Dioxins/Dibenzofurans | IDA | | | |
Pen/Marker | Pen/Marker | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Toxic | | |
Pendimethalin | Pendimethalin (Prowl) | 40487421 |   | ug/L | ug/Kg dw |   |   |   | Organics | Pesticides | Herbicides | | | |
Penicillin G | Penicillin G | 0 |   |   |   |   | ng/g ww | ng/g dw | Organics | | | | | |
Penicillin V | Penicillin V | 0 |   |   |   |   | ng/g ww | ng/g dw | Organics | | | | | |
Penoxsulam | Penoxsulam | 219714962 |   | ug/L |   |   |   |   | Organics | Pesticides | Herbicides | | | |
Pentachloroanisole | Pentachloroanisole | 1825214 |   | ng/L |   |   |   |   | Organics | Pesticides | | | | |
Pentachlorobenzene | Pentachlorobenzene | 0 |   |   | ug/Kg dw |   |   |   | | | | | | |
Pentachlorobenzene-13C6(IsoDilAnalogue) | Isotope Dilution Analogue: Pentachlorobenzene-13C6 | 2483735540 |   |   | % recovery |   | % recovery | % recovery | | | | | | |
Pentachloronitrobenzene | Pentachloronitrobenzene (PCNB) | 82688 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-OCHs | Algaecides | Fungicides | Nematocides |
Pentachlorophenol | Pentachlorophenol | 87865 |   | ug/L | mg/Kg dw |   |   |   | Organics | SVOCs | Phenols | Chlorinated Phenols | Insecticides | Fungicides |
Perchlorate | Perchlorate | 14797730 |   | ug/L | ug/kg |   |   |   | Inorganics | Conventionals | | | | |
Perfluoro(2-ethoxyethane)sulfonic acid | Perfluoro(2-ethoxyethane)sulfonic acid (PFEESA) | 113507827 |   | ng/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | PFAS | | | | |
Perfluoro-2-Propoxypropanoic Acid | Perfluoro-2-Propoxypropanoic Acid | 13252136 |   | ng/L | ng/g dw |   | ng/g ww | ng/g dw | | | | | | |
Perfluoro-2-Propoxypropanoic Acid-13C3(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluoro-2-Propoxypropanoic Acid-13C3 (HFPO-DA) | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | | IDA | | | |
Perfluoro-2-Propoxypropanoic Acid-13C3(Surrogate) | Surrogate: Perfluoro-2-Propoxypropanoic Acid-13C3 (HFPO-DA) | 0 |   |   |   |   | % recovery | % recovery | Organics | PFAS | | | | |
Perfluoro-3,6-dioxaheptanoate | Perfluoro-3,6-dioxaheptanoate (Nonafluoro-3,6-dioxaheptanoic acid) (NFDHA) | 151772586 |   | ng/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | PFAS | | | | |
Perfluoro-3-methoxypropanoate | Perfluoro-3-methoxypropanoate (Perfluoro-3-methoxypropanoic acid) (PFMPA) | 377731 |   | ng/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | PFAS | | | | |
Perfluoro-4-methoxybutanoate | Perfluoro-4-methoxybutanoate (Perfluoro-4-methoxybutanoic acid) (PFMBA) | 863090895 |   | ng/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | PFAS | | | | |
Perfluorobutanesulfonate | Perfluorobutanesulfonate | 45187153 |   | ng/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | Perflouronate | | | | |
Perfluorobutanesulfonate-13C3(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorobutanesulfonate-13C3 (PFBS) | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | | IDA | | | |
Perfluorobutanesulfonate-13C3(Surrogate) | Surrogate: Perfluorobutanesulfonate-13C3 (PFBS) | 0 |   |   |   |   | % recovery | % recovery | Organics | PFAS | | | | |
Perfluorobutanoate | Perfluorobutanoic Acid (PFBTA), (PFBA) | 375224 |   | ng/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | | | | | |
Perfluorobutanoate(Surrogate) | Surrogate: Perfluorobutanoic Acid (PFBTA), (PFBA) | 375224 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | | | | | |
Perfluorobutanoate-13C4(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorobutanoate-13C4 (PFBTA) (PFBA) | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | | IDA | | | |
Perfluorodecanesulfonate | Perfluorodecanesulfonate | 126105348 |   | ng/L | ng/g dw |   | ng/g ww | ng/g dw | | | | | | |
Perfluorodecanoate | Perfluorodecanoic Acid (PFDA) | 335762 |   | ng/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | | | | | |
Perfluorodecanoate(Surrogate) | Surrogate: Perfluorodecanoic Acid (PFDA) | 335762 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | | | | | |
Perfluorodecanoate-13C6(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorodecanoate-13C6 (PFDA) | 0 |   | ng/L | % recovery |   | % recovery | % recovery | Organics | | IDA | | | |
Perfluorododecanesulfonate | Perfluorododecanesulfonate | 0 |   | ng/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | PFAS | | | | |
Perfluorododecanoate | Perfluorododecanoic Acid (PFDoA) | 307551 |   | ng/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | | | | | |
Perfluorododecanoate(Surrogate) | Surrogate: Perfluorododecanoic Acid (PFDoA) | 307551 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | | | | | |
Perfluorododecanoate-13C2(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorododecanoate-13C2 (PFDoA) | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | | IDA | | | |
Perfluoroheptanesulfonate | Perfluoroheptanesulfonate | 375928 |   | ng/L | ng/g dw |   | ng/g ww | ng/g dw | | | | | | |
Perfluoroheptanoate | Perfluoroheptanoic Acid (PFHpA) | 375859 |   | ng/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | | | | | |
Perfluoroheptanoate-13C4(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluoroheptanoate-13C4 (PFHpA) | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | | IDA | | | |
Perfluoroheptanoate-13C4(Surrogate) | Surrogate: Perfluoroheptanoate-13C4 (PFHpA) | 0 |   |   |   |   | % recovery | % recovery | Organics | PFAS | | | | |
Perfluorohexanesulfonate | Perfluorohexanesulfonate | 108427538 |   | ng/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | Perflouronate | | | | |
Perfluorohexanesulfonate-13C3(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorohexanesulfonate-13C3 (PFHxS) | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | | IDA | | | |
Perfluorohexanesulfonate-13C3(Surrogate) | Surrogate: Perfluorohexanesulfonate-13C3 (PFHxS) | 0 |   |   |   |   | % recovery | % recovery | Organics | PFAS | | | | |
Perfluorohexanesulfonate-18O2(Surrogate) | Surrogate: Perfluorohexanesulfonate-18O2 | 0 |   | % recovery |   |   |   |   | Organics | | | | | |
Perfluorohexanoate | Perfluorohexanoic Acid (PFHxA) | 307244 |   | ng/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | | | | | |
Perfluorohexanoate(Surrogate) | Surrogate: Perfluorohexanoic Acid (PFHxA) | 307244 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | | | | | |
Perfluorohexanoate-13C5(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorohexanoate-13C5 (PFHxA) | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | | IDA | | | |
Perfluorononanesulfonate | Perfluorononanesulfonate | 0 |   | ng/L | ng/g dw |   | ng/g ww | ng/g dw | | | | | | |
Perfluorononanoate | Perfluorononanoic Acid (PFNA) | 375951 |   | ng/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | | | | | |
Perfluorononanoate(Surrogate) | Surrogate: Perfluorononanoic Acid (PFNA) | 375951 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | | | | | |
Perfluorononanoate-13C9(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorononanoate-13C9 (PFNA) | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | | IDA | | | |
Perfluorooctanesulfonamide | Perfluorooctanesulfonamide | 0 |   | ng/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | Perflouronate | | | | |
Perfluorooctanesulfonamide-13C8(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorooctanesulfonamide-13C8 (PFOSA) | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | | IDA | | | |
Perfluorooctanesulfonamide-13C8(Surrogate) | Surrogate: Perfluorooctanesulfonamide-13C8 | 0 |   |   |   |   | % recovery | % recovery | Organics | PFAS | | | | |
Perfluorooctanesulfonate | Perfluorooctanesulfonate | 45298906 |   | ng/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | Perflouronate | | | | |
Perfluorooctanesulfonate 080(Surrogate) | Surrogate: Perfluorooctanesulfonate 080 (PFOS) | 45298906 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | | | | | |
Perfluorooctanesulfonate-13C8(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorooctanesulfonate-13C8 (PFOS) | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | | IDA | | | |
Perfluorooctanesulfonic acid (PFOS) | Perfluorooctanesulfonic acid (PFOS) | 0 |   | ng/L |   |   |   |   | Organics | PFAS | | | | |
Perfluorooctanesulfonic acid-13C8(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorooctanesulfonic acid-13C8 (PFOS) | 0 |   | % recovery |   |   |   |   | Organics | | IDA | | | |
Perfluorooctanoate | Perfluorooctanoic Acid (PFOA) | 335671 |   | ng/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | | | | | |
Perfluorooctanoate(Surrogate) | Surrogate: Perfluorooctanoic Acid (PFOA) | 335671 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | | | | | |
Perfluorooctanoate-13C8(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorooctanoate-13C8 (PFOA) | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | | IDA | | | |
Perfluorooctanoate-13C8(Surrogate) | Surrogate: Perfluorooctanoate-13C8 | 0 |   |   |   |   | % recovery | % recovery | Organics | Perflouronate | | | | |
Perfluorooctanoic acid (PFOA) | Perfluorooctanoic acid (PFOA) | 0 |   | ng/L |   |   |   |   | Organics | PFAS | | | | |
Perfluorooctanoic acid-13C2(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorooctanoic acid-13C2 (PFOA) | 0 |   | % recovery |   |   |   |   | Organics | | IDA | | | |
Perfluoropentanesulfonate | Perfluoropentanesulfonate | 0 |   | ng/L | ng/g dw |   | ng/g ww | ng/g dw | | | | | | |
Perfluoropentanoate | Perfluoropentanoic Acid (PFPeA) | 2706903 |   | ng/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | | | | | |
Perfluoropentanoate-13C5(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluoropentanoate-13C5 (PFPA) (PFPeA) | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | | IDA | | | |
Perfluoropentanoate-13C5(Surrogate) | Surrogate: Perfluoropentanoate-13C5 (PFPA) (PFPeA) | 0 |   |   |   |   | % recovery | % recovery | Organics | PFAS | | | | |
Perfluorotetradecanoate | Perfluorotetradecanoate | 376067 |   | ng/L | ng/g dw |   | ng/g ww | ng/g dw | | | | | | |
