| AnalyteName | AnalyteDescr | | 6-Pack Ring | 6-Pack Ring |
| Abnormality | Abnormality (%) |
| Abundance | Abundance |
| AccesstoWaterbody_BikePath | AccesstoWaterbody_BikePath |
| AccesstoWaterbody_Fence | AccesstoWaterbody_Fence |
| AccesstoWaterbody_HeavyVegetation | AccesstoWaterbody_HeavyVegetation |
| AccesstoWaterbody_ParkingLot | AccesstoWaterbody_ParkingLot |
| AccesstoWaterbody_PicnicArea | AccesstoWaterbody_PicnicArea |
| AccesstoWaterbody_RestrictedAccessMaintenanceRoad | AccesstoWaterbody_RestrictedAccessMaintenanceRoad |
| AccesstoWaterbody_Roadway | AccesstoWaterbody_Roadway |
| AccesstoWaterbody_Walkway | AccesstoWaterbody_Walkway |
| Accumulation | Accumulation using Trash Protocol |
| Acenaphthene | Acenaphthene |
| Acenaphthene-d10(Surrogate) | Surrogate: Acenaphthene-d10 |
| Acenaphthenes, C1- | C1-Acenaphthenes |
| Acenaphthylene | Acenaphthylene |
| Acenaphthylene-d8(IsoDilAnalogue) | Isotope Dilution Analogue: Acenaphthylene-d8 |
| Acenaphthylene-d8(Surrogate) | Surrogate: Acenaphthylene-d8 |
| Acetaminophen | Acetaminophen |
| Acetaminophen(Surrogate) | Surrogate: Acetaminophen |
| Acetamiprid | Acetamiprid |
| Acetone | Acetone |
| Acibenzolar-S-methyl | Acibenzolar-S-methyl |
| Acid Neutralizing Capacity | Acid Neutralizing Capacity (ANC) |
| Acid Volatile Sulfides | Acid Volatile Sulfides (AVS) |
| Acifluorfen | Acifluorfen |
| Acrolein | Acrolein |
| Acrylonitrile | Acrylonitrile |
| Aesthetic Condition | Aesthetic Condition |
| AFDM_Algae | Ash Free Dry Mass primarily of Algae but other items may be weighed |
| Age | Age |
| Age Diversity and Natural Regeneration Metric | Metric assesses the age diversity and natural regeneration potential of woody species in the riparian and channel zones (excluding low-flow). |
| Age_Pond | Age (in years) of the pond if it is created |
| Alachlor | Alachlor (Lasso) |
| Aldicarb | Aldicarb |
| Aldicarb Sulfone | Aldicarb Sulfone |
| Aldicarb Sulfoxide | Aldicarb Sulfoxide |
| Aldrin | Aldrin |
| Aldrin(Surrogate) | Surrogate: Aldrin |
| Aldrin-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Aldrin-13C12 |
| Algae | Algae for benthics |
| Algae Cover | Percent of stream's water surface upstream of sample location estimated to be covered with algae |
| Algae-attached | Percent of substrate in wetted channel upstream of sample location estimated to be covered with Algae-attached |
| Algae-floating Mats | Percent of stream's water surface upstream of sample location estimated to be covered with Algae-floating Mats |
| Alkalinity as CaCO3 | Alkalinity as CaCO3 |
| Allethrin | Allethrin |
| Alpha Linolenic Acid | Alpha Linolenic Acid |
| Aluminum | Aluminum |
| Aluminum Foil | Aluminum Foil |
| Aluminum, Organic Monomeric | Organic Monomeric Aluminum (Organic Reactive) |
| Aluminum, Total Monomeric | Total Monomeric Aluminum (Organic + Inorganic Reactive) |
| Aluminum/Steel Can | Aluminum/Steel Can |
| Ametryn | Ametryn |
| Aminocarb | Aminocarb |
| Aminopyralid | Aminopyralid |
| Ammonia as N | Ammonia as N |
| Ammonia as N, Unionized | Unionized Ammonia as N |
| Ammonia as NH3 | Ammonia as NH3 |
| Ammonia as NH3, Unionized | Unionized Ammonia as NH3 |
| Ammonium as N | Ammonium as N (NH4) |
| Ammonium Chloride | Ammonium Chloride |
| Amoxicillin | Amoxicillin |
| AMPA | Aminomethyl Phosphonic Acid (AMPA) |
| AMPA(Surrogate) | Surrogate: Aminomethyl Phosphonic Acid (AMPA) |
| Anatoxin-A | Anatoxin-A |
| Angling Pressure | Angling Pressure |
| Anilazine | Anilazine |
| Aniline | Aniline (Aminobenzene)(Phenylamine) |
| AnimalPresence | describes presence of animals which may include tracks, scat, sounds or physical presence |
| Antennal segment | Antennal segment (#) |
| Anthracene | Anthracene |
| Anthracene-d10(IsoDilAnalogue) | Isotope Dilution Analogue: Anthracene-d10 |
| Anthracene-d10(Surrogate) | Surrogate: Anthracene-d10 |
| Anthropogenic Alt Channel Modification SubMetric | Metric assesses the impact of anthropogenic alterations based on channel modification |
| Anthropogenic Alt Hydromodification SubMetric | Metric assesses the impact of anthropogenic alterations based on hydromodification and Channel Evolution Models (CEMS) |
| Anthropogenic Alterations to Channel Morph Metric | Metric assesses the impact of anthropogenic alterations to channel morphology through hydromodification and channel modification. Metric is an average of the two previous submetrics. |
| Antimony | Antimony |
| Appliance | Appliance |
| AquaticLife | AquaticLife using Trash Protocol |
| Arachidonic | Arachidonic |
| Area | Area |
| Arsenic | Arsenic |
| Arsenic, Inorganic | Inorganic Arsenic |
| Asbestos, Total | Total Asbestos |
| ASCI_D | Score for the Diatom Algal Stream Condition Index |
| ASCI_D_cnt.spp.most.tol_pct_att | Percent of taxa attributed with tolerance value (QA metric) for the Diatom Algal Stream Condition Index |
| ASCI_D_cnt.spp.most.tol_pred | Count of most tolerant algae taxa (predicted) for the Diatom Algal Stream Condition Index |
| ASCI_D_cnt.spp.most.tol_raw | Count of most tolerant algae taxa (raw) for the Diatom Algal Stream Condition Index |
| ASCI_D_cnt.spp.most.tol_scr | Count of most tolerant algae taxa (score) for the Diatom Algal Stream Condition Index |
| ASCI_D_EpiRho.richness_pct_att | Percent of taxa attributed with genus (QA metric) for the Diatom Algal Stream Condition Index |
| ASCI_D_EpiRho.richness_pred | Richness of Epithemia and Rhopalodia taxa (predicted) for the Diatom Algal Stream Condition Index |
| ASCI_D_EpiRho.richness_raw | Richness of Epithemia and Rhopalodia taxa (raw) for the Diatom Algal Stream Condition Index |
| ASCI_D_EpiRho.richness_scr | Richness of Epithemia and Rhopalodia taxa (score) for the Diatom Algal Stream Condition Index |
| ASCI_D_NumberTaxa | Number of diatom taxa |
| ASCI_D_prop.spp.IndicatorClass_TN_low_pct_att | Percent of taxa attributed with nitrogen indicator value (QA metric) for the Diatom Algal Stream Condition Index |
| ASCI_D_prop.spp.IndicatorClass_TN_low_pred | Proportion low total nitrogen indicator taxa (predicted) for the Diatom Algal Stream Condition Index |
| ASCI_D_prop.spp.IndicatorClass_TN_low_raw | Proportion low total nitrogen indicator taxa (raw) for the Diatom Algal Stream Condition Index |
| ASCI_D_prop.spp.IndicatorClass_TN_low_scr | Proportion low total nitrogen indicator taxa (score) for the Diatom Algal Stream Condition Index |
| ASCI_D_prop.spp.Planktonic_pct_att | Percent of taxa attributed with habitat value (QA metric) for the Diatom Algal Stream Condition Index |
| ASCI_D_prop.spp.Planktonic_pred | Proportion planktonic taxa (predicted) for the Diatom Algal Stream Condition Index |
| ASCI_D_prop.spp.Planktonic_raw | Proportion planktonic taxa (raw) for the Diatom Algal Stream Condition Index |
| ASCI_D_prop.spp.Planktonic_scr | Proportion planktonic taxa (score) for the Diatom Algal Stream Condition Index |
| ASCI_D_prop.spp.Trophic.E_pct_att | Percent of taxa attributed with trophic indicator value (QA metric) for the Diatom Algal Stream Condition Index |
| ASCI_D_prop.spp.Trophic.E_pred | Proportion eutrophic taxa (predicted) for the Diatom Algal Stream Condition Index |
| ASCI_D_prop.spp.Trophic.E_raw | Proportion eutrophic taxa (raw) for the Diatom Algal Stream Condition Index |
| ASCI_D_prop.spp.Trophic.E_scr | Proportion eutrophic taxa (score) for the Diatom Algal Stream Condition Index |
| ASCI_D_Salinity.BF.richness_pct_att | Percent of taxa attributed with salinity value (QA metric) for the Diatom Algal Stream Condition Index |
| ASCI_D_Salinity.BF.richness_pred | Richness of brackish/freshwater taxa (predicted) for the Diatom Algal Stream Condition Index |
| ASCI_D_Salinity.BF.richness_raw | Richness of brackish/freshwater taxa (raw) for the Diatom Algal Stream Condition Index |
| ASCI_D_Salinity.BF.richness_scr | Richness of brackish/freshwater taxa (score) for the Diatom Algal Stream Condition Index |
| ASCI_D_ValveCount | Total number of diatom valves reported in the input data (i.e., sum of BAResult) |
| ASCI_H | Score for the Hybrid (diatom and soft-bodied algae) Algal Stream Condition Index |
| ASCI_H_cnt.spp.IndicatorClass_TP_high_pct_att | Percent of taxa attributed phosphorus indicator value (QA metric) for the Hybrid Algal Stream Condition Index |
| ASCI_H_cnt.spp.IndicatorClass_TP_high_pred | Count of high total phosphorus indicator taxa (predicted) for the Hybrid Algal Stream Condition Index |
| ASCI_H_cnt.spp.IndicatorClass_TP_high_raw | Count of high total phosphorus indicator taxa (raw) for the Hybrid Algal Stream Condition Index |
| ASCI_H_cnt.spp.IndicatorClass_TP_high_scr | Count of high total phosphorus indicator taxa (score) for the Hybrid Algal Stream Condition Index |
| ASCI_H_cnt.spp.most.tol_pct_att | Percent of taxa attributed with tolerance value (QA metric) for the Hybrid Algal Stream Condition Index |
| ASCI_H_cnt.spp.most.tol_pred | Count of most tolerant algae taxa (predicted) for the Hybrid Algal Stream Condition Index |
| ASCI_H_cnt.spp.most.tol_raw | Count of most tolerant algae taxa (raw) for the Hybrid Algal Stream Condition Index |
| ASCI_H_cnt.spp.most.tol_scr | Count of most tolerant algae taxa (score) for the Hybrid Algal Stream Condition Index |
| ASCI_H_EpiRho.richness_pct_att | Percent of taxa attributed with genus (QA metric) for the Hybrid Algal Stream Condition Index |
| ASCI_H_EpiRho.richness_pred | Richness of Epithemia and Rhopalodia taxa (predicted) for the Hybrid Algal Stream Condition Index |
| ASCI_H_EpiRho.richness_raw | Richness of Epithemia and Rhopalodia taxa (raw) for the Hybrid Algal Stream Condition Index |
| ASCI_H_EpiRho.richness_scr | Richness of Epithemia and Rhopalodia taxa (score) for the Hybrid Algal Stream Condition Index |
| ASCI_H_NumberTaxa | Number of diatom taxa + soft-bodied algae taxa in Hybrid Algal Stream Condition Index |
| ASCI_H_OxyReD_DO_30.richness_pct_att | Percent of taxa attributed with oxygen tolerance value (QA metric) for the Hybrid Algal Stream Condition Index |
| ASCI_H_OxyReD_DO_30.richness_pred | Richness of algae species with 30% oxygen tolerance (predicted) for the Hybrid Algal Stream Condition Index |
| ASCI_H_OxyReD_DO_30.richness_raw | Richness of algae species with 30% oxygen tolerance (raw) for the Hybrid Algal Stream Condition Index |
| ASCI_H_OxyReD_DO_30.richness_scr | Richness of algae species with 30% oxygen tolerance (score) for the Hybrid Algal Stream Condition Index |
| ASCI_H_prop.spp.Planktonic_pct_att | Percent of taxa attributed with habitat value (QA metric) for the Hybrid Algal Stream Condition Index |
| ASCI_H_prop.spp.Planktonic_pred | Proportion planktonic algae taxa (predicted) for the Hybrid Algal Stream Condition Index |
| ASCI_H_prop.spp.Planktonic_raw | Proportion planktonic algae taxa (raw) for the Hybrid Algal Stream Condition Index |
| ASCI_H_prop.spp.Planktonic_scr | Proportion planktonic algae taxa (score) for the Hybrid Algal Stream Condition Index |
| ASCI_H_prop.spp.Trophic.E_pct_att | Percent of taxa attributed with trophic indicator value (QA metric) for the Hybrid Algal Stream Condition Index |
| ASCI_H_prop.spp.Trophic.E_pred | Proportion eutrophic algae taxa (predicted) for the Hybrid Algal Stream Condition Index |
| ASCI_H_prop.spp.Trophic.E_raw | Proportion eutrophic algae taxa (raw) for the Hybrid Algal Stream Condition Index |
| ASCI_H_prop.spp.Trophic.E_scr | Proportion eutrophic algae taxa (score) for the Hybrid Algal Stream Condition Index |
| ASCI_H_prop.spp.ZHR_pct_att | Proportion of taxa attributed for the Zygnemataceae, heterocystous cyanobacteria, and Rhodophyta Algal taxa metric for the Hybrid Algal Stream Condition Index |
| ASCI_H_prop.spp.ZHR_raw | Proportion Zygnemataceae, heterocystous cyanobacteria, and Rhodophyta Algal taxa (raw) |