Perfluorotetradecanoate-13C2(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorotetradecanoate-13C2 (PFTeDA) (PFTA) | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | | IDA | | | |
Perfluorotetradecanoate-13C2(Surrogate) | Surrogate: Perfluorotetradecanoate-13C2 (PFTeDA) (PFTA) | 0 |   |   |   |   | % recovery | % recovery | Organics | PFAS | | | | |
Perfluorotridecanoate | Perfluorotridecanoate | 72629948 |   | ng/L | ng/g dw |   | ng/g ww | ng/g dw | | | | | | |
Perfluoroundecanoate | Perfluoroundecanoic Acid (PFUnA) | 2058948 |   | ng/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | | | | | |
Perfluoroundecanoate-13C7(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluoroundecanoate-13C7 (PFUnDA) (PFUdA) | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | | IDA | | | |
Perfluoroundecanoate-13C7(Surrogate) | Surrogate: Perfluoroundecanoate-13C7 (PFUnDA) (PFUdA) | 0 |   |   |   |   | % recovery | % recovery | Organics | PFAS | | | | |
Permethrin, cis- | cis-Permethrin, formerly peak 1 | 54774457 |   | ug/L | ug/Kg dw |   |   |   | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | |
Permethrin, cis-(Surrogate) | Surrogate: cis-Permethrin | 0 |   | % recovery |   |   |   |   | Organics | Pesticides | Pyrethroids | Insecticides | | |
Permethrin, Total | Total Permethrin, sum peaks cis and trans (formerly 1 & 2) | 52645531 |   | ug/L | ug/Kg dw |   |   |   | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | |
Permethrin, trans- | trans-Permethrin formerly peak 2 | 51877748 |   | ug/L | ug/Kg dw |   |   |   | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | |
Permethrin-13C6, cis-(Surrogate) | Surrogate: cis-Permethrin-13C6 | 0 |   | ng/L | % recovery |   |   |   | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | |
Perthane | Perthane | 72560 |   | ug/L | ug/Kg dw |   | ng/g ww | ng/g dw | Organics | Pesticides | Pest-OCHs | | | |
Perylene | Perylene | 198550 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | HMW_PAH | | |
Perylene-d12(IsoDilAnalogue) | Isotope Dilution Analogue: Perylene-d12 | 1520963 |   | % recovery |   |   |   |   | Organics | PAHs | IDA | | | |
Perylene-d12(Surrogate) | Surrogate: Perylene-d12 | 1520963 |   | ng/L | % recovery |   | ng/g ww | ng/g dw | Organics | PAHs | SVOCs | HMW_PAH | | |
pH | pH | 0 |   | none | none |   |   |   | WaterQualityMeasurements | ToxTreatment | | | | |
Phenanthrene | Phenanthrene | 85018 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | LMW_PAH | Endocrine Disruptors | |
Phenanthrene/Anthracene, C1- | C1-Phenanthrene/Anthracene | 0 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | LMW_PAH | | |
Phenanthrene/Anthracene, C2- | C2-Phenanthrene/Anthracene | 0 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | LMW_PAH | | |
Phenanthrene/Anthracene, C3- | C3-Phenanthrene/Anthracene | 0 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | LMW_PAH | | |
Phenanthrene/Anthracene, C4- | C4-Phenanthrene/Anthracene | 0 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | LMW_PAH | | |
Phenanthrene-d10(IsoDilAnalogue) | Isotope Dilution Analogue: Phenanthrene-d10 | 1517222 |   | % recovery |   |   |   |   | Organics | PAHs | IDA | | | |
Phenanthrene-d10(Surrogate) | Surrogate: Phenanthrene-d10 | 1517222 |   | % recovery | % recovery |   | ng/g ww | ng/g dw | Organics | PAHs | SVOCs | LMW_PAH | Endocrine Disruptors | |
Phenol | Phenol | 108952 |   | ug/L | ug/kg |   |   |   | Organics | SVOCs | Phenols | non-Chlorinated Phenols | | |
Phenol-d5(Surrogate) | Surrogate: Phenol-d5 | 0 |   | ug/L |   |   |   |   | Organics | SVOCs | | | | |
Phenol-d6(Surrogate) | Surrogate: Phenol-d6 | 13127883 |   | ug/L |   |   |   |   | Organics | SVOCs | Phenols | non-Chlorinated Phenols | | |
Phenolics, Total | Total Phenolics, classification of phenols | 0 |   | ug/L |   |   |   |   | Organics | PPCPs | | | | |
Phenothrin | Phenothrin | 26002802 |   | ug/L | ug/Kg dw |   |   |   | Organics | PPCPs | | | | |
Phenytoin | Phenytoin | 57410 |   | ng/L |   |   |   |   | | | | | | |
Pheophytin a | Pheophytin a | 603178 |   | ug/L |   |   |   |   | Inorganics | Conventionals | Benthic | | | |
Phone | Phone | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Toxic | | |
Phorate | Phorate | 298022 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Pest-OPs | Insecticides | Nematocides | |
Phosalone | Phosalone | 2310170 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-OPs | Insecticides | | |
Phosmet | Phosmet | 732116 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Pest-OPs | Insecticides | | |
Phosphamidon | Phosphamidon | 13171216 |   | ug/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | Pesticides | Pest-OPs | Insecticides | | |
Phosphate as P | Phosphate as P | 14265442 |   | mg/L |   |   |   |   | Inorganics | Conventionals | Nutrients | WaterQualityMeasurements | | |
Phosphorus as P | Phosphorus as P | 7723140 |   | ug/L | ug/g dw |   |   |   | Inorganics | Conventionals | Nutrients | | | |
Picloram | Picloram | 1918021 |   | ug/L |   |   |   |   | Organics | Herbicides | | | | |
Picoxystrobin | Picoxystrobin | 117428225 |   | ng/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
PictureCode | Picture code idenifier | 0 | none |   |   |   |   |   | FieldObservations | Habitat | | | | |
Pipe, PVC | Pipe, PVC | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Household | | |
Piperonyl Butoxide | Piperonyl Butoxide | 51036 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Pest-Pyrethroids | Insecticides | | |
Pipes, Drains | Pipes, Drains | 0 | none |   |   |   |   |   | Habitat | | | | | |
Pirimiphos Methyl | Pirimiphos Methyl | 29232937 |   | ug/L |   |   |   |   | Organics | Pesticides | Insecticides | | | |
Plastic | Plastic using Trash Protocol | 0 | pieces |   |   |   |   |   | Trash | | | | | |
Plastic MicroDebris, > 4.75 mm | Plastic MicroDebris, > 4.75 mm | 0 | pieces |   |   |   |   |   | Debris | Plastics | | | | |
Plastic MicroDebris, 0.355 mm | Plastic MicroDebris, 0.355 mm | 0 | pieces |   |   |   |   |   | Debris | Plastics | | | | |
Plastic MicroDebris, 0.500 mm | Plastic MicroDebris, 0.500 mm | 0 | pieces |   |   |   |   |   | Debris | Plastics | | | | |
Plastic MicroDebris, 1.0 mm | Plastic MicroDebris, 1.0 mm | 0 | pieces |   |   |   |   |   | Debris | Plastics | | | | |
Plastic MicroDebris, 2.0 mm | Plastic MicroDebris, 2.0 mm | 0 | pieces |   |   |   |   |   | Debris | Plastics | | | | |
Plastic MicroDebris, 4.75 mm | Plastic MicroDebris, 4.75 mm | 0 | pieces |   |   |   |   |   | Debris | Plastics | | | | |
Plastic MicroDebris, Black | Plastic MicroDebris, Black | 0 | pieces |   |   |   |   |   | Debris | Plastics | | | | |
Plastic MicroDebris, Blue | Plastic MicroDebris, Blue | 0 | pieces |   |   |   |   |   | Debris | Plastics | | | | |
Plastic MicroDebris, Clear | Plastic MicroDebris, Clear | 0 | pieces |   |   |   |   |   | Debris | Plastics | | | | |
Plastic MicroDebris, Green | Plastic MicroDebris, Green | 0 | pieces |   |   |   |   |   | Debris | Plastics | | | | |
Plastic MicroDebris, Grey | Plastic MicroDebris, Grey | 0 | pieces |   |   |   |   |   | Debris | Plastics | | | | |
Plastic MicroDebris, Orange | Plastic MicroDebris, Orange | 0 | pieces |   |   |   |   |   | Debris | Plastics | | | | |
Plastic MicroDebris, Peach | Plastic MicroDebris, Peach | 0 | pieces |   |   |   |   |   | Debris | Plastics | | | | |
Plastic MicroDebris, Pink | Plastic MicroDebris, Pink | 0 | pieces |   |   |   |   |   | Debris | Plastics | | | | |
Plastic MicroDebris, Red | Plastic MicroDebris, Red | 0 | pieces |   |   |   |   |   | Debris | Plastics | | | | |
Plastic MicroDebris, Tan | Plastic MicroDebris, Tan | 0 | pieces |   |   |   |   |   | Debris | Plastics | | | | |
Plastic MicroDebris, White | Plastic MicroDebris, White | 0 | pieces |   |   |   |   |   | Debris | Plastics | | | | |
Plastic MicroDebris, Yellow | Plastic MicroDebris, Yellow | 0 | pieces |   |   |   |   |   | Debris | Plastics | | | | |
Plastic, Other | Plastic, Other | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Bags/Packaging | | |
Plate, Waxed Paper | Plate, Waxed Paper | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | FoodService | | |
Ponded | Ponded water that either evaporates and/or infiltrates and does not flow to a surface receiving water | 0 | none |   |   |   |   |   | Habitat | | | | | |
Pool | Pool | 0 | % |   |   |   |   |   | Habitat | | | | | |
Pool Form | Pool Form | 0 | none |   |   |   |   |   | Habitat | | | | | |
Position | Position along transect where sample collected | 0 | none |   |   |   |   |   | Habitat | | | | | |
Potassium | Potassium | 7440097 |   | ug/L | mg/Kg nr |   |   |   | Inorganics | TraceElements | Metals | Conventionals | | |
Potential Non-Stormwater Source | Potential Non-Stormwater Source | 0 | none |   |   |   |   |   | | | | | | |
Poultry | Poultry | 0 | none |   |   |   |   |   | Habitat | | | | | |
Power Plants | Power Plants | 0 | none |   |   |   |   |   | Habitat | | | | | |
Prallethrin | Prallethrin | 0 |   | ug/L | ug/Kg dw |   |   |   | Organics | PPCPs | | | | |
Precipitation | Precipitation | 0 | none |   |   |   |   |   | FieldObservations | Habitat | | | | |
PrecipitationLast24hrs | PrecipitationLast24hrs | 0 | none |   |   |   |   |   | FieldObservations | Habitat | | | | |
Precipitationlast72hrs | Precipitation within the last 72 hours | 0 | none |   |   |   |   |   | | | | | | |
Primidone | Primidone | 125337 |   | ng/L |   |   |   |   | | | | | | |
Primitive Parks, Camping | Primitive Parks, Camping | 0 | none |   |   |   |   |   | Habitat | | | | | |
Procymidone | Procymidone | 32809168 |   | ug/L |   |   |   |   | Organics | Pesticides | | | | |
Prodiamine | Prodiamine | 29091212 |   | ug/L |   |   |   |   | Organics | | | | | |
Profenofos | Profenofos | 41198087 |   | ug/L |   |   |   |   | Organics | Pesticides | | | | |
Profluralin | Profluralin | 26399360 |   | ug/L |   |   |   |   | Organics | Pesticides | Herbicides | | | |
Progesterone | Progesterone | 0 |   | ng/L |   |   |   |   | | | | | | |
Progesterone-d9(IsoDilAnalogue) | Isotope Dilution Analogue: Progesterone-d9 | 15775743 |   | % recovery |   |   |   |   | Organics | | IDA | | | |
Prometon | Prometon | 1610180 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-Triazines | Herbicides | | |
Prometryn | Prometryn | 7287196 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Pest-Triazines | Herbicides | | |
Pronamide | Pronamide (Propyzamide) | 23950585 |   | ug/L |   |   |   |   | Organics | Herbicides | | | | |
Propachlor | Propachlor | 1918167 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-Carbamates | Herbicides | | |
Propanil | Propanil | 709988 |   | ug/L |   |   |   |   | Organics | Pesticides | Herbicides | | | |
Propargite | Propargite | 2312358 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-OPs | Acaricides | | |
Propazine | Propazine | 139402 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-Triazines | Herbicides | | |
Propham | Propham | 122429 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-Carbamates | Herbicides | | |
Propiconazole | Propiconazole | 60207901 |   | ug/L |   |   |   |   | Organics | Herbicides | | | | |
Proportion | Proportion | 0 | % |   |   |   |   |   | Habitat | | | | | |
Propoxur | Propoxur | 114261 |   | ug/L | ug/Kg dw |   |   |   | Organics | Pesticides | Pest-Carbamates | Insecticides | | |
Propylbenzene, n- | n-Propylbenzene | 103651 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Propyzamide | Propyzamide | 23950585 |   | ng/L |   |   |   |   | Organics | Pesticides | Herbicides | | | |
p-Terphenyl-d14(Surrogate) | Surrogate: p-Terphenyl-d14 | 0 |   | % recovery |   |   | ng/g ww | ng/g dw | Organics | | | | | |
Public Access | Public Access | 0 | none |   |   |   |   |   | Habitat | Debris | | | | |
Pymetrozin | Pymetrozin | 123312890 |   | ug/L |   |   |   |   | Organics | Pesticides | | | | |
Pyraclostrobin | Pyraclostrobin | 175013180 |   | ug/L |   |   |   |   | Organics | Fungicides | | | | |
Pyrene | Pyrene | 129000 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | HMW_PAH | | |
Pyrene-d10(Surrogate) | Surrogate: Pyrene-d10 | 1718521 |   | % recovery | % recovery |   | ng/g ww | ng/g dw | Organics | PAHs | SVOCs | HMW_PAH | | |
Pyrethrin-1 | Pyrethrin-1 | 121211 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Pest-Pyrethroids | | | |
Pyrethrin-2 | Pyrethrin-2 (Pyrethrin II) | 121299 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Pest-Pyrethroids | | | |
Pyridaben | Pyridaben | 96489713 |   | ug/L |   |   |   |   | Organics | Pesticides | Insecticides | | | |
Pyridine | Pyridine | 0 |   | ug/L |   |   |   |   | Organics | SVOCs | | | | |
Pyrimethanil | Pyrimethanil | 53112280 |   | ng/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
Quinoxyfen | Quinoxyfen | 124495187 |   | ng/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
Radium-226 | Radium-226 | 13982633 |   | pCi/L |   |   |   |   | Radiochemisty | | | | | |
Radium-228 | Radium-228 | 0 |   | pCi/L |   |   |   |   | | | | | | |
Rapid | Rapid | 0 | % |   |   |   |   |   | Habitat | | | | | |
Rebar | Rebar | 0 | pieces |   |   |   |   |   | Debris | Trash | Non-Plastics | Metal | | |
Reproduction | Reproduction | 0 |   |   |   | Num/Rep |   |   | Toxicity | | | | | |
Residences | Residences | 0 | none |   |   |   |   |   | Habitat | | | | | |
Residential Dumping | Residential Dumping | 0 | none |   |   |   |   |   | Habitat | | | | | |
Resmethrin | Resmethrin | 0 |   | ug/L | ug/Kg dw |   |   |   | Organics | PPCPs | | | | |
Retene | Retene | 0 |   | ng/L | % recovery |   | % recovery | % recovery | Organics | PAHs | | | | |
Ribbon, Non-plastic | Ribbon, Non-plastic | 0 | pieces |   |   |   |   |   | Debris | Trash | Non-Plastics | Household | | |
Ribbon, Packaging | Ribbon, Packaging | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Miscellaneous | | |
Riffle | Riffle | 0 | % |   |   |   |   |   | Habitat | | | | | |
Riffle/Run Bank Stability | Riffle/Run Bank Stability (used for EMAP RBP 20-score habitat characterization) | 0 | none |   |   |   |   |   | Habitat | | | | | |
Riffle/Run Channel Alteration | Riffle/Run Channel Alteration | 0 | none |   |   |   |   |   | Habitat | | | | | |
Riffle/Run Channel Flow Status | Riffle/Run Channel Flow Status | 0 | none |   |   |   |   |   | Habitat | | | | | |
Riffle/Run Embeddedness | Riffle/Run Embeddedness | 0 | none |   |   |   |   |   | Habitat | | | | | |
Riffle/Run Epifaunal Substrate | Riffle/Run Epifaunal Substrate | 0 | none |   |   |   |   |   | Habitat | | | | | |
Riffle/Run Frequency | Riffle/Run Frequency | 0 | none |   |   |   |   |   | Habitat | | | | | |
Riffle/Run Riparian Zone Width | Riffle/Run Riparian Zone Width | 0 | none |   |   |   |   |   | Habitat | | | | | |
Riffle/Run Sediment Deposition | Riffle/Run Sediment Deposition | 0 | none |   |   |   |   |   | Habitat | | | | | |
Riffle/Run Vegetative Protection | Riffle/Run Vegetative Protection | 0 | none |   |   |   |   |   | Habitat | | | | | |
Riffle/Run Velocity/Depth Regime | Riffle/Run Velocity/Depth Regime scale data | 0 | none |   |   |   |   |   | Habitat | | | | | |
Rimsulfuron | Rimsulfuron | 122931480 |   | ug/L |   |   |   |   | Organics | Pesticides | Herbicides | | | |
Riparian Bridges/Abutments | Riparian Bridges/Abutments | 0 | none |   |   |   |   |   | Habitat | | | | | |
Riparian Buildings | Riparian Buildings | 0 | none |   |   |   |   |   | Habitat | | | | | |
Riparian Canopy Big Trees | EMAP BA Specific - Riparian Canopy Big Trees (Trunk > 0.3m DBH) | 0 | none |   |   |   |   |   | Habitat | | | | | |
Riparian Canopy Small Trees | EMAP BA Specific - Riparian Canopy Small Trees (Trunk < 0.3 m DBH) | 0 | none |   |   |   |   |   | Habitat | | | | | |
Riparian Canopy Veg Type | Riparian Canopy Vegetation Type | 0 | none |   |   |   |   |   | Habitat | | | | | |
Riparian Corridor Shading | Percent of stream's water surface upstream of sample location estimated to be shaded if the sun was directly over the stream | 0 | % |   |   |   |   |   | FieldObservations | Habitat | | | | |
Riparian Cover Metric | Metric assesses total vegetation cover in the riparian and channel zones (excluding low-flow) and includes any kind of tree, bush, shrub, or helophyte. | 0 | score |   |   |   |   |   | Habitat | | | | | |
Riparian GroundCover Barren | Riparian Ground Cover Barren, Bare Dirt or Duff | 0 | none |   |   |   |   |   | Habitat | | | | | |
Riparian GroundCover NonWoody Plants | Riparian Ground Cover Non-woody Herbs, Grasses & Forbes | 0 | none |   |   |   |   |   | Habitat | | | | | |
Riparian GroundCover Woody Shrubs | Riparian Ground Cover Woody Shrubs & Saplings | 0 | none |   |   |   |   |   | Habitat | | | | | |
Riparian Landfill/Trash | Riparian Landfill/Trash | 0 | none |   |   |   |   |   | Habitat | | | | | |
Riparian Logging | Riparian Logging Operations | 0 | none |   |   |   |   |   | Habitat | | | | | |
Riparian Lower Canopy All Vegetation | Riparian Lower Canopy All Vegetation (merge of Riparian Understory Non-Woody Plants and Riparian Understory Woody Shrubs in EMAP BA) | 0 | none |   |   |   |   |   | Habitat | | | | | |
Riparian Mining | Riparian Mining Activity | 0 | none |   |   |   |   |   | Habitat | | | | | |
Riparian Orchards/Vineyards | Riparian Orchards/Vineyards | 0 | none |   |   |   |   |   | Habitat | | | | | |
Riparian Park/Lawn | Riparian Park/Lawn | 0 | none |   |   |   |   |   | Habitat | | | | | |
Riparian Pasture/Range | Riparian Pasture/Range/Hay field | 0 | none |   |   |   |   |   | Habitat | | | | | |
Riparian Pavement | Riparian Pavement/Cleared Lot | 0 | none |   |   |   |   |   | Habitat | | | | | |
Riparian Pipes | Riparian Piles (Inlet/Outlet) | 0 | none |   |   |   |   |   | Habitat | | | | | |
Riparian Powerline | Human disturbance measure for powerlines | 0 | none |   |   |   |   |   | Habitat | | | | | |
Riparian Road | Riparian Road/Railroad | 0 | none |   |   |   |   |   | Habitat | | | | | |
Riparian Row Crops | Riparian Row Crops | 0 | none |   |   |   |   |   | Habitat | | | | | |
Riparian Sub Condition/Vert Connectivity Metric | Metric assesses riparian substratum condition influencing natural infiltration capacity and vertical connectivity affecting alluvial permeability, subsurface flows and groundwater connectivity. | 0 | score |   |   |   |   |   | Habitat | | | | | |
Riparian Trail | Human disturbance measure for trails | 0 | none |   |   |   |   |   | Habitat | | | | | |
Riparian Understory NonWoody Plants | EMAP BA specific - Riparian Understory Non-woody Herbs, Grasses & Forbes | 0 | none |   |   |   |   |   | Habitat | | | | | |
Riparian Understory Veg Type | Riparian Understory Vegetation Type | 0 | none |   |   |   |   |   | Habitat | | | | | |
Riparian Understory Woody Shrubs | EMAP BA Specific - Riparian Understory Woody Shrubs & Saplings | 0 | none |   |   |   |   |   | Habitat | | | | | |
Riparian Upper Canopy All Trees | Riparian Upper Canopy All Trees (merge of Riparian Canopy Big Trees and Small Trees in EMAP BA) | 0 | none |   |   |   |   |   | Habitat | | | | | |
Riparian Upper Canopy Deciduous | Riparian Upper Canopy Deciduous | 0 | none |   |   |   |   |   | Habitat | | | | | |
Riparian Upper Canopy Evergreen | Riparian Upper Canopy Evergreen | 0 | none |   |   |   |   |   | Habitat | | | | | |
Riparian Vegetation Management | Riparian Vegetation Management | 0 | none |   |   |   |   |   | Habitat | | | | | |
Riparian Vegetation Width Metric | Metric assesses the average width of the defined riparian zone along the assessment area. | 0 | score |   |   |   |   |   | Habitat | | | | | |
Riparian Wall/Dike | Riparian Wall/Dike/Revetment/Riprap/Dam | 0 | none |   |   |   |   |   | Habitat | | | | | |
RipRAM Index | Riparian Rapid Assessment Method (RAM) for California index score based on the average score of eight component metrics. | 0 | score |   |   |   |   |   | Habitat | | | | | |
RisingGroundwater | Rising groundwater (i.e., a spring) that is the source of water in a receiving water and may contribute (or even define) the receiving water quality | 0 | none |   |   |   |   |   | Habitat | | | | | |
Roads | Roads | 0 | none |   |   |   |   |   | Habitat | | | | | |