| ASCI_H_prop.spp.ZHR_scr | Proportion Zygnemataceae, heterocystous cyanobacteria, and Rhodophyta Algal taxa (score) for the Hybrid Algal Stream Condition Index |
| ASCI_H_Salinity.BF.richness_pct_att | Percent of taxa attributed with salinity value (QA metric) for the Hybrid Algal Stream Condition Index |
| ASCI_H_Salinity.BF.richness_pred | Richness of brackish/freshwater algae taxa (predicted) for the Hybrid Algal Stream Condition Index |
| ASCI_H_Salinity.BF.richness_raw | Richness of brackish/freshwater algae taxa (raw) for the Hybrid Algal Stream Condition Index |
| ASCI_H_Salinity.BF.richness_scr | Richness of brackish/freshwater algae taxa (score) for the Hybrid Algal Stream Condition Index |
| ASCI_S | Score for the Soft-bodied Algal Stream Condition Index |
| ASCI_S_Biovolume | Total soft-bodied algae biovolume reported in the input data (i.e., sum of Result) |
| ASCI_S_EntityCount | Total number of soft-bodied algae entities reported in the input data (i.e., sum of BAResult) |
| ASCI_S_NumberTaxa | Number of soft-bodied algae taxa |
| ASCI_S_prop.spp.IndicatorClass_DOC_high_pct_att | Percent of taxa attributed with dissolved organic carbon indicator value (QA metric) for the Soft-bodied Algal Stream Condition Index |
| ASCI_S_prop.spp.IndicatorClass_DOC_high_raw | Proportion high dissolved organic carbon indicator Algal species (raw) |
| ASCI_S_prop.spp.IndicatorClass_DOC_high_scr | Proportion high dissolved organic carbon indicator Algal species (score) for the Soft-bodied Agae Stream Condition Index |
| ASCI_S_prop.spp.IndicatorClass_NonRef_pct_att | Percent of taxa attributed with reference/non-reference indicator value (QA metric) for the Soft-bodied Algal Stream Condition Index |
| ASCI_S_prop.spp.IndicatorClass_NonRef_raw | Proportion non-reference indicator algae species (raw) for the Soft-bodied Algal Stream Condition Index |
| ASCI_S_prop.spp.IndicatorClass_NonRef_scr | Proportion non-reference indicator algae species (score) for the Soft-bodied Algal Stream Condition Index |
| ASCI_S_prop.spp.IndicatorClass_TP_high_pct_att | Percent of taxa attributed phosphorus indicator value (QA metric) for the Soft-bodied Algal Stream Condition Index |
| ASCI_S_prop.spp.IndicatorClass_TP_high_raw | Proportion high total phosphorus indicator algae taxa (raw) for the Soft-bodied Algal Stream Condition Index |
| ASCI_S_prop.spp.IndicatorClass_TP_high_scr | Proportion high total phosphorus indicator Algal taxa (score) for the Soft-bodied Algal Stream Condition Index |
| ASCI_S_prop.spp.ZHR_pct_att | Proportion of taxa attributed for the Zygnemataceae, heterocystous cyanobacteria, and Rhodophyta Algal taxa metric for the Soft-bodied Algal Stream Condition Index |
| ASCI_S_prop.spp.ZHR_raw | Proportion Zygnemataceae, heterocystous cyanobacteria, and Rhodophyta Algal taxa (raw) for the Soft-bodied Algal Stream Condition Index |
| ASCI_S_prop.spp.ZHR_scr | Proportion Zygnemataceae, heterocystous cyanobacteria, and Rhodophyta Algal taxa (score) for the Soft-bodied Algal Stream Condition Index |
| Ash Free Dry Mass | Ash-Free Dry Mass (AFDM, AFDW) |
| Aspon | Aspon |
| AssemblageIDAlgaeSampleVolume | Volume of material and liquid to produce the soft algae assemblage (taxonomy) sample |
| AssemblageIDDiatomSampleVolume | Volume of material and liquid to produce the diatom assemblage (taxonomy) sample |
| Atenolol | Atenolol |
| Atorvastatin | Atorvastatin |
| Atraton | Atraton |
| Atrazine | Atrazine |
| Atrazine-13C3(IsoDilAnalogue) | Isotope Dilution Analogue: Atrazine-13C3 |
| Atrazine-13C3(Surrogate) | Surrogate: Atrazine-13C3 |
| Atrazine-d5(Surrogate) | Surrogate: Atrazine-d5 |
| Atrazine-Desisopropyl-2-Hydroxy | Atrazine-Desisopropyl-2-Hydroxy |
| Autopart | Autopart |
| Avoidance | Avoidance (%) |
| Azinphos Ethyl | Azinphos Ethyl |
| Azinphos Methyl | Azinphos Methyl (Guthion) |
| Azinphos Methyl oxon | Azinphos Methyl oxon |
| Azinphos-Methyl-d6(IsoDilAnalogue) | Isotope Dilution Analogue: Azinphos-Methyl-d6 |
| Azithromycin | Azithromycin |
| Azobenzene | Azobenzene (Diphenyl Diimide) |
| Azoxystrobin | Azoxystrobin |
| Back Water | Back Water present |
| Bacteroidales, Human (BacH) | Human Bacteroidales Marker BacH |
| Bacteroidales, Human (HF183/BacR287) | Human Bacteroidales, Assay name: HF183/BacR287, 5'-ATCATGAGTTCACATGTCCG-3', 5'-CTTCCTCTCAGAACCCCTATCC-3' |
| Bacteroidales, Human (HF183/BFDrev) | Human Bacteroidales, Assay name: HF183/BFDrev, 5' ATCATGAGTTCACATGTCCG 3', 5' CGTAGGAGTTTGGACCGTGT 3' |
| Bacteroidales, Universal (UniB) | Universal Bacteroidales, Assay name: UniB, 5' GGGGTTCTGAGAGGAAGGT 3', 5' CCGTCATCCTTCACGCTACT 3' |
| Bag, Large/Retail | Bag, Large/Retail |
| Bag, Pet Waste | Bag, Pet Waste |
| Bag, Single Use Plastic | Bag, Single Use Plastic |
| Bag, Takeout | Bag, Takeout |
| Bags/Packaging | Bags/Packaging |
| Balloon, Latex | Balloon, Latex |
| Balloon, Mylar | Balloon, Mylar |
| Bandage/Bandaid | Bandage/Bandaid |
| Bank Angle | Bank Angle |
| Bank Cover | Bank Cover |
| Bank Stability | Bank Stability (score zone 5m up and 5m downstream of transect between bankfull - wetted width) |
| Bankfull Height | Bankfull Height |
| Bankfull Width | Bankfull Width |
| Bankfull Width Reach | Visual estimate of the average bankfull width of the reach |
| Bar Present | Bar Present |
| Bar Width | Bar Width |
| Barban | Barban |
| Barban(Surrogate) | Surrogate: Barban |
| Barium | Barium |
| Barometric Pressure | Barometric Pressure |
| Batteries, Large | Batteries, Large |
| Batteries, Small | Batteries, Small |
| Battery Voltage | Battery Voltage |
| Bearing | Bearing |
| BeaufortScale | BeaufortScale |
| Beaver Flow Modifications | Beaver Flow Modifications |
| Beaver Signs | Beaver Signs |
| Bendiocarb | Bendiocarb |
| Benfluralin | Benfluralin |
| Benomyl | Benomyl |
| Bensulfuron Methyl | Bensulfuron Methyl |
| Bensulide | Bensulide |
| Bentazon | Bentazon |
| Benz(a)anthracene | Benz(a)anthracene |
| Benz(a)anthracene-d12(IsoDilAnalogue) | Isotope Dilution Analogue: Benz(a)anthracene-d12 |
| Benz(a)anthracene-d12(Surrogate) | Surrogate: Benz(a)anthracene-d12 |
| Benz(a)anthracenes/Chrysenes, C1- | C1-Benz(a)anthracenes/Chrysenes |
| Benz(a)anthracenes/Chrysenes, C2- | C2-Benz(a)anthracenes/Chrysenes |
| Benz(a)anthracenes/Chrysenes, C3- | C3-Benz(a)anthracenes/Chrysenes |
| Benz(a)anthracenes/Chrysenes, C4- | C4-Benz(a)anthracenes/Chrysenes |
| Benz(e)pyrene-d12(Surrogate) | Surrogate: Benz(e)pyrene-d12 |
| Benzene | Benzene |
| Benzidine | Benzidine |
| Benzo [a] Pyrene equivalents | Benzo [a] Pyrene equivalents |
| Benzo(a)fluoranthene | Benzo(a)fluoranthene |
| Benzo(a)pyrene | Benzo(a)pyrene |
| Benzo(a)pyrene-d12(IsoDilAnalogue) | Isotope Dilution Analogue: Benzo(a)pyrene-d12 |
| Benzo(a)pyrene-d12(Surrogate) | Surrogate: Benzo(a)pyrene-d12 |
| Benzo(b)fluoranthene | Benzo(b)fluoranthene |
| Benzo(b)fluoranthene-d12(IsoDilAnalogue) | Isotope Dilution Analogue: Benzo(b)fluoranthene-d12 |
| Benzo(b)fluoranthene-d12(Surrogate) | Surrogate: Benzo(b)fluoranthene-d12 |
| Benzo(e)pyrene | Benzo(e)pyrene |
| Benzo(e)pyrene-d12(Surrogate) | Surrogate: Benzo(e)pyrene-d12 |
| Benzo(g,h,i)perylene | Benzo(g,h,i)perylene |
| Benzo(g,h,i)perylene-d12(IsoDilAnalogue) | Isotope Dilution Analogue: Benzo(g,h,i)perylene-d12 |
| Benzo(g,h,i)perylene-d12(Surrogate) | Surrogate: Benzo(g,h,i)perylene-d12 |
| Benzo(j/k)fluoranthene | Benzo(j)fluoranthene/Benzo(k)fluoranthene |
| Benzo(k)fluoranthene | Benzo(k)fluoranthene |
| Benzo(k)fluoranthene-d12(IsoDilAnalogue) | Isotope Dilution Analogue: Benzo(k)fluoranthene-d12 |
| Benzo(k)fluoranthene-d12(Surrogate) | Surrogate: Benzo(k)fluoranthene-d12 |
| Benzobicyclon | Benzobicyclon pesticide |
| Benzofluoranthenes/Benzopyrenes, C1- | C1-Benzofluoranthenes/Benzopyrenes |
| Benzofluoranthenes/Benzopyrenes, C2- | C2-Benzofluoranthenes/Benzopyrenes |
| Benzoic acid | Benzoic acid |
| Benzothiophene | Benzothiophene |
| Benzothiophene, C1- | C1-Benzothiophene |
| Benzothiophene, C2- | C2-Benzothiophene |
| Benzothiophene, C3- | C3-Benzothiophene |
| Benzovindiflupyr | Benzovindiflupyr |
| Benzyl Alcohol | Benzyl Alcohol |
| Beryllium | Beryllium |
| Bicarbonate | Bicarbonate |
| Bifenox | Bifenox |
| Bifenthrin | Bifenthrin |
| Biodegradable | Biodegradeable using Trash Protocol |
| Biodegradable, Other | Biodegradable, Other |
| Biohazard | Biohazard using Trash Protocol |
| Bioluminescence (EC50) | Bioluminescence (EC50) |
| Biomass (wt/orig indiv) | Biomass (weight/original individual) |
| BiomassSampleVolume | Volume of material and liquid filtered to produce the biomass (Ash Free Dry Mass-AFDM) sample |
| Biphenyl | Biphenyl |
| Biphenyl-d10(IsoDilAnalogue) | Isotope Dilution Analogue: Biphenyl-d10 |
| Biphenyl-d10(Surrogate) | Surrogate: Biphenyl-d10 |
| Biphenyls, C1- | C1-Biphenyls |
| Biphenyls, C2- | C2-Biphenyls |
| Bis(2-chloroethoxy)methane | Bis(2-chloroethoxy)methane |
| Bis(2-chloroethyl)ether | Bis(2-chloroethyl)ether |
| Bis(2-chloroisopropyl) ether | Bis(2-chloroisopropyl) ether |
| Bis(2-ethylhexyl)adipate | Bis(2-ethylhexyl)adipate |
| Bis(2-ethylhexyl)phthalate | Bis(2-ethylhexyl)phthalate |
| Bismuth | Bismuth |
| Bisphenol A | Bisphenol A |
| Bisphenol A-d16(IsoDilAnalogue) | Isotope Dilution Analogue: Bisphenol A-d16 |
| Bispyribac Sodium | Bispyribac Sodium |
| Blue-Green Algae Phycocyanin | Blue-Green Algae Phycocyanin (BGA-PC) |
| BOD | Biochemical Oxygen Demand (BOD) - 5 day test |
| BOD10day | Biochemical Oxygen Demand (BOD) - 10 day test |
| Bolstar | Bolstar (Sulprofos) |
| Boron | Boron |
| Boscalid | Boscalid |
| Boscalid-5-hydroxy | 5-Hydroxy-Boscalid |
| Bottle Cap, Metal | Bottle Cap, Metal |
| Bottle Cap, Plastic | Bottle Cap, Plastic |
| Bottle, Beach | Bottle, Beach |
| Bottle, Cleaning | Bottle, Cleaning |
| Bottle, Glass | Bottle, Glass |
| Bottle, Shampoo | Bottle, Shampoo |
| Bottle, Soda | Bottle, Soda |
| Bottle, Sport | Bottle, Sport |
| Bottle, Water | Bottle, Water |
| Boulder | Boulder |
| Brick | Brick |
| Bridge | Bridge |
| Bridge Fence | Bridge Fence |
| Bridge Fence Height | Bridge Fence Height |
| Bridges, Culverts | Bridges, Culverts |
| Broflanilide | Broflanilide |
| Bromacil | Bromacil |
| Bromate | Bromate |
| Bromide | Bromide |
| Bromo-3,5-dimethylphenyl-N-methylcarbamate, 4-(Surrogate) | Surrogate: 4-Bromo-3,5-dimethylphenyl-N-methylcarbamate (BDMC) |
| Bromobenzene | Bromobenzene (Phenyl Bromide) |
| Bromochloromethane | Bromochloromethane |
| Bromodichloromethane | Bromodichloromethane (Dichlorobromomethane) |
| Bromofluorobenzene, 4- | 4-Bromofluorobenzene |
| Bromofluorobenzene, 4-(Surrogate) | Surrogate: 4-Bromofluorobenzene |
| Bromoform | Bromoform (Tribromomethane) |
| Bromomethane | Bromomethane (Methyl Bromide) |
| Bromophenyl Phenyl Ether, 4- | 4-Bromophenyl Phenyl Ether |
| Bromuconazole | Bromuconazole |
| Bulk Density | Bulk Density |
| Burial | Burial |
| Butachlor | Butachlor |
| Butanone, 2- | 2-Butanone (Methyl Ethyl Ketone) |
| Butralin | Butralin |
| Butyl Benzyl Phthalate | Butyl Benzyl Phthalate |
| Butylate | Butylate |
| Butylbenzene, n- | n-Butylbenzene |
| Butylbenzene, sec- | sec-Butylbenzene |
| Butylbenzene, tert- | tert-Butylbenzene |
| C. coli | Campylobactor coli |
| C. jejuni | Campylobactor jejuni |
| Cadmium | Cadmium |
| Caffeine | Caffeine |
| Caffeine-13C(Surrogate) | Surrogate: Caffeine-13C |
| Calcium | Calcium |
| Canopy Cover | Canopy Cover |
| Captafol | Captafol |
| Captan | Captan |
| Carbadox | Carbadox |
| Carbamazepine | Carbamazepine |
| Carbamazepine(Surrogate) | Surrogate: Carbamazepine |
| Carbaryl | Carbaryl |
| Carbazole | Carbazole |
| Carbazole(Surrogate) | Surrogate: Carbazole |
| Carbendazim | Carbendazim |
| Carbofuran | Carbofuran |
| Carbon dioxide, free | Carbon dioxide, free |
| Carbon Dioxide, total | Carbon Dioxide, total |
| Carbon Disulfide | Carbon Disulfide |
| Carbon Tetrachloride | Carbon Tetrachloride |
| Carbon, Total | Total Carbon |
| Carbon-13/Carbon-12 Ratio | Carbon-13/Carbon-12 Ratio |
| Carbon-14 | Carbon-14 |
| Carbon-14 Counting Error | Carbon-14 Counting Error |
| Carbonate | Carbonate |
| Carbophenothion | Carbophenothion (Trithion) |
| Carboxin | Carboxin (6-methyl-N-phenyl-2,3-dihydro-1,4-oxathiine-5-carboxamide) |
| Carfentrazone Ethyl | Carfentrazone Ethyl |
| Cascade/Falls | Cascade/Falls |
| CD/DVD | CD/DVD |
| CDOM | Colored Dissolved Organic Matter |
| Cefotaxime | Cefotaxime |
| Ceramic Pot/Shard | Ceramic Pot/Shard |
| Cerium | Cerium |
| Chamber biomass | Chamber biomass |
| Channel Constraining Feature | Channel Constraining Feature |
| Channel Constraint | Channel Constraint |
| Channel Engineered | Channel has been modified/engineered |
| Channel Margin in Contact | Channel Margin in Contact |
| Channel Pattern | Channel Pattern |
| Channel Unit | Channel Unit |
| Channel Width Reach | Channel width used to define reach |
| Channelization | Channelization |
| Chemical Concentration | Chemical Concentration |
| Chemical Treatment | Chemical Treatment |
| Chloramben | Chloramben |
| Chlorantraniliprole | Chlorantraniliprole |
| Chlorate | Chlorate |
| Chlordane | Chlordane, not otherwise specified |
| Chlordane, cis- | cis-Chlordane (alpha-Chlordane) |
| Chlordane, Technical | Chlordane, mixture of many related chemicals, of which 10 are major components |
| Chlordane, Total | Total Chlordane, sum of cis-chlordane and trans-chlordane |
| Chlordane, trans- | trans-Chlordane (gamma-Chlordane) |
| Chlordane, trans-(Surrogate) | Surrogate: trans-Chlordane (gamma-Chlordane) |
| Chlordane-13C10, trans-(IsoDilAnalogue) | Isotope Dilution Analogue: trans-Chlordane-13C10 (gamma-Chlordane) |
| Chlordene | Chlordene |
| Chlordene, cis- | cis-Chlordene (alpha-Chlordene) |
| Chlordene, trans- | trans-Chlordene (gamma-Chlordene) |
| Chlorfenapyr | Chlorfenapyr |
| Chlorfenvinphos | Chlorfenvinphos |
| Chloride | Chloride |
| Chlorimuron Ethyl | Chlorimuron Ethyl |
| Chlorine, Free | Free Chlorine |
| Chlorine, Total Residual | Total Residual Chlorine |
| Chlorite | Chlorite |
| Chlormefos | Chlormefos |
| Chloro-2-methylphenoxy) Butanoic Acid, 4-(4- | 4-(4-Chloro-2-methylphenoxy) Butanoic Acid (MCPB) |
| Chloro-3-methylphenol, 4- | 4-Chloro-3-methylphenol |
| Chloroaniline, 4- | 4-Chloroaniline |
| Chlorobenzene | Chlorobenzene |
| Chlorobenzene-d5(Surrogate) | Surrogate: Chlorobenzene-d5 |
| Chlorobenzilate | Chlorobenzilate |
| Chloroeicosafluoro-3-Oxaundecane-1-Sulfonic Acid, 11- | 11-Chloroeicosafluoro-3-Oxaundecane-1-Sulfonic Acid |
| Chloroethane | Chlorethane (Ethyl Chloride) |
| Chloroethyl Vinyl Ether, 2- | 2-Chloroethyl Vinyl Ether |
| Chloroform | Chloroform |
| Chlorohexadecafluoro-3-Oxanonane-1-Sulfonic Acid, 9- | 9-Chlorohexadecafluoro-3-Oxanonane-1-Sulfonic Acid |
| Chloromethane | Chloromethane (Methyl Chloride) |
| Chloro-N-(2,6-diethylphenyl) acetamide, 2- | 2-chloro-N-(2,6-diethylphenyl) acetamide |
| Chloro-N-(ethoxymethyl)-N-(2-ethyl-6-methylphenyl)acetamide, 2- | 2-Chloro-N-(ethoxymethyl)-N-(2-ethyl-6-methylphenyl)acetamide (Acetochlor) |
| Chloronaphthalene, 2- | 2-Chloronaphthalene |
| Chloroneb(Surrogate) | Surrogate: Chloroneb |
| Chlorophenol, 2- | 2-Chlorophenol |
| Chlorophenyl Phenyl Ether, 4- | 4-Chlorophenyl Phenyl Ether |
| Chlorophenyl)-N'-methylurea, N-(4- | N-(4-Chlorophenyl)-N'-methylurea |
| Chlorophyll a | Chlorophyll a |
| Chlorophyll a & b | Chlorophyll a & b |
| Chlorophyll b | Chlorophyll b |
| Chlorophyll c | Chlorophyll c |
| Chlorophyll, Total | Total Chlorophyll |
| ChlorophyllSampleVolume | Volume of material and liquid filtered to produce the chlorophyll a sample |
| Chloropicrin | Chloropicrin |
| Chlorothalonil | Chlorothalonil |
| Chlorotoluene, 2- | 2-Chlorotoluene |
| Chlorotoluene, 4- | 4-Chlorotoluene |
| Chloroxuron | Chloroxuron (Chloroxyfenidim) (Norex) |
| Chloroxuron(Surrogate) | Surrogate: Chloroxuron (Chloroxyfenidim) (Norex) |
| Chlorpropham | Chlorpropham |
| Chlorpyrifos | Chlorpyrifos |
| Chlorpyrifos Methyl | Chlorpyrifos Methyl |
| Chlorpyrifos Methyl(Surrogate) | Surrogate: Chlorpyrifos Methyl |
| Chlorpyrifos oxon | Chlorpyrifos Oxon |
| Chlortetracycline | Chlortetracycline |
| Chromium | Chromium |
| Chromium III | Chromium III (Trivalent Chromium) |
| Chromium VI | Chromium VI |
| Chrysene | Chrysene |
| Chrysene/Triphenylene | Chrysene/Triphenylene (CAS #EDF-359) |
| Chrysene-d12(IsoDilAnalogue) | Isotope Dilution Analogue: Chrysene-d12 |
| Chrysene-d12(Surrogate) | Surrogate: Chrysene-d12 |
| Chrysenes, C1- | C1-Chrysenes |
| Chrysenes, C2- | C2-Chrysenes |
| Chrysenes, C3- | C3-Chrysenes |
| Chrysenes, C4- | C4-Chrysenes |
| Cigarette Box/Wrapper | Cigarette Box/Wrapper |
| Cigarette Butt | Cigarette Butt |
| Cinerin-1 | Cinerin-1 |
| Cinerin-2 | Cinerin-2 (Cinerin II) |
| Ciodrin | Ciodrin (Crotoxyphos) |
| Ciprofloxacin | Ciprofloxacin |
| Ciprofloxacin-13C3-N15(Surrogate) | Surrogate: Ciprofloxacin-13C3-N15 |
| Circumference | Circumference |
| Clarithromycin | Clarithromycin |
| Clay | Clay |
| Clinafloxacin | Clinafloxacin |
| Clomazone | Clomazone (Dimethazone) |
| Clostridiales, Human (LACHNO3) | Human Clostridiales, Assay Name: LACHNO3 |
| Clothianidin | Clothianidin |
| Clothianidin-d3(Surrogate) | Surrogate: Clothianidin-d3 |
| Clothianidin-Desmethyl | Clothianidin-Desmethyl |
| Clothing, synthetic fabric | Clothing, synthetic fabric |
| CloudCover | Cloud cover at the time of sampling |
| Cloxacillin | Cloxacillin |
| Cobalt | Cobalt |
| Cobble | Cobble |
| Cocoons | Cocoons (#) |
| COD | Chemical Oxygen Demand (COD) |
| Coliform, Fecal | Fecal Coliform |
| Coliform, Total | Total Coliform |
| CollectionDepth | Depth at which sample was collected |
| CollSub_PlantDead | Algae collected from dead plant (including wood) substratum |
| CollSub_PlantLive | Algae collected from live plant (including wood) substratum |
| CollSub_Rock | Algae collected from rock (including concrete and consolidated sediment) substratum |
| CollSub_SedSoft | Algae collected from soft sediment substratum |
| Color | Color |
| Color, True | Color of water from which turbidity has been removed |
| Commercial | Commercial |
| CompositeVolume | Volume of material and liquid in Composite sample |
| Composition | Composition |
| Computer | Computer |
| Concrete/Asphalt | Concrete/Asphalt |
| Construction | Construction |
| Construction Debris | Construction debris such as brick, wood, sheetrock using Trash Protocol |
| Construction Other | Construction Other |
| Construction Wood/Pellets | Construction Wood/Pellets |
| Container, Chemical | Container, Chemical |
| Container, Juice | Container, Juice |
| Container, Storage | Container, Storage |
| Container, Styrofoam | Container, Styrofoam |
| Copper | Copper |
| Cotinine | Cotinine |
| Coumaphos | Coumaphos |
| CPOM | Coarse particulate organic matter |
| Cropland | Cropland |
| Cryptosporidium | Cryptosporidium |
| CSCI | California Stream Condition Index score, calculated as the average of the O/E and pMMI |
| CSCI_CaptureProb_Abedus | Probability of capturing Abedus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Acari | Probability of capturing Acari calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Acentrella | Probability of capturing Acentrella calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Acneus | Probability of capturing Acneus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Aeshna_Rhionaeshna | Probability of capturing Aeshna or Rhionaeshna calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Agabinus | Probability of capturing Agabinus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Agabus | Probability of capturing Agabus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Agapetus | Probability of capturing Agapetus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Allocosmoecus | Probability of capturing Allocosmoecus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ambrysus | Probability of capturing Ambrysus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ameletus | Probability of capturing Ameletus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ametor | Probability of capturing Ametor calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Amiocentrus | Probability of capturing Amiocentrus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Amphicosmoecus | Probability of capturing Amphicosmoecus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ampumixis | Probability of capturing Ampumixis calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Anacaena | Probability of capturing Anacaena calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Anagapetus | Probability of capturing Anagapetus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Anax | Probability of capturing Anax calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Anchycteis | Probability of capturing Anchycteis calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Antocha | Probability of capturing Antocha calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Apatania | Probability of capturing Apatania calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Archilestes | Probability of capturing Archilestes calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Arctopsyche | Probability of capturing Arctopsyche calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Argia | Probability of capturing Argia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Asellidae | Probability of capturing Asellidae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Asioplax | Probability of capturing Asioplax calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Astacidae | Probability of capturing Astacidae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Atherix | Probability of capturing Atherix calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Atractelmis | Probability of capturing Atractelmis calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Atrichopogon | Probability of capturing Atrichopogon calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Attenella | Probability of capturing Attenella calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Baetis | Probability of capturing Baetis calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Berosus | Probability of capturing Berosus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Bezzia_Palpomyia | Probability of capturing Bezzia or Palpomyia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Blephariceridae | Probability of capturing Blephariceridae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Brachycentrus | Probability of capturing Brachycentrus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Brechmorhoga | Probability of capturing Brechmorhoga calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Caenis | Probability of capturing Caenis calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Calineuria | Probability of capturing Calineuria calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Callibaetis | Probability of capturing Callibaetis calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Callicorixa | Probability of capturing Callicorixa calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Calliperla | Probability of capturing Calliperla calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Caloparyphus_Euparyphus | Probability of capturing Caloparyphus or Euparyphus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Calopterygidae | Probability of capturing Calopterygidae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Camelobaetidius | Probability of capturing Camelobaetidius calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Capniidae | Probability of capturing Capniidae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Caudatella | Probability of capturing Caudatella calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Centroptilum | Probability of capturing Centroptilum calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ceraclea | Probability of capturing Ceraclea calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ceratopogon | Probability of capturing Ceratopogon calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ceratopsyche_Hydropsyche | Probability of capturing Ceratopsyche or Hydropsyche calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Chelifera_Metachela | Probability of capturing Chelifera or Metachela calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Cheumatopsyche | Probability of capturing Cheumatopsyche calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Chimarra | Probability of capturing Chimarra calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Chironominae | Probability of capturing Chironominae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Choroterpes | Probability of capturing Choroterpes calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Chrysops | Probability of capturing Chrysops calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Chyranda | Probability of capturing Chyranda calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Cinygma | Probability of capturing Cinygma calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Cinygmula | Probability of capturing Cinygmula calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Claassenia | Probability of capturing Claassenia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Cleptelmis | Probability of capturing Cleptelmis calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Clinocera | Probability of capturing Clinocera calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Cloeodes | Probability of capturing Cloeodes calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Clostoeca | Probability of capturing Clostoeca calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Cordulegaster | Probability of capturing Cordulegaster calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Corduliidae | Probability of capturing Corduliidae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Corydalus | Probability of capturing Corydalus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Crangonyx | Probability of capturing Crangonyx calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Cryptochia | Probability of capturing Cryptochia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Cryptolabis | Probability of capturing Cryptolabis calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Culicidae | Probability of capturing Culicidae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Culicoides | Probability of capturing Culicoides calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Cultus | Probability of capturing Cultus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Cymbiodyta | Probability of capturing Cymbiodyta calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Dasyhelea | Probability of capturing Dasyhelea calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Desmona | Probability of capturing Desmona calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Despaxia | Probability of capturing Despaxia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Deuterophlebia | Probability of capturing Deuterophlebia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Diamesinae | Probability of capturing Diamesinae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Dicosmoecus | Probability of capturing Dicosmoecus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Dicranota | Probability of capturing Dicranota calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Diphetor | Probability of capturing Diphetor calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Diplectrona | Probability of capturing Diplectrona calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Diura | Probability of capturing Diura calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Dixa | Probability of capturing Dixa calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Dixella | Probability of capturing Dixella calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Dolichopodidae | Probability of capturing Dolichopodidae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Dolophilodes | Probability of capturing Dolophilodes calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Doroneuria | Probability of capturing Doroneuria calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Drunella | Probability of capturing Drunella calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Dubiraphia | Probability of capturing Dubiraphia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Dysmicohermes | Probability of capturing Dysmicohermes calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ecclisomyia | Probability of capturing Ecclisomyia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ecdyonurus | Probability of capturing Ecdyonurus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Enallagma | Probability of capturing Enallagma calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Enochrus | Probability of capturing Enochrus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Epeorus | Probability of capturing Epeorus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ephemerella | Probability of capturing Ephemerella calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ephydridae | Probability of capturing Ephydridae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Eubrianax | Probability of capturing Eubrianax calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Eurylophella | Probability of capturing Eurylophella calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Fallceon | Probability of capturing Fallceon calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Farula | Probability of capturing Farula calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ferrissia | Probability of capturing Ferrissia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Forcipomyia | Probability of capturing Forcipomyia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Fossaria | Probability of capturing Fossaria calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Frisonia | Probability of capturing Frisonia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Gammarus | Probability of capturing Gammarus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Glossiphoniidae | Probability of capturing Glossiphoniidae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Glossosoma | Probability of capturing Glossosoma calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Glutops | Probability of capturing Glutops calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Goera | Probability of capturing Goera calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Gomphus | Probability of capturing Gomphus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Gonomyia | Probability of capturing Gonomyia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Graptocorixa | Probability of capturing Graptocorixa calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Gumaga | Probability of capturing Gumaga calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Gyraulus | Probability of capturing Gyraulus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Gyrinus | Probability of capturing Gyrinus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Haliplus | Probability of capturing Haliplus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Haploperla | Probability of capturing Haploperla calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Hedriodiscus_Odontomyia | Probability of capturing Hedriodiscus or Odontomyia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Helichus | Probability of capturing Helichus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Helicopsyche | Probability of capturing Helicopsyche calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Helisoma | Probability of capturing Helisoma calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Helodon_Prosimulium | Probability of capturing Helodon or Prosimulium calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Helophorus | Probability of capturing Helophorus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Hemerodromia | Probability of capturing Hemerodromia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Heptagenia | Probability of capturing Heptagenia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Hesperoconopa | Probability of capturing Hesperoconopa calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Hesperoperla | Probability of capturing Hesperoperla calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Hesperophylax | Probability of capturing Hesperophylax calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Heterelmis | Probability of capturing Heterelmis calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Heterlimnius | Probability of capturing Heterlimnius calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Heteroplectron | Probability of capturing Heteroplectron calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Hexatoma | Probability of capturing Hexatoma calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Himalopsyche | Probability of capturing Himalopsyche calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Homoleptohyphes | Probability of capturing Homoleptohyphes calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Hyalella | Probability of capturing Hyalella calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Hydatophylax | Probability of capturing Hydatophylax calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Hydra | Probability of capturing Hydra calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Hydraena | Probability of capturing Hydraena calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Hydrobiidae | Probability of capturing Hydrobiidae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Hydrobius | Probability of capturing Hydrobius calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Hydrochus | Probability of capturing Hydrochus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Hydroporus | Probability of capturing Hydroporus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Hydroptila | Probability of capturing Hydroptila calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Hydrotrupes | Probability of capturing Hydrotrupes calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ilybius | Probability of capturing Ilybius calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ironodes | Probability of capturing Ironodes calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ischnura | Probability of capturing Ischnura calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Isogenoides | Probability of capturing Isogenoides calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Isonychia | Probability of capturing Isonychia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Isoperla | Probability of capturing Isoperla calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Juga | Probability of capturing Juga calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Kathroperla | Probability of capturing Kathroperla calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Kogotus | Probability of capturing Kogotus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Laccobius | Probability of