Rope, Polypropylene | Rope, Polypropylene | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Miscellaneous | | |
Rope/Tie | Rope/Tie | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Miscellaneous | | |
Roxithromycin | Roxithromycin | 80214831 |   | ug/L |   |   | ng/g ww | ng/g dw | Organics | PPCPs | | | | |
Rubber Materials (Non-Specific) | Rubber Materials (Non-Specific) | 0 | pieces |   |   |   |   |   | Debris | Trash | Non-Plastics | Construction | | |
Rubber Piece | Rubber Piece | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Miscellaneous | | |
Run | Run | 0 | % |   |   |   |   |   | Habitat | | | | | |
Safrotin | Safrotin | 77491306 |   | ug/L |   |   |   |   | Organics | Pesticides | Insecticides | | | |
Salicylic Acid | Salicylic Acid | 0 |   | ng/L |   |   |   |   | | | | | | |
Salicylic Acid-d4(IsoDilAnalogue) | Isotope Dilution Analogue: Salicylic Acid-d4 | 78646170 |   | % recovery |   |   |   |   | Organics | | IDA | | | |
Salinity | Salinity | 0 |   | psu |   |   |   |   | WaterQualityMeasurements | Conventionals | Inorganics | | | |
Salmonella | Salmonella | 0 |   | none |   |   |   |   | Microbiological | Pathogens | Conventional | | | |
Salmonella-invA | Salmonella-invA | 0 |   | copies/100 mL |   |   |   |   | Microbiological | Pathogens | Conventional | | | |
Salmonella-ttr | Salmonella-ttr | 0 |   | copies/100 mL |   |   |   |   | Microbiological | Pathogens | Conventional | | | |
Sand | Sand | 0 |   | % | % |   |   |   | Inorganics | Conventionals | GrainSize | | | |
Sarafloxacin | Sarafloxacin | 0 |   |   |   |   | ng/g ww | ng/g dw | Organics | | | | | |
Saxitoxins | Saxitoxins | 0 |   | ug/L |   |   |   |   | Microbiological | Cyanotoxins | | | | |
Scandium | Scandium | 7440202 |   | ug/L |   |   |   |   | Inorganics | | | | | |
Seagrass | Seagrass | 0 | pieces |   |   |   |   |   | Debris | Natural | Non-Plastics | Marine Origin | | |
SeaState | SeaState | 0 | none |   |   |   |   |   | FieldObservations | Habitat | | | | |
Secbumeton | Secbumeton | 26259450 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-Triazines | Herbicides | | |
Secchi Depth | Measurement of clarity based on the depth at which the Secchi disk can be differentiated | 0 |   | m |   |   |   |   | WaterQualityMeasurements | | | | | |
Sedaxane | Sedaxane | 874967676 |   | ng/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
Selenate as Se | Selenate as Se (Se VI) | 0 |   | ug/L |   |   |   |   | Inorganics | Conventionals | | | | |
Selenite as Se | Selenite as Se (Se IV) | 0 |   | ug/L |   |   |   |   | Inorganics | Conventionals | | | | |
Selenium | Selenium | 7782492 |   | ug/L | ug/g dw |   | ug/g ww | ug/g dw | Inorganics | TraceElements | Metals | | | |
Sethoxydim | Sethoxydim | 74051802 |   | ug/L |   |   |   |   | Organics | Pesticides | Herbicides | | | |
Settleable Solids | Settleable Solids | 0 |   | mL/L/hr |   |   |   |   | Inorganics | Conventionals | | | | |
Sewage Treatment | Sewage Treatment | 0 | none |   |   |   |   |   | Habitat | | | | | |
Shade | Amount of shade within the algae sampling area (1 m2) | 0 | % |   |   |   |   |   | Habitat | | | | | |
Shoe | Shoe | 0 | pieces |   |   |   |   |   | Debris | Trash | Non-Plastics | Household | | |
Shopping Cart | Shopping Cart | 0 | pieces |   |   |   |   |   | Debris | Trash | Non-Plastics | Large | | |
Side Channel | Side Channel present | 0 | none |   |   |   |   |   | Habitat | | | | | |
Siduron | Siduron | 1982496 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-Carbamates | Herbicides | | |
Silica as SiO2 | Silica as SiO2 | 14808607 |   | ug/L |   |   |   |   | Inorganics | Conventionals | Habitat | | | |
Silicate as Si | Silicate as Si (Si(OH)4) | 0 |   | mg/L |   |   |   |   | Inorganics | Conventionals | | | | |
Silicon | Silicon
| 7440213 |   | mg/L |   |   |   |   | | | | | | |
Silt | Silt | 0 |   | % | % |   |   |   | Inorganics | Conventionals | GrainSize | | | |
Silt + Clay | Silt + Clay | 0 |   |   | % |   |   |   | Inorganics | Conventionals | | | | |
Silver | Silver | 7440224 |   | ug/L | ug/g dw |   | ug/g ww | ug/g dw | Inorganics | TraceElements | Metals | | | |
Simazine | Simazine | 122349 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Pest-Triazines | Herbicides | Algaecides | Endocrine Disruptors |
Simazine(Surrogate) | Surrogate: Simazine | 122349 |   | % recovery |   |   |   |   | Organics | Pesticides | Pest-Triazines | | | |
Simetryn | Simetryn | 1014706 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-Triazines | Herbicides | | |
Sinuosity | Ratio of the curvilinear length along a stream and the Euclidean (straight line) distance between two points along the stream | 0 | none |   |   |   |   |   | Habitat | | | | | |
Site Length | Site Length | 0 | m |   |   |   |   |   | Habitat | Debris | | | | |
Site Width | Site Width | 0 | m |   |   |   |   |   | Habitat | Debris | | | | |
SkyCode | SkyCode | 0 | none |   |   |   |   |   | FieldObservations | Habitat | | | | |
Slope | Slope | 0 | % |   |   |   |   |   | Habitat | | | | | |
SOD | Sediment Oxygen Demand (SOD) | 0 |   |   | mg/Kg dw |   |   |   | | | | | | |
Sodium | Sodium | 7440235 |   | ug/L |   |   |   |   | Inorganics | Conventionals | Metals | | | |
Soft Plastic Piece, non-specific | Soft Plastic Piece, non-specific | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Bags/Packaging | | |
Soft Sediment | Soft Sediment; indicates presence/absence of soft/small sediment at the point where depth is measured | 0 | none |   |   |   |   |   | Habitat | | | | | |
Soot | Soot/Black Carbon | 0 |   |   | % |   |   |   | | | | | | |
SpecificConductivity | Specific Conductivity | 0 |   | uS/cm |   |   |   |   | WaterQualityMeasurements | Conventionals | Inorganics | | | |
Sports Ball | Sports Ball | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Household | | |
Spray Paint Can | Spray Paint Can | 0 | pieces |   |   |   |   |   | Debris | Trash | Non-Plastics | Toxic | | |
StationWaterDepth | Depth of waterbody where sample was collected | 0 | m | ft |   |   |   |   | Habitat | | | | | |
StationWaterDepth_Avg | Estimated average depth of the waterbody at the time of sampling | 0 | cm |   |   |   |   |   | Habitat | | | | | |
StationWaterDepth_Max | Estimated maximum depth of the waterbody at the time of sampling | 0 | cm |   |   |   |   |   | Habitat | | | | | |
Stick/Branch/Driftwood | Stick/Branch/Driftwood | 0 | pieces |   |   |   |   |   | Debris | Natural | Non-Plastics | Marine Origin | | |
Straw | Straw | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | FoodService | | |
Stream Confinement | Confinement based upon the valley width in relation to average bankfull width which the riverine system can migrate without encountering a hillside, terrace or other feature | 0 | none |   |   |   |   |   | Habitat | | | | | |
StreamBankCharacteristics_Concrete | StreamBankCharacteristics_Concrete | 0 | none |   |   |   |   |   | Habitat | Debris | | | | |
StreamBankCharacteristics_Earthen | StreamBankCharacteristics_Earthen | 0 | none |   |   |   |   |   | Habitat | Debris | | | | |
StreamBankCharacteristics_RipRap | StreamBankCharacteristics_RipRap | 0 | none |   |   |   |   |   | Habitat | Debris | | | | |
StreamBankCharacteristics_Sloped | StreamBankCharacteristics_Sloped | 0 | none |   |   |   |   |   | Habitat | Debris | | | | |
StreamBankCharacteristics_Vegetated | StreamBankCharacteristics_Vegetated | 0 | none |   |   |   |   |   | Habitat | Debris | | | | |
StreamBankCharacteristics_Vertical | StreamBankCharacteristics_Vertical | 0 | none |   |   |   |   |   | Habitat | Debris | | | | |
StreamBedCharacteristics_Concrete | StreamBedCharacteristics_Concrete | 0 | none |   |   |   |   |   | Habitat | Debris | | | | |
StreamBedCharacteristics_Earthen | StreamBedCharacteristics_Earthen | 0 | none |   |   |   |   |   | Habitat | Debris | | | | |
StreamBedCharacteristics_Rock | StreamBedCharacteristics_Rock | 0 | none |   |   |   |   |   | Habitat | Debris | | | | |
StreamBedCharacteristics_SubPlants | StreamBedCharacteristics_SubPlants | 0 | none |   |   |   |   |   | Habitat | Debris | | | | |
StreamMixing | Classification of stream mixing by stratification, well-mixed or poorly mixed | 0 | none |   |   |   |   |   | FieldObservations | Habitat | | | | |
StreamWidth | StreamWidth | 0 | m |   |   |   |   |   | FieldObservations | Habitat | | | | |
Strontium | Strontium | 7440246 |   | ug/L | mg/Kg nr |   | ug/g ww | ug/g dw | Inorganics | Metals | | | | |
Strontium-87/Strontium-86 Ratio | Strontium-87/Strontium-86 Ratio | 0 |   | per mil |   |   |   |   | Isotopes | | | | | |
Strontium-90 | Strontium-90 | 0 |   | pCi/L |   |   |   |   | | | | | | |
Styrene | Styrene | 100425 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Styrofoam Pellet | Styrofoam Pellet | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Bags/Packaging | | |
SubreachesFished | Subreaches fished within a given waterbody | 0 | none |   |   |   |   |   | Habitat | | | | | |
Substrate Modifier | Substrate Modifier | 0 | none |   |   |   |   |   | Habitat | | | | | |
Substrate Size Class | Substrate Size Class | 0 | none |   |   |   |   |   | Habitat | | | | | |
Sucralose | Sucralose | 56038132 |   | ng/L |   |   |   |   | | | | | | |
Sulfachloropyridazine | Sulfachloropyridazine | 80320 |   | ug/L |   |   | ng/g ww | ng/g dw | Organics | PPCPs | | | | |
Sulfadiazine | Sulfadiazine | 68359 |   |   |   |   | ng/g ww | ng/g dw | Organics | | | | | |
Sulfadimethoxine | Sulfadimethoxine | 122112 |   | ug/L |   |   | ng/g ww | ng/g dw | Organics | PPCPs | | | | |
Sulfallate | Sulfallate (CDEC) | 95067 |   | ug/L |   |   |   |   | Organics | Pesticides | Herbicides | | | |
Sulfamerazine | Sulfamerazine | 127797 |   | ug/L |   |   | ng/g ww | ng/g dw | Organics | PPCPs | | | | |
Sulfamethazine | Sulfamethazine | 57681 |   | ug/L |   |   | ng/g ww | ng/g dw | Organics | PPCPs | | | | |
Sulfamethazine-13C6(Surrogate) | Surrogate: Sulfamethazine-13C6 | 77643915 |   | % recovery |   |   | % recovery | % recovery | Organics | PPCPs | | | | |
Sulfamethizole | Sulfamethizole | 144821 |   | ug/L |   |   | ng/g ww | ng/g dw | Organics | PPCPs | | | | |