capturing Laccobius calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Lara | Probability of capturing Lara calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Lepidostoma | Probability of capturing Lepidostoma calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Lestes | Probability of capturing Lestes calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Lethocerus | Probability of capturing Lethocerus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Leucotrichia | Probability of capturing Leucotrichia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Leucrocuta | Probability of capturing Leucrocuta calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Libellula | Probability of capturing Libellula calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Limnophila | Probability of capturing Limnophila calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Limonia | Probability of capturing Limonia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Liodessus | Probability of capturing Liodessus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Lymnaea | Probability of capturing Lymnaea calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Malenka | Probability of capturing Malenka calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Marilia | Probability of capturing Marilia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Maruina | Probability of capturing Maruina calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Matriella_Serratella | Probability of capturing Matriella or Serratella calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Megarcys | Probability of capturing Megarcys calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Menetus | Probability of capturing Menetus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Meringodixa | Probability of capturing Meringodixa calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Micrasema | Probability of capturing Micrasema calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Microcylloepus | Probability of capturing Microcylloepus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Molophilus | Probability of capturing Molophilus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Moselia | Probability of capturing Moselia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Muscidae | Probability of capturing Muscidae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Mystacides | Probability of capturing Mystacides calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Namamyia | Probability of capturing Namamyia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Narpus | Probability of capturing Narpus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Nectopsyche | Probability of capturing Nectopsyche calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Nematoda | Probability of capturing Nematoda calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Nematomorpha | Probability of capturing Nematomorpha calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Nemotelus | Probability of capturing Nemotelus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Nemoura | Probability of capturing Nemoura calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Neohermes | Probability of capturing Neohermes calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Neophylax | Probability of capturing Neophylax calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Neoplasta | Probability of capturing Neoplasta calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Neothremma | Probability of capturing Neothremma calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Neotrichia | Probability of capturing Neotrichia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Nerophilus | Probability of capturing Nerophilus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Nixe | Probability of capturing Nixe calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Nothotrichia | Probability of capturing Nothotrichia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ochrotrichia | Probability of capturing Ochrotrichia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ochthebius | Probability of capturing Ochthebius calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Octogomphus_specularis | Probability of capturing Octogomphus or specularis calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Oecetis | Probability of capturing Oecetis calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Oemopteryx | Probability of capturing Oemopteryx calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Oligochaeta | Probability of capturing Oligochaeta calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Oligophlebodes | Probability of capturing Oligophlebodes calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Onocosmoecus | Probability of capturing Onocosmoecus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ophiogomphus | Probability of capturing Ophiogomphus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Optioservus | Probability of capturing Optioservus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ordobrevia | Probability of capturing Ordobrevia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Oreodytes | Probability of capturing Oreodytes calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Oreogeton | Probability of capturing Oreogeton calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ormosia | Probability of capturing Ormosia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Orohermes | Probability of capturing Orohermes calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Oroperla | Probability of capturing Oroperla calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Orthocladiinae | Probability of capturing Orthocladiinae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Osobenus | Probability of capturing Osobenus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ostracoda | Probability of capturing Ostracoda calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ostrocada | Probability of capturing Ostrocada calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Oxyethira | Probability of capturing Oxyethira calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Palaeagapetus | Probability of capturing Palaeagapetus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Paltothemis | Probability of capturing Paltothemis calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Paraleptophlebia | Probability of capturing Paraleptophlebia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Paraleuctra | Probability of capturing Paraleuctra calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Paraperla | Probability of capturing Paraperla calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Parapsyche | Probability of capturing Parapsyche calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Parthina | Probability of capturing Parthina calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Pedicia | Probability of capturing Pedicia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Pedomoecus | Probability of capturing Pedomoecus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Peltodytes | Probability of capturing Peltodytes calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Pericoma_Telmatoscopus | Probability of capturing Pericoma or Telmatoscopus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Perlinodes | Probability of capturing Perlinodes calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Perlomyia | Probability of capturing Perlomyia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Petrophila | Probability of capturing Petrophila calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Physa_Physella | Probability of capturing Physa or Physella calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Plumiperla | Probability of capturing Plumiperla calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Podmosta | Probability of capturing Podmosta calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Podonominae | Probability of capturing Podonominae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Polycentropus | Probability of capturing Polycentropus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Postelichus | Probability of capturing Postelichus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Probezzia | Probability of capturing Probezzia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Procloeon | Probability of capturing Procloeon calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Prodiamesinae | Probability of capturing Prodiamesinae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Progomphus | Probability of capturing Progomphus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Prostoia | Probability of capturing Prostoia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Prostoma | Probability of capturing Prostoma calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Protoptila | Probability of capturing Protoptila calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Psephenus | Probability of capturing Psephenus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Pseudolimnophila | Probability of capturing Pseudolimnophila calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Psychoda | Probability of capturing Psychoda calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Psychoglypha | Probability of capturing Psychoglypha calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Psychomyia | Probability of capturing Psychomyia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Pteronarcella | Probability of capturing Pteronarcella calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Pteronarcys | Probability of capturing Pteronarcys calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Ptychopteridae | Probability of capturing Ptychopteridae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Rhabdomastix | Probability of capturing Rhabdomastix calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Rhithrogena | Probability of capturing Rhithrogena calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Rhizelmis | Probability of capturing Rhizelmis calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Rhyacophila | Probability of capturing Rhyacophila calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Rickera | Probability of capturing Rickera calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Sanfilippodytes | Probability of capturing Sanfilippodytes calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Sciomyzidae | Probability of capturing Sciomyzidae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Scirtidae | Probability of capturing Scirtidae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Sialis | Probability of capturing Sialis calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Sierraperla | Probability of capturing Sierraperla calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Sigara | Probability of capturing Sigara calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Silvius | Probability of capturing Silvius calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Simulium | Probability of capturing Simulium calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Siphlonurus | Probability of capturing Siphlonurus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Skwala | Probability of capturing Skwala calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Soliperla | Probability of capturing Soliperla calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Soyedina | Probability of capturing Soyedina calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Sphaeriidae | Probability of capturing Sphaeriidae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Sphaeromatidae | Probability of capturing Sphaeromatidae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Sphaeromias | Probability of capturing Sphaeromias calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Staphylinidae | Probability of capturing Staphylinidae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Stenocolus | Probability of capturing Stenocolus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Stictotarsus | Probability of capturing Stictotarsus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Stilobezzia | Probability of capturing Stilobezzia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Stratiomys | Probability of capturing Stratiomys calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Stygobromus | Probability of capturing Stygobromus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Suwallia | Probability of capturing Suwallia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Sweltsa | Probability of capturing Sweltsa calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Sympetrum | Probability of capturing Sympetrum calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Syrphidae | Probability of capturing Syrphidae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Tabanus_Atylotus | Probability of capturing Tabanus or Atylotus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Taenionema | Probability of capturing Taenionema calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Tanypodinae | Probability of capturing Tanypodinae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Thaumaleidae | Probability of capturing Thaumaleidae calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Timpanoga | Probability of capturing Timpanoga calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Tinodes | Probability of capturing Tinodes calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Tipula | Probability of capturing Tipula calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Triaenodes | Probability of capturing Triaenodes calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Trichoclinocera | Probability of capturing Trichoclinocera calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Trichocorixa | Probability of capturing Trichocorixa calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Tricoryhyphes | Probability of capturing Tricoryhyphes calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Tricorythodes | Probability of capturing Tricorythodes calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Triznaka | Probability of capturing Triznaka calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Tropisternus | Probability of capturing Tropisternus calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Turbellaria | Probability of capturing Turbellaria calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Uvarus_subtilis | Probability of capturing Uvarus or subtilis calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Visoka | Probability of capturing Visoka calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Wiedemannia | Probability of capturing Wiedemannia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Wormaldia | Probability of capturing Wormaldia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Yoraperla | Probability of capturing Yoraperla calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Yphria | Probability of capturing Yphria calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Zaitzevia | Probability of capturing Zaitzevia calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Zapada | Probability of capturing Zapada calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_CaptureProb_Zoniagrion | Probability of capturing Zoniagrion calculated by the California Stream Condition Index (Mazor et al. 2016) |
| CSCI_Clinger_PercentTaxa | Observed percent clinger taxa |
| CSCI_Clinger_PercentTaxa_predicted | Predicted percent clinger taxa |
| CSCI_Clinger_PercentTaxa_score | Score for percent clinger taxa metric |
| CSCI_Coleoptera_PercentTaxa | Observed percent Coleoptera taxa |
| CSCI_Coleoptera_PercentTaxa_predicted | Predicted percent Coleoptera taxa |
| CSCI_Coleoptera_PercentTaxa_score | Score for percent Coleoptera taxa metric |
| CSCI_Count | Total number of organisms in the sample. If purge=T, the post-purge number is shown. A minimum number has not been established, but samples with low values should be evaluated with caution. |
| CSCI_E | The sum of all capture probabilities greater than 0.5 at a site. Interpreted as the total number of common taxa expected at a site. |
| CSCI_EPT_PercentTaxa | Observed percent Ephemeroptera, Plecoptera, and Trichoptera (EPT) taxa |
| CSCI_EPT_PercentTaxa_predicted | Predicted percent Ephemeroptera, Plecoptera, and Trichoptera (EPT) taxa |
| CSCI_EPT_PercentTaxa_score | Scored percent Ephemeroptera, Plecoptera, and Trichoptera (EPT) taxa |
| CSCI_Intolerant_Percent | Observed percent intolerant individuals (CTV<3) |
| CSCI_Intolerant_Percent_predicted | Predicted percent intolerant individuals |
| CSCI_Intolerant_Percent_score | Score for percent intolerant individuals metric |
| CSCI_Mean_O | The number of common taxa (i.e., capture probability greater than 0.5) observed at a site, averaged across iterations. |
| CSCI_MMI | The pMMI score, averaged across 20 iterations. A minimum threshold has not been established, but low values should be considered indicative of degradation. |
| CSCI_MMI_Percentile | The percentile of the pMMI score, relative to the reference distribution. A minimum threshold has not been established, but low values should be considered indicative of degradation. |
| CSCI_Number_of_MMI_Iterations | Number of subsamples used to calculate the pMMI. If the count is less than 500, no subsampling is performed, and this field will show 1. Otherwise, 20 subsamples are performed. |
| CSCI_Number_of_OE_Iterations | Number of subsamples used to calculate the O/E. If the total number of unambiguous taxa is less than 500, no subsampling is performed, and this field will show 1. Otherwise, 20 subsamples are performed. |
| CSCI_OoverE | O/E, calculated as Mean_O divided by E. |
| CSCI_OoverE_Percentile | The percentile of the O/E score, relative to the reference distribution. A minimum threshold has not been established, but low values should be considered indicative of degradation. |
| CSCI_Pcnt_Ambiguous_Individuals | Percent of the total number of individuals excluded from O/E calculation. A maximum number has not been established, but samples with high values should be evaluated with caution. |
| CSCI_Pcnt_Ambiguous_Taxa | Percent of the total number of FinalIDs excluded from O/E calculation. A maximum number has not been established, but samples with high values should be evaluated with caution. |
| CSCI_Percentile | The percentile of CSCI score, relative to the reference distribution |
| CSCI_ProbGroup1 | Probability of membership in Group 1 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016) |
| CSCI_ProbGroup10 | Probability of membership in Group 10 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016) |
| CSCI_ProbGroup11 | Probability of membership in Group 11 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016) |
| CSCI_ProbGroup2 | Probability of membership in Group 2 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016) |
| CSCI_ProbGroup3 | Probability of membership in Group 3 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016) |
| CSCI_ProbGroup4 | Probability of membership in Group 4 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016) |
| CSCI_ProbGroup5 | Probability of membership in Group 5 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016) |
| CSCI_ProbGroup6 | Probability of membership in Group 6 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016) |
| CSCI_ProbGroup7 | Probability of membership in Group 7 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016) |
| CSCI_ProbGroup8 | Probability of membership in Group 8 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016) |
| CSCI_ProbGroup9 | Probability of membership in Group 9 from cluster analysis of reference sites in CSCI development (Mazor et al. 2016) |
| CSCI_Shredder_Taxa | Observed number of shredder taxa |
| CSCI_Shredder_Taxa_predicted | Predicted number of shredder taxa |
| CSCI_Shredder_Taxa_score | Score for shredder taxa metric |
| CSCI_Taxonomic_Richness | Observed taxonomic richness |
| CSCI_Taxonomic_Richness_predicted | Predicted taxonomic richness |
| CSCI_Taxonomic_Richness_score | Score for taxonomic richness metric |
| Cup | Cup |
| Cup, Styrofoam | Cup, Styrofoam |
| Cup, Waxed Paper | Cup, Waxed Paper |
| Cyanazine | Cyanazine |
| Cyanide | Cyanide |
| Cyanobacteria | Potentially toxigenic (PTOX) genera of cyanobacteria |
| CyanotoxinSampleVolume | Volume of material and liquid in Cyanotoxin sample |
| Cyantraniliprole | Cyantraniliprole |
| Cyazofamid | Cyazofamid |
| Cyclaniliprole | Cyclaniliprole |
| Cycloate | Cycloate |
| Cyfluthrin, beta- | beta-Cyfluthrin |
| Cyfluthrin, gamma- | gamma-Cyfluthrin |
| Cyfluthrin, Total | Total Cyfluthrin |
| Cyfluthrin-1 | Cyfluthrin peak 1 |
| Cyfluthrin-2 | Cyfluthrin peak 2 |
| Cyfluthrin-2/Cyflurthrin-4 | Cyfluthrin-2/Cyflurthrin-4 |
| Cyfluthrin-3 | Cyfluthrin peak 3 |
| Cyfluthrin-4 | Cyfluthrin peak 4 |
| Cyhalofop-butyl | Cyhalofop-butyl |
| Cyhalothrin, gamma- | gamma-Cyhalothrin |
| Cyhalothrin, lambda-1 | lambda-Cyhalothrin, peak 1 or Warrior-1 |
| Cyhalothrin, lambda-2 | lambda-Cyhalothrin, peak 2 or Warrior-2 |
| Cyhalothrin, Total | Total Cyhalothrin |
| Cyhalothrin, Total lambda- | Total lambda-Cyhalothrin, sum peaks 1 & 2 |
| Cyhalothrin-d6, Total lambda-(Surrogate) | Surrogate: Total lambda-Cyhalothrin-d6 |
| Cylindrospermopsin | Cylindrospermopsin |
| Cymene, p- | p-Cymene |
| Cymoxanil | Cymoxanil |
| Cypermethrin, Total | Total Cypermethrin, sum peaks 1,2,3 & 4 |
| Cypermethrin-1 | Cypermethrin peak 1 |
| Cypermethrin-13C6(surrogate) | Surrogate: Cypermethrin-13C6 |
| Cypermethrin-2 | Cypermethrin peak 2 |
| Cypermethrin-2/Cypermethrin-4 | Cypermethrin-2/Cypermethrin-4 |
| Cypermethrin-3 | Cypermethrin peak 3 |
| Cypermethrin-4 | Cypermethrin peak 4 |
| Cyproconazole | Cyproconazole |
| Cyprodinil | Cyprodinil |
| Dacthal | Dacthal |
| Dams | Dams |
| DBCE(Surrogate) | Surrogate: Dibutylchlorendate |
| DCBP(p,p') | p,p'-Dichlorobenzophenone (DCBP) |
| DDD(o,p') | o,p'-DDD |
| DDD(o,p')(Surrogate) | Surrogate: o,p'-DDD |
| DDD(p,p') | p,p'-DDD |
| DDD(p,p')(Surrogate) | Surrogate: p,p'-DDD |
| DDD-13C(p,p')(Surrogate) | Surrogate: p,p'-DDD-C13 |
| DDD-13C12(o,p')(IsoDilAnalogue) | Isotope Dilution Analogue: o,p'-DDD-13C12 |
| DDD-13C12(p,p')(IsoDilAnalogue) | Isotope Dilution Analogue: p,p'-DDD-13C12 |
| DDE(o,p') | o,p'-DDE |
| DDE(o,p')(Surrogate) | Surrogate: o,p'-DDE |
| DDE(p,p') | p,p'-DDE |
| DDE(p,p')(Surrogate) | Surrogate: p,p'-DDE |
| DDE-13C12(o,p')(IsoDilAnalogue) | Isotope Dilution Analogue: o,p'-DDE-13C12 |
| DDE-13C12(p,p')(IsoDilAnalogue) | Isotope Dilution Analogue: p,p'-DDE-13C12 |
| DDE-13C12(p,p')(Surrogate) | Surrogate: DDE-13C12(p,p') |
| DDMU(p,p') | p,p'-DDMU |
| DDT(o,p') | o,p'-DDT |
| DDT(o,p')(Surrogate) | Surrogate: o,p'-DDT |
| DDT(p,p') | p,p'-DDT |
| DDT(p,p')(Surrogate) | Surrogate: p,p'-DDT |
| DDT-13C12(o,p')(IsoDilAnalogue) | Isotope Dilution Analogue: o,p'-DDT-13C12 |
| DDT-13C12(p,p')(IsoDilAnalogue) | Isotope Dilution Analogue: p,p'-DDT-13C12 |
| Dead Domestic Animals | Dead Domestic Animals |
| DebrisLandUse_Commercial | DebrisLandUse_Commercial |
| DebrisLandUse_Industrial | DebrisLandUse_Industrial |
| DebrisLandUse_LimitedTimeParking | DebrisLandUse_LimitedTimeParking |
| DebrisLandUse_OpenSpace | DebrisLandUse_OpenSpace |