Sulfamethoxazole | Sulfamethoxazole | 723466 |   | ug/L |   |   | ng/g ww | ng/g dw | Organics | PPCPs | | | | |
Sulfamethoxazole-13C6(Surrogate) | Surrogate: Sulfamethoxazole-13C6 | 0 |   |   |   |   | % recovery | % recovery | Organics | | | | | |
Sulfanilamide | Sulfanilamide | 0 |   |   |   |   | ng/g ww | ng/g dw | Organics | | | | | |
Sulfate | Sulfate | 14808798 |   | mg/L | mg/Kg nr |   |   |   | Inorganics | Conventionals | Nutrients | | | |
Sulfathiazole | Sulfathiazole | 72140 |   | ug/L |   |   | ng/g ww | ng/g dw | Organics | PPCPs | | | | |
Sulfide, Total | Total Sulfide | 0 |   | mg/L | mg/Kg dw |   |   |   | WaterQualityMeasurements | | | | | |
Sulfometuron Methyl | Sulfometuron Methyl | 74222972 |   | ug/L |   |   |   |   | Organics | Herbicides | | | | |
Sulfotep | Sulfotepp | 3689245 |   | ug/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | Pesticides | Pest-OPs | Insecticides | | |
Sum of DDTs (RWQCB3) | Sum of DDD, DDE, and DDT (RWQCB3) | 0 |   |   | ug/Kg dw |   |   |   | Organics | | | | | |
Sum of HPAHs (Integral) | Sum of HPAHs (Integral) | 0 |   |   | ug/kg |   |   |   | | | | | | |
Sum of LPAHs (Integral) | Sum of LPAHs (Integral) | 0 |   |   | ug/kg |   |   |   | | | | | | |
Surface Films | Surface Films | 0 | none |   |   |   |   |   | Habitat | | | | | |
SurfaceAreaOfMax | Estimate of the current surface area size as a fraction of the total surface area the waterbody would have at high water stage | 0 | % |   |   |   |   |   | Habitat | | | | | |
SurfacewaterConnect | Discharge from an outfall that does or does not flow to and have hydrologic continuity with a surface receiving water and has or does not have the potential to contribute to the quality of the surface receiving water quality | 0 | none |   |   |   |   |   | Habitat | | | | | |
Survival | Survival (%) | 0 |   |   |   | % |   |   | Toxicity | | | | | |
Suspended Sediment Concentration | Suspended Sediment Concentration (SSC) | 0 |   | mg/L |   |   |   |   | Inorganics | Conventionals | | | | |
Suspended Sediment Discharge | Suspended Sediment Discharge | 0 |   | tons/day |   |   |   |   | Inorganics | | | | | |
Swim Normally | Swim Normally (Num/Rep) | 0 |   |   |   | Num/Rep |   |   | Toxicity | | | | | |
Syringe/Pipette | Syringe/Pipette | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Toxic | | |
Tape | Tape | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Household | | |
Tarp | Tarp | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Household | | |
TCDD, 2,3,7,8- | 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) | 1746016 |   | ug/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
TCDD, 2,3,7,8- (TEQ ND=0) | 2,3,7,8-TCDD (TEQ ND=0) | 0 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
TCDD, 2,3,7,8- (TEQ ND=1/2 DL) | 2,3,7,8-TCDD (TEQ ND=1/2 DL) | 0 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
TCDD, 2,3,7,8-(Surrogate) | Surrogate: 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) | 1746016 |   | % recovery |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
TCDD-13C, 2,3,7,8-(Surrogate) | Surrogate: 2,3,7,8-Tetrachlorodibenzo-p-dioxin-13C (TCDD) | 156712 |   | % recovery |   |   |   |   | Organics | PCDDs/PCDFs | Dioxins/Dibenzofurans | | | |
TCDD-13C12, 2,3,7,8-(IsoDilAnalogue) | Isotope Dilution Analogue: 2,3,7,8-TCDD-13C12 | 76523405 |   | % recovery |   |   |   |   | Organics | Dioxins/Dibenzofurans | IDA | | | |
TCDD-13C6, 1,2,3,4-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3,4-TCDD-13C6 | 116865588 |   | % recovery |   |   |   |   | Organics | Dioxins/Dibenzofurans | IDA | | | |
TCDD-13C6, 1,2,3,4-(Surrogate) | Surrogate: 1,2,3,4-Tetrachlorodibenzo-p-dioxin-13C6 (TCDD) | 30746588 |   | % recovery |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
TCDD-37Cl, 2,3,7,8-(Surrogate) | Surrogate: 2,3,7,8-Tetrachlorodibenzo-p-dioxin-37Cl (TCDD) | 0 |   | % recovery |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
TCDD-37Cl14, 2,3,7,8-(IsoDilAnalogue) | Isotope Dilution Analogue: 2,3,7,8-TCDD-37Cl14 | 85508505 |   | % recovery |   |   |   |   | Organics | Dioxins/Dibenzofurans | IDA | | | |
TCDF, 2,3,7,8- | 2,3,7,8-Tetrachlorodibenzofuran (TCDF) | 51207319 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
TCDF, 2,3,7,8- (TEQ ND=0) | 2,3,7,8-TCDF (TEQ ND=0) | 0 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
TCDF, 2,3,7,8- (TEQ ND=1/2 DL) | 2,3,7,8-TCDF (TEQ ND=1/2 DL) | 0 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
TCDF, 2,3,7,8-(Surrogate) | Surrogate: 2,3,7,8-Tetrachlorodibenzofuran (TCDF) | 51207319 |   | % recovery |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
TCDF-13C12, 2,3,7,8-(IsoDilAnalogue) | Isotope Dilution Analogue: 2,3,7,8-TCDF-13C12 | 89059461 |   | % recovery |   |   |   |   | Organics | Dioxins/Dibenzofurans | IDA | | | |
TCDF-2C, 2,3,7,8- | 2,3,7,8-TCDF-2C | 0 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
Tebuconazole | Tebuconazole (Folicur) | 107534963 |   | ug/L |   |   |   |   | Organics | Fungicides | | | | |
Tebupirimfos | Tebupirimfos | 96182535 |   | ng/L |   |   |   |   | Organics | Pesticides | Insecticides | | | |
Tebupirimfos oxon | Tebupirimfos oxon | 1035330369 |   | ng/L |   |   |   |   | Organics | Pesticides | | | | |
Tebuthiuron | Tebuthiuron | 34014181 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-OPs | | | |
Tebuthiuron(Surrogate) | Surrogate: Tebuthiuron | 0 |   | % recovery | % recovery |   |   |   | Organics | | | | | |
Tedion | Tedion (Tetradifon) | 116290 |   | ug/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | Pesticides | Pest-OCHs | | | |
Tefluthrin | Tefluthrin | 79538322 |   | ng/L | ug/Kg dw |   |   |   | Pyrethroid Pesticides | | | | | |
Television | Television | 0 | pieces |   |   |   |   |   | Debris | Trash | Non-Plastics | Large | | |
Temephos | Temephos | 3383968 |   | ug/L |   |   |   |   | Organics | PPCPs | | | | |
Temperature | Temperature | 0 |   | Deg C |   |   |   |   | WaterQualityMeasurements | Conventionals | | | | |
Terbacil | Terbacil | 5902512 |   | ug/L |   |   |   |   | Organics | Herbicides | | | | |
Terbufos | Terbufos | 13071799 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-OPs | Insecticides | Nematocides | Nematocides |
Terbuthylazine | Terbuthylazine | 5915413 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-Triazines | Herbicides | | |
Terbutryn | Terbutryn | 886500 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-Triazines | Herbicides | | |
Terphenyl-d14 | Terphenyl-d14 | 0 |   | ug/L |   |   |   |   | | | | | | |
Terphenyl-d14(Surrogate) | Surrogate: Terphenyl-d14 | 1718510 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | SVOCs | | | | |
Tert-amyl Methyl Ether | Tert-amyl Methyl Ether | 994058 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Tert-butyl Alcohol | Tert-butyl Alcohol | 75630 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Testosterone | Testosterone | 0 |   | ng/L |   |   |   |   | | | | | | |
Testosterone-d3(IsoDilAnalogue) | Isotope Dilution Analogue: Testosterone-d3 | 77546395 |   | % recovery |   |   |   |   | Organics | | IDA | | | |
Tetrabutyltin as Sn | Tetrabutyltin as Sn | 0 |   |   | ug/Kg dw |   |   |   | Organics | | | | | |
Tetrachlorobenzene, 1,2,3,4- | 1,2,3,4-Tetrachlorobenzene | 634662 |   |   | ug/Kg dw |   |   |   | | | | | | |
Tetrachlorobenzene, 1,2,3,4-(Surrogate) | Surrogate: 1,2,3,4-Tetrachlorobenzene | 634662 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | Semi-VOAs | | | | |
Tetrachlorobenzene, 1,2,3,5/1,2,4,5- | 1,2,3,5/1,2,4,5-Tetrachlorobenzene | 0 |   |   | ug/Kg dw |   |   |   | | | | | | |
Tetrachlorobenzene-13C6,1,2,3,4-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3,4-Tetrachlorobenzene-13C6 | 2483735528 |   |   | % recovery |   | % recovery | % recovery | | | | | | |
Tetrachloroethane, 1,1,1,2- | 1,1,1,2-Tetrachloroethane | 630206 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Tetrachloroethane, 1,1,2,2- | 1,1,2,2-Tetrachloroethane | 76345 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Tetrachloroethylene | Tetrachloroethylene, Tetrachloroethene | 127184 |   | ug/L |   |   |   |   | Organics | VOCs | Insecticides | | | |
Tetrachloro-m-xylene(Surrogate) | Surrogate: Tetrachloro-m-xylene (TCMX) | 877098 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OCHs | | | |
Tetrachlorophenol, 2,3,4,5- | 2,3,4,5-Tetrachlorophenol | 4901513 |   | ug/L |   |   |   |   | Organics | SVOCs | Phenols | Chlorinated Phenols | | |
Tetrachlorophenol, 2,3,4,6- | 2,3,4,6-Tetrachlorophenol | 58902 |   | ug/L | mg/Kg dw |   |   |   | Organics | SVOCs | Phenols | Chlorinated Phenols | | |
Tetrachlorophenol, 2,3,5,6- | 2,3,5,6-Tetrachlorophenol | 935955 |   | ug/L |   |   |   |   | Organics | SVOCs | Phenols | Chlorinated Phenols | | |
Tetrachlorvinphos | Tetrachlorvinphos (Stirofos) | 22248799 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Pest-OPs | Insecticides | | |
Tetraconazole | Tetraconazole (1-[2-(2,4-Dichlorophenyl)-3-(1,1,2,2-tetrafluoroethoxy)propyl]- 1H-1,2,4-triazole)
Tetraconazole (1-[2-(2,4-Dichlorophenyl)-3-(1,1,2,2-tetrafluoroethoxy)propyl]- 1H-1,2,4-triazole) | 112281773 |   | ug/L |   |   |   |   | Organics | Fungicides | | | | |
Tetracosane, n- | n-Tetracosane | 0 |   | mg/L |   |   |   |   | | | | | | |
Tetracosane, n-(Surrogate) | Surrogate: n-Tetracosane | 0 |   | % recovery |   |   |   |   | | | | | | |
Tetracycline | Tetracycline | 60548 |   | ug/L |   |   |   |   | Organics | PPCPs | | | | |
Tetradifon | Tetradifon | 0 |   | ng/L |   |   |   |   | Organics | Pesticides | | | | |
Tetraethyl Pyrophosphate | Tetraethyl Pyrophosphate (TEPP) | 107493 |   | ug/L |   |   |   |   | Organics | Pesticides | OrganophosphatePest. | | | |
Tetramethrin | Tetramethrin | 7696120 |   | ug/L | ug/Kg dw |   |   |   | Organics | PPCPs | | | | |
Tetramethylnaphthalene, 1,4,6,7- | 1,4,6,7-Tetramethylnaphthalene | 13764186 |   | ng/L |   |   |   |   | Organics | PAHs | | | | |
Tetryl | Tetryl | 479458 |   | ug/L | ug/kg |   |   |   | Organics | | | | | |
T-Fluvalinate | T-Fluvalinate | 102851069 |   | ug/L | ng/g dw |   |   |   | Organics | | | | | |
Thallium | Thallium | 7440280 |   | ug/L | mg/Kg nr |   | ug/g ww | ug/g dw | Inorganics | Metals | | | | |
Thiabendazole | Thiabendazole | 148798 |   | ug/L |   |   | ng/g ww | ng/g dw | Organics | Pesticides | Fungicides | | | |
Thiabendazole-d6(Surrogate) | Surrogate: Thiabendazole-d6 | 0 |   |   |   |   | % recovery | % recovery | Organics | | | | | |
Thiacloprid | Thiacloprid | 111988499 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Insecticides | | | |
Thiamethoxam | Thiamethoxam | 153719234 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Insecticides | | | |
Thiamethoxam-d3(Surrogate) | Surrogate: Thiamethoxam-d3 | 0 |   | % recovery | % recovery |   |   |   | | | | | | |
Thiazopyr | Thiazopyr | 117718602 |   | ng/L |   |   |   |   | Organics | Pesticides | Herbicides | | | |
Thiobencarb | Thiobencarb (Benthiocarb) (Bolero) | 28249776 |   | ug/L | ng/g dw |   |   |   | Organics | Pesticides | Pest-OPs | | | |
Thiobencarb(Surrogate) | Surrogate: Thiobencarb (Benthiocarb) (Bolero) | 28249776 |   | % recovery |   |   |   |   | Organics | | | | | |
Thionazin | Thionazin (Thionzin) | 297972 |   | ug/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | Pesticides | Pest-OPs | | | |
Tidal Height | Tidal Height | 0 | none |   |   |   |   |   | Habitat | | | | | |
Tidal State | Tidal State | 0 | none |   |   |   |   |   | FieldObservations | Habitat | | | | |
TidalDirection | TidalDirection | 0 | none |   |   |   |   |   | Habitat | | | | | |
Time, Fishing | Time spent fishing within a given waterbody | 0 | mins |   |   |   |   |   | Habitat | | | | | |
Time, Shock | Time spent electroshocking within a given waterbody | 0 | seconds |   |   |   |   |   | Habitat | | | | | |
TimeToSpinTest | Time the velocity meter spins during QA/QC calibration checks | 0 |   |   |   |   |   |   | WaterQualityMeasurements | | | | | |
Tin | Tin | 7440315 |   | ug/L | mg/Kg nr |   | ug/g ww | ug/g dw | Inorganics | Metals | | | | |
Tire | Tire | 0 | pieces |   |   |   |   |   | Debris | Trash | Non-Plastics | Construction | | |
Titanium | Titanium | 7440326 |   | ug/L | mg/Kg nr |   | ug/g ww | ug/g dw | Inorganics | Metals | | | | |
Tokuthion | Tokuthion (Prothiofos) | 34643464 |   | ug/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | Pesticides | Pest-OPs | Insecticides | | |
Tolfenpyrad | Tolfenpyrad | 129558765 |   | ng/L |   |   |   |   | Organics | Pesticides | Insecticides | | | |
Toluene | Toluene | 108883 |   | ug/L |   |   |   |   | Organics | VOCs | MTBE_BTEX | | | |
Toluene-d8(Surrogate) | Surrogate: Toluene-d8 | 2037265 |   | % recovery |   |   |   |   | Organics | VOCs | MTBE_BTEX | | | |
Toothbrush | Toothbrush | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Household | | |
Torrent 01 | Torrent 01 - Recently devegetated corridor two or more times the width of the low flow channel | 0 | none |   |   |   |   |   | Habitat | | | | | |
Torrent 02 | Torrent 02 - Substrate cobbles or large gravel particles are not imbricated | 0 | none |   |   |   |   |   | Habitat | | | | | |
Torrent 03 | Torrent 03 - Channel has little evidence of pool-riffle structure | 0 | none |   |   |   |   |   | Habitat | | | | | |
Torrent 04 | Torrent 04 - Stream channel is scoured down to bedrock | 0 | none |   |   |   |   |   | Habitat | | | | | |
Torrent 05 | Torrent 05 - Gravel and cobble berms above bankfull level | 0 | none |   |   |   |   |   | Habitat | | | | | |
Torrent 06 | Torrent 06 - Massive deposits downstream of reach | 0 | none |   |   |   |   |   | Habitat | | | | | |
Torrent 07 | Torrent 07 - Riparian trees have fresh bark scars | 0 | none |   |   |   |   |   | Habitat | | | | | |
Torrent 08 | Torrent 08 - Riparian trees have fallen into channel as a result of scouring near their roots | 0 | none |   |   |   |   |   | Habitat | | | | | |
Torrent 09 | Torrent 09 - Massive deposits of sediment, logs and debris within reach | 0 | none |   |   |   |   |   | Habitat | | | | | |
Torrent 10 | Torrent 10 - Newly erroded deposits show evidence that the deposits are matrix supported | 0 | none |   |   |   |   |   | Habitat | | | | | |
Torrent 11 | Torrent 11 - No evidence of torrent scouring or torrent deposits | 0 | none |   |   |   |   |   | Habitat | | | | | |
Total Anions | Total Anions | 0 |   | mg/L |   |   |   |   | Inorganics | | | | | |
Total Cations | Total Cations | 0 |   | mg/L |   |   |   |   | Inorganics | | | | | |
Total Cell Count | Total Cell Count | 0 |   |   |   | cells/ml |   |   | Toxicity | | | | | |
Total Chlordanes | Total Chlordanes | 0 |   |   | ug/Kg dw |   |   |   | | | | | | |
Total DDDs | Total DDDs | 0 |   |   | ug/Kg dw |   |   |   | Organics | Pesticides | | | | |
Total DDEs | Total DDEs | 0 |   |   | ug/Kg dw |   |   |   | Organics | Pesticides | | | | |
Total DDTs | Total DDTs | 0 |   | ug/L | ug/Kg dw |   |   |   | Organics | Pesticides | | | | |
Total Debris, >2.5 cm | Total Debris >2.5 cm | 0 | L |   |   |   |   |   | Debris | Debris | Trash | Plastics | | |
Total Debris, 2.5 cm - 5 mm | Total Debris 2.5 cm - 5 mm | 0 | L |   |   |   |   |   | Debris | Debris | Trash | Plastics | | |
Total Dichlorobiphenyls | Total Dichlorobiphenyls | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
Total Dioxins-Furans (TEQ ND=0) | Total Dioxins-Furans (TEQ ND=0 DL) | 0 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
Total Dioxins-Furans (TEQ ND=1/2 DL) | Total Dioxins-Furans (TEQ ND=1/2 DL) | 0 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
Total Di-PCB | Total Di-PCB | 0 |   | pg/L |   |   |   |   | Organics | PCBs | | | | |
Total Dissolved Solids | Total Dissolved Solids | 0 |   | mg/L |   |   |   |   | Inorganics | Conventionals | | | | |
Total HCHs | Total HCHs | 0 |   | ug/L |   |   |   |   | Organics | Pesticides | | | | |
Total Heptachlorobiphenyls | Total Heptachlorobiphenyls | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
Total Hepta-Dioxins | Total Hepta-Dioxins | 37871004 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
Total Hepta-Furans | Total Hepta-Furans | 38998753 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
Total Hepta-PCB | Total Hepta-PCB | 0 |   | pg/L |   |   |   |   | Organics | PCBs | | | | |
Total Hexachlorobiphenyls | Total Hexachlorobiphenyls | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
Total Hexa-Dioxins | Total Hexa-Dioxins | 34465468 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
Total Hexa-Furans | Total Hexa-Furans | 55684941 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
Total Hexa-PCB | Total Hexa-PCB | 0 |   | pg/L |   |   |   |   | Organics | PCBs | | | | |
Total Monochlorobiphenyls | Total Monochlorobiphenyls | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
Total Mono-PCB | Total Mono-PCB | 0 |   | pg/L |   |   |   |   | Organics | PCBs | | | | |
Total Nonachlorobiphenyls | Total Nonachlorobiphenyls | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
Total Nona-PCB | Total Nona-PCB | 0 |   | pg/L |   |   |   |   | Organics | PCBs | | | | |
Total Octachlorobiphenyls | Total Octachlorobiphenyls | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
Total Octa-PCB | Total Octa-PCB | 0 |   | pg/L |   |   |   |   | Organics | PCBs | | | | |
Total Organic Carbon | Total Organic Carbon (TOC) | 0 |   | mg/L | mg/Kg ww |   |   |   | Inorganics | Conventionals | | | | |
Total Organic Matter | Includes all the elements (hydrogen, oxygen, nitrogen, etc) that are components of organic compounds, not just carbon. | 0 |   |   | % dw |   |   |   | | | | | | |
Total PAHs | Total PAHs | 0 |   | ug/L | ug/kg |   |   |   | Organics | | | | | |
Total PCBs | Total PCBs | 0 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
Total Pentachlorobiphenyls | Total Pentachlorobiphenyls | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
Total Penta-Dioxins | Total Penta-Dioxins | 36088229 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
Total Penta-Furans | Total Penta-Furans | 30402154 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
Total Penta-PCB | Total Penta-PCB | 0 |   | pg/L |   |   |   |   | Organics | PCBs | | | | |
Total Pyrethrins | Total Pyrethrins | 0 |   | ug/L |   |   |   |   | Organics | Pesticides | | | | |
Total Solids | Total Solids | 0 |   | mg/L | mg/Kg dw |   | % ww | % dw | Inorganics | Conventionals | | | | |
Total Suspended Solids | Total Suspended Solids | 0 |   | mg/L |   |   |   |   | Inorganics | Conventionals | | | | |
Total TEQ (WHO 2005; ND=0) | Total TEQ (WHO 2005; ND=0) | 0 |   | pg/L |   |   |   |   | | | | | | |
Total TEQ (WHO 2005; ND=1/2DL) | Total TEQ (WHO 2005; ND=1/2DL) | 0 |   | pg/L |   |   |   |   | Organics | | | | | |
Total Tetrachlorobiphenyls | Total Tetrachlorobiphenyls | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
Total Tetra-Dioxins | Total Tetra-Dioxins | 41903575 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
Total Tetra-Furans | Total Tetra-Furans | 30402143 |   | pg/L |   |   |   |   | Organics | Dioxins/Dibenzofurans | | | | |
Total Tetra-PCB | Total Tetra-PCB | 0 |   | pg/L |   |   |   |   | Organics | PCBs | | | | |
Total Trichlorobiphenyls | Total Trichlorobiphenyls | 0 |   | pg/sample | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PCBs | | | | |
Total Tri-PCB | Total Tri-PCB | 0 |   | pg/L |   |   |   |   | Organics | PCBs | | | | |
TotalPieces | Total Pieces of Trash using Trash Protocol | 0 | pieces |   |   |   |   |   | Trash | | | | | |
Toxaphene | Toxaphene | 8001352 |   | ug/L | ug/Kg ww |   | ug/Kg ww | ug/Kg dw | Organics | Pesticides | Pest-OCHs | Insecticides | | |
Toxic | Toxic using Trash Protocol | 0 | L |   |   |   |   |   | Trash | | | | | |
Toxic, Other | Toxic, Other | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Toxic | | |
Toy | Toy | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Household | | |
TPH as Diesel C10-C22 | TPH as Diesel C10-C22 | 0 |   | ug/L |   |   |   |   | Organics | SVOCs | | | | |
TPH as Diesel C10-C24 | TPH as Diesel C10-C24 | 0 |   | ug/L |   |   |   |   | Organics | SVOCs | | | | |