| DebrisLandUse_Park | DebrisLandUse_Park |
| DebrisLandUse_ParkingLot | DebrisLandUse_ParkingLot |
| DebrisLandUse_Residential | DebrisLandUse_Residential |
| Decafluorobiphenyl(Surrogate) | Surrogate: Decafluorobiphenyl |
| Dehydronifedipine | Dehydronifedipine |
| Deisopropyl-Atrazine | Deisopropyl-Atrazine |
| Deltamethrin | Deltamethrin |
| Deltamethrin/Tralomethrin | Deltamethrin/Tralomethrin |
| Deltamethrin-d6, Total(Surrogate) | Surrogate: Total Deltamethrin-d6 |
| Demeton, Total | Total Demeton |
| Demeton-O | Demeton-O |
| Demeton-s | Demeton-s |
| Density | Density of Sample |
| Deposits | Deposits |
| Desethyl-Atrazine | Desethyl-Atrazine |
| Desethyl-desisopropyl-atrazine | Desethyl-desisopropyl-atrazine |
| Desisopropyl-Atrazine | Desisopropyl-Atrazine |
| Desmethyl-LR | Desmethyl-LR |
| Desmethyl-RR | Desmethyl-RR |
| Desmetryn | Desmetryn |
| Desnitro-imidacloprid | Desnitro-imidacloprid |
| Desthio-prothioconazole | Desthio-prothioconazole |
| Detergent | Detergent |
| Deuterium/Hydrogen Ratio | Deuterium/Hydrogen Ratio |
| Diazepam | Diazepam |
| Diazinon | Diazinon |
| Diazinon oxon | Diazinon oxon |
| Diazinon-d10(IsoDilAnalogue) | Isotope Dilution Analogue: Diazinon-d10 |
| Diazoxon | Diazoxon |
| Dibenz(a,h)anthracene | Dibenz(a,h)anthracene |
| Dibenz(a,h)anthracene, C1- | C1-Dibenz(a,h)anthracene |
| Dibenz(a,h)anthracene, C2- | C2-Dibenz(a,h)anthracene |
| Dibenz(a,h)anthracene, C3- | C3-Dibenz(a,h)anthracene |
| Dibenz(a,h)anthracene-d14(IsoDilAnalogue) | Isotope Dilution Analogue: Dibenz(a,h)anthracene-d14 |
| Dibenz(a,h)anthracene-d14(Surrogate) | Surrogate: Dibenz(a,h)anthracene-d14 |
| Dibenzofuran | Dibenzofuran |
| Dibenzothiophene | Dibenzothiophene |
| Dibenzothiophene-d8(IsoDilAnalogue) | Isotope Dilution Analogue: Dibenzothiophene-d8 |
| Dibenzothiophene-d8(Surrogate) | Surrogate: Dibenzothiophene-d8 |
| Dibenzothiophenes, C1- | C1-Dibenzothiophenes |
| Dibenzothiophenes, C2- | C2-Dibenzothiophenes |
| Dibenzothiophenes, C3- | C3-Dibenzothiophenes |
| Dibenzothiophenes, C4- | C4-Dibenzothiophenes |
| Dibromo-3-Chloropropane, 1,2- | 1,2-Dibromo-3-Chloropropane (DBCP) |
| Dibromo-4-hydroxybenzonitrile, 3,5- | 3,5-Dibromo-4-hydroxybenzonitrile (Bromoxynil) |
| Dibromobiphenyl, 4,4'-(Surrogate) | Surrogate: 4,4'-Dibromobiphenyl |
| Dibromochloromethane | Dibromochloromethane |
| Dibromoethane, 1,2- | 1,2-Dibromoethane |
| Dibromofluoromethane | Dibromofluoromethane |
| Dibromofluoromethane(Surrogate) | Surrogate: Dibromofluoromethane |
| Dibromomethane | Dibromomethane |
| Dibromooctafluorobiphenyl, 4,4'-(Surrogate) | Surrogate: 4,4'-Dibromooctafluorobiphenyl (DBOFB) |
| Dibromooctafluorobiphenyl, 4,4'-(Surrogate)DB-608 | Surrogate: 4,4Â’-Dibromooctafluorobiphenyl run on column DB-608 |
| Dibromooctafluorobiphenyl, 4,4'-(Surrogate)HP-5 | Surrogate: 4,4Â’-Dibromooctafluorobiphenyl run on column HP-5 |
| Dibromopropane, 1,2-(Surrogate) | Surrogate: 1,2-Dibromopropane |
| Dibutylchlorendate(Surrogate) | Surrogate: Dibutylchlorendate (DBCE) |
| Dibutyltin as Sn | Dibutyltin as Sn (DBT) |
| Dicamba | Dicamba (2,5-Dichloro-6-methoxybenzoic Acid) |
| Dichlofenthion | Dichlofenthion |
| Dichlofenthion(Surrogate) | Surrogate: Dichlofenthion |
| Dichlone | Dichlone |
| Dichloran | Dichloran (Botran) (Benzenamine, 2,6-dichloro-4-nitro-) |
| Dichloro-2 butene, cis 1,4- | Cis-1,4-dichloro-2 butene |
| Dichloro-2 butene, trans 1,4- | Trans-1,4-dichloro-2 butene |
| Dichloroacetate(Surrogate) | Surrogate: Dichloroacetate |
| Dichloroaniline, 3,4- | 3,4-Dichloroaniline |
| Dichloroaniline, 3,5- | 3,5-Dichloroaniline |
| Dichlorobenzenamine, 3,4- | 3,4-Dichlorobenzenamine (3,4-DCA) |
| Dichlorobenzene, 1,2- | 1,2-Dichlorobenzene |
| Dichlorobenzene, 1,3- | 1,3-Dichlorobenzene |
| Dichlorobenzene, 1,4- | 1,4-Dichlorobenzene |
| Dichlorobenzene-13C6,1,4-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,4-Dichlorobenzene-13C6 |
| Dichlorobenzene-d4, 1,2-(Surrogate) | Surrogate: 1,2-Dichlorobenzene-d4 |
| Dichlorobenzene-d4, 1,4-(Surrogate) | Surrogate: 1,4-Dichlorobenzene-d4 |
| Dichlorobenzidine, 3,3'- | 3,3'-Dichlorobenzidine |
| Dichlorobenzoic Acid, 3,5- | 3,5-Dichlorobenzoic Acid |
| Dichlorobenzonitrile, 2,6- | 2,6-Dichlorobenzonitrile (Dichlobenil) |
| Dichlorodifluoromethane | Dichlorodifluoromethane |
| Dichloroethane, 1,1- | 1,1-Dichloroethane |
| Dichloroethane, 1,2- | 1,2-Dichloroethane |
| Dichloroethane-d4, 1,2-(Surrogate) | Surrogate: 1,2-Dichloroethane-d4 |
| Dichloroethylene, 1,1- | 1,1-Dichloroethylene (1,1-Dichloroethene) |
| Dichloroethylene, cis 1,2- | cis-1,2-Dichloroethylene (cis-1,2-Dichloroethene) |
| Dichloroethylene, trans 1,2- | trans-1,2-Dichloroethylene (trans-1,2-Dichloroethene) |
| Dichlorophenol, 2,4- | 2,4-Dichlorophenol |
| Dichlorophenol, 2,6- | 2,6-Dichlorophenol |
| Dichlorophenoxyacetic Acid, 2,3-(Surrogate) | Surrogate: 2,3-Dichlorophenoxyacetic Acid (2,3-D) |
| Dichlorophenoxyacetic Acid, 2,4- | 2,4-Dichlorophenoxyacetic Acid (2,4-D) |
| Dichlorophenoxybutyric Acid Methyl Ester, 2,4- | 2,4-Dichlorophenoxybutyric Acid Methyl Ester (2,4-DB Methyl Ester) |
| Dichlorophenoxybutyric Acid, 2,4- | 2,4-Dichlorophenoxybutyric Acid (2,4-DB) |
| Dichlorophenyl Urea, 3,4- | 3,4-Dichlorophenyl Urea (DCPU) |
| Dichlorophenyl-3-methyl Urea, 3,4- | 3,4-Dichlorophenyl-3-methyl Urea (DCPMU) |
| Dichlorophenylacetic Acid, 2,4- (Surrogate) | Surrogate: 2,4-Dichlorophenylacetic Acid |
| Dichloroprop | Dichlorprop (2-(2,4-Dichlorophenoxy)propanoic Acid) |
| Dichloropropane, 1,2- | 1,2-Dichloropropane |
| Dichloropropane, 1,3- | 1,3-Dichloropropane |
| Dichloropropane, 2,2- | 2,2-Dichloropropane |
| Dichloropropene, 1,1- | 1,1-Dichloropropene |
| Dichloropropene, 1,3- | 1,3-Dichloropropene |
| Dichloropropene, cis 1,3- | cis-1,3-Dichloropropene |
| Dichloropropene, Total 1,3- | Total 1,3-Dichloropropene |
| Dichloropropene, trans 1,3- | trans-1,3-Dichloropropene |
| Dichloropropionic Acid, 2,2- | 2,2-Dichloropropionic Acid (Dalapon) |
| Dichloro-pyridine-2-carboxylic Acid, 3,6- | 3,6-Dichloro-pyridine-2-carboxylic Acid (Clopyralid) |
| Dichlorvos | Dichlorvos |
| Diclofenac | Diclofenac (2-(2-(2,6-Dichlorophenylamino)phenyl)acetic Acid) |
| Dicofol | Dicofol |
| Dicrotophos | Dicrotophos |
| Dieldrin | Dieldrin |
| Dieldrin(Surrogate) | Surrogate: Dieldrin |
| Dieldrin-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Dieldrin-13C12 |
| Diesel Fuel | Diesel Fuel |
| Diethatyl-Ethyl | Diethatyl-Ethyl |
| Diethyl phthalate | Diethyl phthalate |
| Diethyl-3-methyl-benzamide, N,N- | N,N-Diethyl-3-methyl-benzamide |
| Diethylstilbestrol | Diethylstilbestrol |
| Difenoconazole | Difenoconazole |
| Diflubenzuron | Diflubenzuron (Difluron) |
| Difluoro-2,2',3,4,4'-Pentabromodiphenyl Ether, 5,6-(Surrogate) | Surrogate: 5,6-Difluoro-2,2',3,4,4'-Pentabromodiphenyl Ether |
| Difluoro-2,2Â’,3,3Â’,4,5,5Â’,6Â’-Octabromodiphenyl Ether 4Â’,6-(Surrogate) | Surrogate: 4Â’,6-Difluoro-2,2Â’,3,3Â’,4,5,5Â’,6Â’-Octabromodiphenyl Ether |
| Digoxigenin | Digoxigenin |
| Digoxin | Digoxin |
| Diisopropyl Ether | Diisopropyl Ether |
| Diltiazem | Diltiazem |
| Dimethoate | Dimethoate |
| Dimethomorph | Dimethomorph |
| Dimethyl Phthalate | Dimethyl Phthalate |
| Dimethyl-2-nitrobenzene, 1,3- | 1,3-Dimethyl-2-nitrobenzene |
| Dimethyl-2-nitrobenzene, 1,3-(Surrogate) | Surrogate: 1,3-Dimethyl-2-nitrobenzene (2,6-Dimethylnitrobenzene) |
| Dimethylchrysene, 5,9- | 5,9-Dimethylchrysene |
| Dimethyldibenzothiophene, 2,4- | 2,4-Dimethyldibenzothiophene |
| Dimethyldibenzothiophene, 4,6- | 4,6-Dimethyldibenzothiophene |
| Dimethylfluorene, 1,7- | 1,7-Dimethylfluorene |
| Dimethylnaphthalene, 1,2- | 1,2-Dimethylnaphthalene |
| Dimethylnaphthalene, 2,6- | 2,6-Dimethylnaphthalene |
| Dimethylnaphthalene, 2,6-(Surrogate) | Surrogate: 2,6-Dimethylnaphthalene |
| Dimethylnaphthalene-d12, 2,6-(IsoDilAnalogue) | Isotope Dilution Analogue: 2,6-Dimethylnaphthalene-d12 |
| Dimethylnaphthalene-d12, 2,6-(Surrogate) | Surrogate: 2,6-Dimethylnaphthalene-d12 |
| Dimethylphenanthrene, 1,5/1,7- | 1,5-Dimethylphenanthrene/1,7-Dimethylphenanthrene |
| Dimethylphenanthrene, 1,7- | 1,7-Dimethylphenanthrene |
| Dimethylphenanthrene, 1,8- | 1,8-Dimethylphenanthrene |
| Dimethylphenanthrene, 2,6- | 2,6-Dimethylphenanthrene |
| Dimethylphenanthrene, 3,6- | 3,6-Dimethylphenanthrene |
| Dimethylphenol, 2,4- | 2,4-Dimethylphenol |
| Dimethylxanthine, 1,7- | Dimethylxanthine, 1,7- |
| Di-n-butyl Phthalate | Di-n-butyl Phthalate |
| Dinitro-2-methylphenol, 4,6- | 4,6-Dinitro-2-methylphenol |
| Dinitrophenol, 2,4- | 2,4-Dinitrophenol |
| Dinitrotoluene, 2,4- | 2,4-Dinitrotoluene |
| Dinitrotoluene, 2,6- | 2,6-Dinitrotoluene |
| Di-n-octyl Phthalate | Di-n-octyl Phthalate |
| Dinoseb | Dinoseb (2,4-Dinitro-6-sec-butylphenol) |
| Dinotefuran | Dinotefuran |
| Dioxa-3H-Perfluorononanoate Acid, 4,8- | 4,8-Dioxa-3H-Perfluorononanote Acid (ADONA) |
| Dioxacarb | Dioxacarb (2-(1,3-Dioxolan-2-yl)phenyl Methylcarbamate) |
| Dioxane, 1,4- | 1,4-Dioxane |
| Dioxathion | Dioxathion |
| Diphenamid | Diphenamid |
| Diphenamid(Surrogate) | Surrogate: Diphenamid |
| Diphenhydramine | Diphenhydramine |
| Diphenylamine | Diphenylamine |
| Diphenylanthracene, 9,10- | 9,10-Diphenylanthracene |
| Diphenylhydrazine, 1,2- | 1,2-Diphenylhydrazine |
| Dipropetryn | Dipropetryn |
| Diquat | Diquat |
| Discharge | Discharge from a calculation |
| DischargeMeasurementMethod | Method used to collect discharge (velocity) measurement |
| DischargeMeasurementRating | Code qualifying the stream discharge measurement quality in relation to the actual flow |
| Dissolved Inorganic Carbon | Dissolved Inorganic Carbon (DIC) |
| Dissolved Organic Carbon | Dissolved Organic Carbon (DOC) |
| Distance from Bank | Distance from Bank |
| Distance to Bankfull | Distance from the wetted edge to the Bankfull mark |
| Distance, Float | Float distance of observed object |
| Distance, Sampled | Distance sampled within a given waterbody |
| Disulfoton | Disulfoton |
| Dithiopyr | Dithiopyr |
| Diuron | Diuron |
| Diuron-d6(Surrogate) | Surrogate: Diuron-d6 |
| Docosahexaenoic Acid | Docosahexaenoic Acid |
| Docosapentaenoic Acid | Docosapentaenoic Acid |
| Dodine | Dodine |
| Dominant Benthic Substrate | Dominant Benthic Substrate - Specific to EMAP BA |
| Dominant Land Use | Dominant Land Use |
| DominantSubstrate | DominantSubstrate |
| Domoic Acid | Domoic Acid |
| Doxycycline | Doxycycline |
| Dredging | Dredging |
| Dry | Dry |
| Dry Weight | Dry Weight |
| Dumping | Dumping using Trash Protocol |
| DW_Algae | Total Dry Weight primarily of Algae but other items may be weighed |
| E. coli | Escherichia coli |
| E. Coli O157:H7 | Escherichia Coli O157:H7 strain |
| Eicosapentaenoate | Eicosapentaenoate |
| ElectricalConductivity | Electrical Conductivity |
| Elevation Difference | Elevation Difference |
| Embeddedness | Embeddedness |
| Emergent | Emergent (%) |
| Emergent juvenile | Emergent juvenile (#) |
| End Time | Time (hh:mm) when a given event ended |
| Endosulfan I | Endosulfan I (alpha-Endosulfan) |
| Endosulfan I(Surrogate) | Surrogate: Endosulfan I (alpha-Endosulfan) |
| Endosulfan I-13C9(IsoDilAnalogue) | Isotope Dilution Analogue: Endosulfan I-13C9 |
| Endosulfan I-d4(Surrogate) | Surrogate: Endosulfan I-d4 |
| Endosulfan II | Endosulfan II (beta-Endosulfan) |
| Endosulfan II(Surrogate) | Surrogate: Endosulfan II (beta-Endosulfan) |
| Endosulfan II-13C9(IsoDilAnalogue) | Isotope Dilution Analogue: Endosulfan II-13C9 |
| Endosulfan II-d4(Surrogate) | Surrogate: Endosulfan II-d4 |
| Endosulfan Sulfate | Endosulfan Sulfate |
| Endosulfan Sulfate-13C9(IsoDilAnalogue) | Isotope Dilution Analogue: Endosulfan Sulfate-13C9 |
| Endrin | Endrin |
| Endrin Aldehyde | Endrin Aldehyde |