TPH as Diesel C10-C25 | TPH as Diesel C10-C25 | 0 |   | mg/L |   |   |   |   | Organics | SVOCs | | | | |
TPH as Diesel C10-C28 | TPH as Diesel C10-C28 | 0 |   | ug/L | ug/g dw |   |   |   | Organics | SVOCs | | | | |
TPH as Diesel C12-C24 | TPH as Diesel C12-C24 | 0 |   | ug/L |   |   |   |   | Organics | SVOCs | | | | |
TPH as Diesel C13-C28 | TPH as Diesel C13-C28 | 0 |   | ug/L |   |   |   |   | Organics | SVOCs | | | | |
TPH as Gasoline C3-C13 | TPH as Gasoline C3-C13 | 0 |   | mg/L |   |   |   |   | Organics | SVOCs | | | | |
TPH as Gasoline C6-C10 | TPH as Gasoline C6-C10 | 0 |   | ug/L |   |   |   |   | Organics | SVOCs | | | | |
TPH as Gasoline C6-C12 | TPH as Gasoline C6-C12 | 0 |   | ug/L |   |   |   |   | Organics | SVOCs | | | | |
TPH as Heavy Fuel Oils C22-C36 | TPH as Heavy Fuel Oils C22-C36 | 0 |   | mg/L |   |   |   |   | Organics | SVOCs | | | | |
TPH as JP8 C7-C18 | TPH as JP8 C7-C18 | 0 |   | mg/L |   |   |   |   | Organics | SVOCs | | | | |
TPH as Motor Oil C21-C32 | TPH as Motor Oil C21-C32 | 0 |   | ug/L |   |   |   |   | Organics | SVOCs | | | | |
TPH as Motor Oil C23-C36 | TPH as Motor Oil C23-C36 | 0 |   | ug/L |   |   |   |   | Organics | SVOCs | | | | |
TPH as Motor Oil C24-C36 | TPH as Motor Oil C24-C36 | 0 |   | ug/L |   |   |   |   | Organics | SVOCs | | | | |
TPH as Motor Oil C24-C40 | TPH as Motor Oil C24-C40 | 0 |   | ug/L |   |   |   |   | Organics | SVOCs | | | | |
TPH as Motor Oil C25-C36 | TPH as Motor Oil C25-C36 | 0 |   | mg/L |   |   |   |   | Organics | SVOCs | | | | |
TPH as Motor Oil C29-C40 | TPH as Motor Oil C29-C40 | 0 |   | ug/L |   |   |   |   | Organics | SVOCs | | | | |
TPH as Oil C29-C44 | TPH as Oil C29-C44 | 0 |   | mg/L |   |   |   |   | Organics | SVOCs | | | | |
Tralomethrin | Tralomethrin | 66841256 |   | ug/L |   |   |   |   | Organics | Pesticides | Insecticides | Pyrethroids | | |
TransectsSampled | Number of transects sampled to attain sample material | 0 | count |   |   |   |   |   | Habitat | | | | | |
Transmittance | Transmittance | 0 |   | % |   |   |   |   | Inorganics | Conventionals | WaterQualityMeasurements | | | |
Transparency | Transparency | 0 |   | cm |   |   |   |   | FieldObservations | Habitat | | | | |
Trash at >96" Drain | Trash at >96" Drain | 0 | none |   |   |   |   |   | Debris | Trash | | | | |
Trash at 12" Drain | Trash at 12" Drain | 0 | none |   |   |   |   |   | Debris | Trash | | | | |
Trash at 18" Drain | Trash at 18" Drain | 0 | none |   |   |   |   |   | Debris | Trash | | | | |
Trash at 24" Drain | Trash at 24" Drain | 0 | none |   |   |   |   |   | Debris | Trash | | | | |
Trash at 30" Drain | Trash at 30" Drain | 0 | none |   |   |   |   |   | Debris | Trash | | | | |
Trash at 36" Drain | Trash at 36" Drain | 0 | none |   |   |   |   |   | Debris | Trash | | | | |
Trash at 48" Drain | Trash at 48" Drain | 0 | none |   |   |   |   |   | Debris | Trash | | | | |
Trash at 60" Drain | Trash at 60" Drain | 0 | none |   |   |   |   |   | Debris | Trash | | | | |
Trash, Litter | Trash, Litter | 0 | none |   |   |   |   |   | Habitat | | | | | |
Tree_Diameter | Diameter at breast height of the largest potential legacy tree visible from the location | 0 | m |   |   |   |   |   | Habitat | | | | | |
Tree_Distance | Distance from the wetted edge to the largest potential legacy tree visible from the location | 0 | m |   |   |   |   |   | Habitat | | | | | |
Tree_Height | Height of the largest potential legacy tree visible from the location | 0 | m |   |   |   |   |   | Habitat | | | | | |
Tree_TaxonomicCategoryCode | Taxonomic Category Code of the largest potential legacy tree visible from the location | 0 | none |   |   |   |   |   | Habitat | | | | | |
Triadimefon | Triadimefon | 43121433 |   | ng/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
Triadimenol | Triadimenol | 55219653 |   | ng/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
Triallate | Triallate | 2303175 |   | ng/L |   |   |   |   | Organics | Pesticides | Herbicides | | | |
Tribromophenol, 2,4,6- | 2,4,6-Tribromophenol | 0 |   | ug/L |   |   |   |   | | | | | | |
Tribromophenol, 2,4,6-(Surrogate) | Surrogate: 2,4,6-Tribromophenol | 118796 |   | ug/L |   |   |   |   | Organics | SVOCs | Phenols | non-Chlorinated Phenols | Brominated Phenols | |
Tributyl Phosphorotrithioate, S,S,S- | S,S,S-Tributyl Phosphorotrithioate (Def) (Butifos) (Merphos) | 78488 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-OPs | | | |
Tributylphosphate | Tributylphosphate (TBP) | 0 |   | ug/L |   |   |   |   | | | | | | |
Tributylphosphate(Surrogate) | Surrogate: Tributylphosphate (Butyl Phosphate) | 126738 |   | % recovery | % recovery |   |   |   | Organics | Pesticides | Pest-OPs | | | |
Tributyltin as Sn | Tributyltin as Sn (TBT) | 1461229 |   | ug/L | ug/Kg dw |   | ng/g ww | ng/g dw | Organics | Organotins | Biocide | | | |
Tributyltin as Sn-d27(Surrogate) | Surrogate: Tributyltin as Sn-d27 | 0 |   | % recovery | % recovery |   |   |   | Organics | Organotins | Biocide | | | |
Trichlorfon | Trichlorfon | 52686 |   | ug/L |   |   |   |   | Organics | Pesticides | Pest-OPs | Insecticides | | |
Trichloro-1,2,2-trifluoroethane, 1,1,2- | 1,1,2-Trichloro-1,2,2-trifluoroethane | 79131 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Trichloro-2-pyridinyl)oxy)acetic Acid, ((3,5,6- | ((3,5,6-Trichloro-2-pyridinyl)oxy)acetic Acid (Triclopyr) | 55335063 |   | ug/L |   |   |   |   | Organics | Herbicides | | | | |
Trichlorobenzene, 1,2,3- | 1,2,3-Trichlorobenzene | 87616 |   | ug/L | ug/Kg dw |   |   |   | Organics | VOCs | | | | |
Trichlorobenzene, 1,2,3-(Surrogate) | Surrogate: 1,2,3-Trichlorobenzene | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | | | | | |
Trichlorobenzene, 1,2,4- | 1,2,4-Trichlorobenzene | 120821 |   | ug/L | ug/Kg dw |   |   |   | Organics | SVOCs | | | | |
Trichlorobenzene, 1,3,5- | 1,3,5-Trichlorobenzene | 108703 |   |   | ug/Kg dw |   |   |   | | | | | | |
Trichlorobenzene-13C6, 1,2,3-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3-Trichlorobenzene-13C6 | 0 |   | % recovery | % recovery |   | % recovery | % recovery | Organics | Pest-OCHs | IDA | | | |
Trichloroethane, 1,1,1- | 1,1,1-Trichloroethane | 71556 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Trichloroethane, 1,1,2- | 1,1,2-Trichloroethane | 79005 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Trichloroethylene | Trichloroethylene (Trichloroethene) | 79016 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Trichlorofluoromethane | Trichlorofluoromethane | 75694 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Trichloronate | Trichloronate | 327980 |   | ug/L | ng/g dw |   | ng/g ww | ng/g dw | Organics | Pesticides | Pest-OPs | Insecticides | | |
Trichlorophenol, 2,4,5- | 2,4,5-Trichlorophenol | 95954 |   | ug/L | mg/Kg dw |   |   |   | Organics | SVOCs | Phenols | Chlorinated Phenols | | |
Trichlorophenol, 2,4,6- | 2,4,6-Trichlorophenol | 88062 |   | ug/L | mg/Kg dw |   |   |   | Organics | SVOCs | Phenols | Chlorinated Phenols | | |
Trichlorophenoxy)propionic Acid, 2-(2,4,5- | 2-(2,4,5-Trichlorophenoxy)propionic Acid (2,4,5-TP) (Silvex) (Fenoprop) | 93721 |   | ug/L |   |   |   |   | Organics | Herbicides | | | | |
Trichlorophenoxyacetic Acid, 2,4,5- | 2,4,5-Trichlorophenoxyacetic Acid (2,4,5-T) | 93765 |   | ug/L |   |   |   |   | Organics | Herbicides | | | | |
Trichlorophenoxyacetic Acid, 2,4,5-(Surrogate) | Surrogate: 2,4,5-Trichlorophenoxyacetic Acid (2,4,5-T) | 93765 |   | % recovery | % recovery |   |   |   | Organics | Herbicides | | | | |
Trichloropropane, 1,2,3- | 1,2,3-Tricloropropane | 96184 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Triclocarban | Triclocarban | 101202 |   | ng/L |   |   |   |   | Organics | PPCPs | | | | |
Triclocarban-13C6(Surrogate) | Surrogate: Triclocarban-13C6 | 1216457769 |   | % recovery |   |   |   |   | Organics | PPCPs | | | | |
Triclopyr | Triclopyr | 55335063 |   | ug/L |   |   |   |   | Organics | | | | | |
Triclosan | Triclosan | 3380345 |   | ug/L |   |   |   |   | Organics | PPCPs | | | | |
Triclosan-d3(IsoDilAnalogue) | Isotope Dilution Analogue: Triclosan-d3 | 1020719985 |   | % recovery |   |   |   |   | Organics | | IDA | | | |
Tridimephon | Triadimefon | 43121433 |   | ug/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
Trifloxystrobin | Trifloxystrobin | 141517217 |   | ug/L |   |   |   |   | Organics | Fungicides | | | | |
Triflumizole | Triflumizole | 68694111 |   | ug/L |   |   |   |   | Organics | Fungicides | | | | |
Trifluorotolunene, a,a,a-(Surrogate) | Surrogate: a,a,a-Trifluorotoluene | 0 |   | % recovery |   |   |   |   | Organics | VOCs | | | | |
Trifluralin | Trifluralin | 1582098 |   | ug/L | ng/g dw |   |   |   | Organics | Herbicides | | | | |
Trifluralin-d14(Surrogate) | Surrogate: Trifluralin-d14 | 0 |   | % recovery |   |   |   |   | Organics | Pesticides | | | | |
Trihalomethanes, Total | Total Trihalomethanes | 0 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Trimethoprim | Trimethoprim | 738705 |   | ug/L |   |   | ng/g ww | ng/g dw | Organics | PPCPs | | | | |
Trimethoprim-13C3(Surrogate) | Surrogate: Trimethoprim-13C3 | 0 |   |   |   |   | % recovery | % recovery | Organics | | | | | |
Trimethylbenzene, 1,2,4- | 1,2,4-Trimethylbenzene | 95636 |   | ug/L |   |   |   |   | Organics | VOCs | Herbicides | | | |
Trimethylbenzene, 1,3,5- | 1,3,5-Trimethylbenzene | 108678 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Trimethylnaphthalene, 1,6,7- | 1,6,7-Trimethylnaphthalene | 0 |   |   | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | | | | |
Trimethylnaphthalene, 2,3,5- | 2,3,5-Trimethylnaphthalene | 2245387 |   | ug/L | ug/Kg dw |   | ug/Kg ww | ug/Kg dw | Organics | PAHs | SVOCs | LMW_PAH | | |
Trimethylnaphthalene, 2,3,6- | 2,3,6-Trimethylnaphthalene | 829265 |   | ng/L |   |   |   |   | Organics | PAHs | | | | |
Trimethylphenanthrene, 1,2,6- | 1,2,6-Trimethylphenanthrene | 30436556 |   | ng/L |   |   |   |   | Organics | PAHs | | | | |
Trimethylphenol, 2,4,6-(Surrogate) | Surrogate: 2,4,6-Trimethylphenol | 26998801 |   | % recovery |   |   |   |   | Organics | PAHs | SVOCs | Phenols | Surfactants | |
Trinitrotoluene, 2,4,6- | 2,4,6-Trinitrotoluene (TNT) | 118967 |   | ug/L | ug/kg |   |   |   | Organics | | | | | |
Tripentyltin(Surrogate) | Surrogate: Tripentyltin | 0 |   |   | ug/Kg dw |   |   |   | Organics | | | | | |
Triphenyl Phosphate | Triphenyl Phosphate | 0 |   | ug/L |   |   |   |   | | | | | | |
Triphenyl phosphate(Surrogate) | Surrogate: Triphenyl Phosphate | 115866 |   | ug/L | % recovery |   | % recovery | % recovery | Organics | Pesticides | Pest-OPs | | | |
Tris(1,3-dichloroisopropyl)phosphate | Tris(1,3-dichloroisopropyl)phosphate (TDCPP) | 13674878 |   | ng/L |   |   |   |   | Organics | FlameRetardants | | | | |
Tris(1-chloro-2-propyl)phosphate | Tris(1-chloro-2-propyl)phosphate (TCPP, multiple isomers) | 13674845 |   | ng/L |   |   |   |   | Organics | FlameRetardants | | | | |
Tris(2-chloroethyl)phosphate | Tris(2-chloroethyl)phosphate (TCEP) | 115968 |   | ng/L |   |   |   |   | Organics | FlameRetardants | | | | |
Triticonazole | Triticonazole | 131983727 |   | ng/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
Tritium | Tritium | 10028178 |   | pCi/L |   |   |   |   | Inorganics | | | | | |
Tritium 2scu | Tritium 2-sigma Combined Uncertainty | 0 |   | pCi/L |   |   |   |   | Inorganics | | | | | |
TrophicStatus | General classification of trophic status based on observed algae and herbaceous plant levels | 0 | none |   |   |   |   |   | Habitat | | | | | |
TRPH | Total Recoverable Petroleum Hydrocarbons (TRPH) | 0 |   | mg/L |   |   |   |   | Organics | | | | | |
Turbidity | Turbidity | 0 |   | NTU |   |   |   |   | Inorganics | ConventionalsConventionals | WaterQualityMeasurements | Habitat | | |
Tylosin | Tylosin | 1401690 |   | ug/L |   |   | ng/g ww | ng/g dw | Organics | PPCPs | | | | |
Undercut Distance | Undercut Distance | 0 | m |   |   |   |   |   | Habitat | | | | | |
UplandSlope | Slope of bank or upland area | 0 | % |   |   |   |   |   | Habitat | | | | | |
Uranium | Uranium | 7440611 |   | ug/L |   |   |   |   | Inorganics | | | | | |
Urea | Urea | 0 |   | ug/L |   |   |   |   | Organics | Carbamides | | | | |
Utensil | Utensil | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | FoodService | | |
Valley Width | Valley Width | 0 | m |   |   |   |   |   | Habitat | | | | | |
Vanadium | Vanadium | 7440622 |   | ug/L | mg/Kg nr |   | ug/g ww | ug/g dw | Inorganics | Metals | | | | |
VectorControl_Bs | Vector Control through Bs (Bacillus sphaericus) within waterbody | 0 | none |   |   |   |   |   | Habitat | | | | | |
VectorControl_Bti | Vector Control through Bti (Bacillus Thuringensis Israelensis) within waterbody | 0 | none |   |   |   |   |   | Habitat | | | | | |
VectorControl_Methoprene | Vector Control through Methoprene within waterbody | 0 | none |   |   |   |   |   | Habitat | | | | | |
VectorControl_Mosquitofish | Vector Control through Mosquitofish within waterbody | 0 | none |   |   |   |   |   | Habitat | | | | | |
VectorControl_Oil | Vector Control through Oil within waterbody | 0 | none |   |   |   |   |   | Habitat | | | | | |
Veg_Emergent | Percent cover of emergent vegetation within a given area | 0 | % |   |   |   |   |   | Habitat | | | | | |
Veg_Open | Percent cover of open space within a given area | 0 | % |   |   |   |   |   | Habitat | | | | | |
Veg_SubmergedAlgae | Percent cover of submerged algae within a given area | 0 | % |   |   |   |   |   | Habitat | | | | | |
Veg_SubmergedOther | Percent cover of submerged other (non-algae) within a given area | 0 | % |   |   |   |   |   | Habitat | | | | | |
Veg_SurfaceAlgae | Percent cover of surface algae within a given area | 0 | % |   |   |   |   |   | Habitat | | | | | |
Veg_SurfaceOther | Percent cover of surface other (non-algae) within a given area | 0 | % |   |   |   |   |   | Habitat | | | | | |
Vegetation Cover Bank | Percent of both bank surfaces upstream of sample location estimated to be covered by vegetation (plants & roots at water's edge) | 0 | none |   |   |   |   |   | FieldObservations | Habitat | | | | |
Vegetation Cover Instream | Percent of stream's water surface upstream of sample location estimated to be covered by aquatic vegetation | 0 | none |   |   |   |   |   | FieldObservations | Habitat | | | | |
Vegetation Cover Quality Metric | Metric assesses the quality of vegetation cover in the riparian and channel zones | 0 | score |   |   |   |   |   | Habitat | | | | | |
Vegetation Cover Structure Metric | Metric assesses structural complexity of the riparian environment in the riparian and channel zones (excluding low-flow) and includes any kind of tree, bush, shrub, or helophyte. Grasses are excluded. | 0 | score |   |   |   |   |   | Habitat | | | | | |
Velocity | Velocity | 0 |   | m/s |   |   |   |   | WaterQualityMeasurements | | | | | |
Vinclozolin | Vinclozolin | 50471448 |   | ug/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
Vinyl Chloride | Vinyl Chloride | 75014 |   | ug/L |   |   |   |   | Organics | VOCs | | | | |
Virginiamycin | Virginiamycin | 0 |   |   |   |   | ng/g ww | ng/g dw | Organics | | | | | |
Volume | Volume | 0 |   | L |   |   |   |   | Habitat | | | | | |
W1_HALL_SWAMP | Riparian human disturbance index, all types, proximity-weighted sum | 0 | none |   |   |   |   |   | Bioassessment | | | | | |
Wadeability | Wadeability | 0 | none |   |   |   |   |   | FieldObservations | Habitat | | | | |
Warfarin-d5(Surrogate) | Warfarin-d5(Surrogate) | 791013224 |   |   | % recovery |   |   |   | Organics | Pesticides | Insecticides | | | |
Waste, Food | Waste, Food | 0 | pieces |   |   |   |   |   | Debris | Natural | Non-Plastics | Biodegradable | Marine Origin | |
Waste, Pet | Waste, Pet | 0 | pieces |   |   |   |   |   | Debris | Natural | Non-Plastics | Toxic | | |
Waste, Yard | Waste, Yard | 0 | pieces |   |   |   |   |   | Debris | Natural | Non-Plastics | Biodegradable | Marine Origin | |
Water level below Reference Point | Distance from reference point to water surface | 0 | m |   |   |   |   |   | Habitat | | | | | |
Water Level Fluctuations | Water Level Fluctuations | 0 | none |   |   |   |   |   | Habitat | | | | | |
Water Withdrawal | Water Withdrawal | 0 | none |   |   |   |   |   | Habitat | | | | | |
Waterbody Appeal | Waterbody Appeal | 0 | none |   |   |   |   |   | Habitat | | | | | |
Waterbody Disturbance | Waterbody Disturbance | 0 | none |   |   |   |   |   | Habitat | | | | | |
WaterbodyOrigin | Origin of the waterbody | 0 | none |   |   |   |   |   | Habitat | | | | | |
WaterClarity | WaterClarity | 0 |   | none |   |   |   |   | FieldObservations | Habitat | | | | |
Wave Height | Wave Height | 0 | ft |   |   |   |   |   | | | | | | |
WaveAction | Wind Movement of Water on Surface | 0 | none |   |   |   |   |   | | | | | | |
Weight | Weight | 0 |   |   |   | mg/ind |   |   | Toxicity | | | | | |
WetlandClass | Class or type of wetland | 0 | none |   |   |   |   |   | Habitat | | | | | |
WetlandFunction_FloodControl | Function of the wetland for flood control use | 0 | none |   |   |   |   |   | Habitat | | | | | |
WetlandFunction_HumanUse | Function of the wetland for human use | 0 | none |   |   |   |   |   | Habitat | | | | | |
WetlandFunction_Stormwater | Function of the wetland for stormwater use | 0 | none |   |   |   |   |   | Habitat | | | | | |
WetlandFunction_Wildlife | Function of the wetland for wildlife use | 0 | none |   |   |   |   |   | Habitat | | | | | |
Wetted Width | Wetted Width | 0 | m |   |   |   |   |   | Habitat | | | | | |
Width | Width | 0 | m |   |   |   |   |   | Habitat | | | | | |
WindDirection | WindDirection | 0 | none |   |   |   |   |   | FieldObservations | Habitat | | | | |
WindIntensity | Intensity of wind at the time of sampling | 0 | none |   |   |   |   |   | Habitat | | | | | |
WindSpeed | WindSpeed | 0 | none |   |   |   |   |   | FieldObservations | Habitat | | | | |
Wire | Wire | 0 | pieces |   |   |   |   |   | Debris | Trash | Non-Plastics | Metal | | |
Wood Debris | Wood Debris | 0 | pieces |   |   |   |   |   | Debris | Natural | Non-Plastics | Construction | Marine Origin | |
Wrapper, Food | Wrapper, Food | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Bags/Packaging | | |
Wrapper, Other | Wrapper, Other | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Bags/Packaging | | |
Wrapper, Plastic Straw | Wrapper, Plastic Straw | 0 | pieces |   |   |   |   |   | Debris | Trash | Plastics | Bags/Packaging | | |
XBKF_W | Mean bankfull width of reach | 0 | m |   |   |   |   |   | Bioassessment | | | | | |
XCDENMID | Mean percent mid-channel canopy density | 0 | % |   |   |   |   |   | Bioassessment | | | | | |
XCMG | Riparian cover as sum of three layers physical-habitat metric | 0 | % |   |   |   |   |   | Bioassessment | | | | | |
XCMGW | Mean riparian woody cover as sum of three layers | 0 | none |   |   |   |   |   | Bioassessment | | | | | |
XFC_NAT_SWAMP | Mean sum of natural instream cover types | 0 | none |   |   |   |   |   | Bioassessment | | | | | |
XSLOPE | Mean slope (water surface gradient) of reach | 0 | % |   |   |   |   |   | Bioassessment | | | | | |
Xylene, m/p- | m-Xylene/p-Xylene | 179601231 |   | ug/L |   |   |   |   | Organics | VOCs | MTBE_BTEX | Xylenes | | |
Xylene, o- | o-Xylene | 95476 |   | ug/L |   |   |   |   | Organics | VOCs | MTBE_BTEX | Xylenes | | |
Xylenes, Total | Total Xylenes | 1330207 |   | ug/L |   |   |   |   | Organics | VOCs | MTBE_BTEX | Xylenes | | |
Young/female | Young/female (#) | 0 |   |   |   | Num/Rep |   |   | Toxicity | | | | | |
Ytterbium | Ytterbium | 7440644 |   | ug/L |   |   |   |   | Inorganics | | | | | |
Yttrium | Yttrium | 7440655 |   | ug/L |   |   |   |   | Inorganics | | | | | |
Z-Bifenthrin-d5, (rac-cis)-(Surrogate) | Surrogate: (rac-cis)-Z-Bifenthrin-d5 | 0 |   | % recovery | % recovery |   |   |   | Organics | | | | | |
Zinc | Zinc | 7440666 |   | ug/L | umol/g |   | ug/g ww | ug/g dw | Inorganics | TraceElements | Metals | | | |
Ziram | Ziram | 137304 |   | ug/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |
Zoxamide | Zoxamide | 156052685 |   | ng/L |   |   |   |   | Organics | Pesticides | Fungicides | | | |