| Endrin Aldehyde(Surrogate) | Surrogate: Endrin Aldehyde |
| Endrin Aldehyde-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Endrin Aldehyde-13C12 |
| Endrin Ketone | Endrin Ketone |
| Endrin Ketone-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Endrin Ketone-13C12 |
| Endrin(Surrogate) | Surrogate: Endrin |
| Endrin-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Endrin-13C12 |
| Enrofloxacin | Enrofloxacin |
| Enterococcus | Enterococcus |
| Enterovirus | Enterovirus |
| Epitestosterone | Epitestosterone |
| EPN | EPN |
| EPN(Surrogate) | Surrogate: EPN |
| EPTC | EPTC |
| EPTC(Surrogate) | Surrogate: EPTC |
| Erythromycin-H2O | Erythromycin-H2O |
| Erythromycin-H2O-13C2(Surrogate) | Surrogate: Erythromycin-H2O-13C2 |
| Esfenvalerate | Esfenvalerate |
| Esfenvalerate/Fenvalerate, Total | Total Esfenvalerate/Fenvalerate, sum peaks 1 & 2 |
| Esfenvalerate/Fenvalerate-1 | Esfenvalerate/Fenvalerate peak 1 |
| Esfenvalerate/Fenvalerate-2 | Esfenvalerate/Fenvalerate peak 2 |
| Esfenvalerate-d6, Total(Surrogate) | Surrogate: Total Esfenvalerate-d6, sum peaks 1 & 2 |
| Esfenvalerate-d6-1(Surrogate) | Surrogate: Esfenvalerate-d6 peak 1 |
| Esfenvalerate-d6-2(Surrogate) | Surrogate: Esfenvalerate-d6 peak 2 |
| Estradiol, 17alpha- | 17alpha-Estradiol |
| Estradiol, 17beta- | 17beta-Estradiol |
| Estradiol-d3, 17beta-(IsoDilAnalogue) | Isotope Dilution Analogue: 17beta-Estradiol-d3 |
| Estriol | Estriol |
| Estrone | Estrone |
| Ethaboxam | Ethaboxam |
| Ethafluralin | Ethafluralin |
| Ethalfluralin | Ethalfluralin |
| Ethanol | Ethanol (Ethyl Alcohol) |
| Ethion | Ethion |
| Ethion(Surrogate) | Surrogate: Ethion |
| Ethofenprox | Ethofenprox |
| Ethoprop | Ethoprop (Prophos) |
| Ethyl Ether | Ethyl Ether |
| Ethyl Perfluorooctane Sulfonamido Acetic Acid, N- | N-Ethyl Perfluorooctane Sulfonamido Acetic Acid (Et-PFOSA-AcOH) |
| Ethyl Perfluorooctane Sulfonamido Acetic Acid-d5, N-(IsoDilAnalogue) | Isotope Dilution Analogue: N-Ethyl Perfluorooctane Sulfonamido Acetic Acid-d5 (N-EtFOSAA) |
| Ethyl Tert-butyl Ether | Ethyl Tert-butyl Ether (ETBE) |
| Ethylbenzene | Ethylbenzene |
| Ethylene Glycol | Ethylene Glycol |
| Ethyl-perfluorooctanesulfonamide, N- | N-Ethyl-perfluorooctanesulfonamide |
| Ethyl-perfluorooctanesulfonamide-d5, N-(IsoDilAnalogue) | Isotope Dilution Analogue: N-Ethyl-perfluorooctanesulfonamide-d5 (N-EtFOSA) |
| Ethyl-perfluorooctanesulfonamidoethanol, N- | N-Ethyl-perfluorooctanesulfonamidoethanol |
| Ethyl-perfluorooctanesulfonamidoethanol-d9, N-(IsoDilAnalogue) | Isotope Dilution Analogue: N-Ethyl-perfluorooctanesulfonamidoethanol-d9 (N-EtFOSE) |
| Ethynylestradiol, 17alpha- | 17alpha-Ethynylestradiol |
| Ethynylestradiol-d4, 17alpha-(IsoDilAnalogue) | Isotope Dilution Analogue: 17alpha-Ethynylestradiol-d4 |
| Etoxazole | Etoxazole |
| Europium | Europium |
| Ev_FlowHab | Evenness of flow habitat types physical-habitat metric |
| Evidence of Fire | Evidence of Fire |
| Evidence of Fire Intensity | Evidence of Fire Intensity - Specific to EMAP BA |
| Evidence of Illegal Connection | Evidence of Illegal Connection |
| Evidence of Illegal Dumping | Evidence of Illegal Dumping |
| Evidence of Recent Rainfall | Evidence of Recent Rainfall |
| Evidence of Scour | Site is affected by recent scouring event |
| E-waste | E-waste |
| Fabric | Fabric |
| FabricCloth | Fabric Cloth using Trash Protocol |
| Famoxadone | Famoxadone |
| Famphur | Famphur |
| FBDE 069 | Fluorobrominated Diphenyl Ether (FBDE) 069 (4'-Fluoro-2,3',4,6-tetrabromodiphenyl ether) |
| FBDE 160 | Fluorobrominated Diphenyl Ether (FBDE) 160 (4'-Fluoro-2,3,3',4,5,6-hexabromodiphenyl ether) |
| Fenamidone | Fenamidone |
| Fenamiphos | Fenamiphos (Phosphoramidic acid, Isopropyl-, 4-(methylthio)-m-tolyl Ethyl Ester) |
| Fenarimol | Fenarimol |
| Fenbuconazole | Fenbuconazole |
| Fenchlorphos | Fenchlorphos (Ronnel) |
| Fenhexamid | Fenhexamid |
| Fenitrothion | Fenitrothion |
| Fenpropathrin | Fenpropathrin (Danitol) |
| Fenpropathrin-d6(Surrogate) | Surrogate: Fenpropathrin-d6 |
| Fenpyroximate | Fenpyroximate |
| Fensulfothion | Fensulfothion |
| Fenthion | Fenthion (Mercaptophos) |
| Fenuron | Fenuron |
| Fenvalerate | Fenvalerate |
| Fenvalerate-d5(Surrogate) | Surrogate: Fenvalerate-d5 |
| Fertilization | Fertilization (%) |
| Fertilized eggs per nest | Fertilized eggs per nest (#) |
| Filling Time | Time to fill a collection device with water |
| Fine | Fine |
| Fipronil | Fipronil |
| Fipronil Amide | Fipronil Amide |
| Fipronil Desulfinyl | Fipronil Desulfinyl |
| Fipronil Desulfinyl Amide | Fipronil Desulfinyl Amide |
| Fipronil Sulfide | Fipronil Sulfide |
| Fipronil Sulfone | Fipronil Sulfone |
| Fipronil-13C4 15N2(Surrogate) | Surrogate: Fipronil-13C4 15N2 |
| Fipronil-C13(Surrogate) | Surrogate: Fipronil-C13 |
| Fireworks | Fireworks |
| Fish Cover Artificial Structures | Fish Cover/Instream Habitat Complexity – Other Artificial Structures |
| Fish Cover Boulders | Fish Cover/Instream Habitat Complexity – Other Boulders |
| Fish Cover Filamentous Algae | Fish Cover/Instream Habitat Complexity - Other Filamentous Algae |
| Fish Cover Live Trees/Roots | Fish Cover/Instream Habitat Complexity – Other Live Trees or Roots |
| Fish Cover Macrophytes | Fish Cover/Instream Habitat Complexity - Macrophytes |
| Fish Cover Overhang.Veg | Fish Cover/Instream Habitat Complexity – Other Overhanging Vegetation =<1 m of surface |
| Fish Cover Undercut Banks | Fish Cover/Instream Habitat Complexity – Other Undercut Banks |
| Fish Cover Woody Debris <0.3 m | Fish Cover/Instream Habitat Complexity – Other Woody Debris <0.3 m |
| Fish Cover Woody Debris >0.3 m | Fish Cover/Instream Habitat Complexity – Other Woody Debris >0.3 m |
| Fish Stocking | Fish Stocking |
| Fishing Line/Net | Fishing Line/Net |
| Float Time | Float time of observed object |
| Floatables | Floatables |
| Flonicamid | Flonicamid |
| Florpyrauxifen-Benzyl | Florpyrauxifen-Benzyl |
| Fluazinam | Fluazinam |
| Flubendiamide | Flubendiamide |
| Flucythrinate | Flucythrinate |
| Fludioxonil | Fludioxonil |
| Flufenacet | Flufenacet |
| Fluindapyr | Fluindapyr |
| Flumequine | Flumequine |
| Flumetralin | Flumetralin |
| Flumetsulam | Flumetsulam |
| Flumioxazin | Flumioxazin |
| Fluometuron | Fluometuron |
| Fluopicolide | Fluopicolide |
| Fluopyram | Fluopyram |
| Fluoranthene | Fluoranthene |
| Fluoranthene/Pyrenes, C1- | C1-Fluoranthene/Pyrenes |
| Fluoranthene-d10(IsoDilAnalogue) | Isotope Dilution Analogue: Fluoranthene-d10 |
| Fluoranthene-d10(Surrogate) | Surrogate: Fluoranthene-d10 |
| Fluoranthenes/Pyrenes, C2- | C2-Fluoranthenes/Pyrenes |
| Fluoranthenes/Pyrenes, C3- | C3-Fluoranthenes/Pyrenes |
| Fluoranthenes/Pyrenes, C4- | C4-Fluoranthenes/Pyrenes |
| Fluorene | Fluorene |
| Fluorenes, C1- | C1-Fluorenes |
| Fluorenes, C2- | C2-Fluorenes |
| Fluorenes, C3- | C3-Fluorenes |
| Fluorescence | Fluorescence |
| Fluoride | Fluoride |
| Fluoro-2,3',6-Tribromodiphenyl Ether, 4'-(Surrogate) | Surrogate: 4'-Fluoro-2,3',6-tribromodiphenyl Ether |
| Fluorobiphenyl, 2- | 2-Fluorobiphenyl |
| Fluorobiphenyl, 2-(Surrogate) | Surrogate: 2-Fluorobiphenyl |
| Fluorophenol, 2- | 2-Fluorophenol |
| Fluorophenol, 2-(Surrogate) | Surrogate: 2-Fluorophenol |
| Fluorotelomer Carboxylic Acid, 3:3- | 3:3 Fluorotelomer carboxylic acid (2H, 2H, 3H, 3H-perfluorohexanoic acid) (3:3 FTCA) |
| Fluorotelomer Carboxylic Acid, 5:3- | 5:3 Fluorotelomer carboxylic acid (2H, 2H, 3H, 3H-perfluorooctanoic acid) (5:3 FTCA) |
| Fluorotelomer Carboxylic Acid, 7:3- | 7:3 Fluorotelomer carboxylic acid (2H, 2H, 3H, 3H-perfluorodecanoic acid) (7:3 FTCA) |
| Fluorotelomer Sulfonate, 4:2- | 4:2-Fluorotelomer Sulfonate (4:2 FTS) |
| Fluorotelomer Sulfonate, 6:2- | 6:2-Fluorotelomer Sulfonate (6:2 FTS) |
| Fluorotelomer Sulfonate, 8:2- | 8:2-Fluorotelomer Sulfonate (8:2 FTS) |
| Fluorotelomer Sulfonate-13C2, 4:2-(IsoDilAnalogue) | Isotope Dilution Analogue: 4:2-Fluorotelomer Sulfonate-13C2 (4:2 FTS) |
| Fluorotelomer Sulfonate-13C2, 6:2-(IsoDilAnalogue) | Isotope Dilution Analogue: 6:2-Fluorotelomer Sulfonate-13C2 (6:2 FTS) |
| Fluorotelomer Sulfonate-13C2, 8:2-(IsoDilAnalogue) | Isotope Dilution Analogue: 8:2-Fluorotelomer Sulfonate-13C2 (8:2 FTS) |
| Fluoxastrobin | Fluoxastrobin |
| Fluoxetine | Fluoxetine |
| Fluoxetine-d5(Surrogate) | Surrogate: Fluoxetine-d5 |
| Flupyradifurone | Flupyradifurone |
| Fluridone | Fluridone |
| Fluridone(Surrogate) | Surrogate: Fluridone |
| Flusilazole | Flusilazole |
| Flutolanil | Flutolanil |
| Flutriafol | Flutriafol |
| Fluvalinate | Fluvalinate |
| Fluxapyroxad | Fluxapyroxad |
| Foam Ball | Foam Ball |
| Foliose Algae | Foliose Algae |
| Folpet | Folpet |
| Fonofos | Fonofos (Dyfonate) |
| Fonofos-13C6(IsoDilAnalogue) | Isotope Dilution Analogue: Fonofos-13C6 |
| Food Service | Food Service |
| Food Service, Other | Food Service, Other |
| Forest Dominant Age Class | Forest Dominant Age Class |
| Formate(Surrogate) | Surrogate: Formate |
| FPOM | Fine particulate organic matter |
| Furniture | Furniture |
| Gage Height | Water surface level measured against a staff gage within a given waterbody |
| Galaxolide | Galaxolide |
| Galaxolide-d6(Surrogate) | Surrogate: Galaxolide-d6 |
| Gallium | Gallium |
| Garbage Bag of Trash | Garbage Bag of Trash |
| Gasoline | Gasoline |
| Gemfibrozil | Gemfibrozil |
| Gemfibrozil-d6(IsoDilAnalogue) | Isotope Dilution Analogue: Gemfibrozil-d6 |
| Gemfibrozil-d6(Surrogate) | Surrogate: Gemfibrozil-d6 |
| Germination | Germination (%) |
| Giardia | Giardia |
| Glass | Glass using Trash Protocol |
| Glass Servicewear | Glass Servicewear |
| Glass Shard | Glass Shard |
| Glide | Glide |
| Glide/Pool Bank Stability | Glide/Pool Bank Stability (used for EMAP RBP 20-score habitat characterization) |
| Glide/Pool Channel Alteration | Glide/Pool Channel Alteration |
| Glide/Pool Channel Flow Status | Glide/Pool Channel Flow Status |
| Glide/Pool Channel Sinuosity | Glide/Pool Channel Sinuosity |
| Glide/Pool Epifaunal Substrate | Glide/Pool Epifaunal Substrate |
| Glide/Pool Pool Substrate | Glide/Pool Pool Substrate |
| Glide/Pool Pool Variability | Glide/Pool Pool Variability |
| Glide/Pool Riparian Zone Width | Glide/Pool Riparian Zone Width |
| Glide/Pool Sediment Deposition | Glide/Pool Sediment Deposition |
| Glide/Pool Vegetative Protection | Glide/Pool Vegetative Protection |
| Glyphosate | Glyphosate |
| Gold | Gold |
| Granule | Granule |
| Granule + Pebble | Granule + Pebble |
| Gravel | Gravel |
| Grazing_Recent | Evidence of grazing activiy by cattle within the past year |
| Gross Alpha | Gross Alpha |
| Gross Beta | Gross Beta |
| Growth (ash-free dry wt/surv indiv) | Growth (ash-free dry wt/surv indiv) |
| Growth (Chlorophyll a fluorescence) | Growth (Chlorophyll a fluorescence) |
| Growth (Chlorophyll a) | Growth (Chlorophyll a) |
| Growth (gonad) | Growth (gonad) |
| Growth (length head capsule) | Growth (length head capsule) |
| Growth (length) | Growth (length) |
| Growth (wt/surv indiv) | Growth (weight/surviving individual) |
| Growth Ratio | Growth Ratio (final measurement / initial measurement) |
| H_AqHab | Shannon diversity of natural instream cover types physical-habitat metric |
| H_SubNat | Shannon diversity of natural substrate types physical-habitat metric |
| HabitatType | HabitatType |
| Halauxifen-methyl | Halauxifen-methyl |
| Halosulfuron Methyl | Halosulfuron Methyl |
| Hard Plastic Piece, non-specific | Hard Plastic Piece, non-specific |
| Hardness as CaCO3 | Hardness as CaCO3 |
| Hatchability | Hatchability (%) |
| HCH, alpha- | alpha-Hexachlorocyclohexane (HCH) (alpha-BHC) |
| HCH, beta- | beta-Hexachlorocyclohexane (HCH) (beta-BHC) |
| HCH, beta-(Surrogate) | Surrogate: beta-Hexachlorocyclohexane (HCH) (beta-BHC) |
| HCH, delta- | delta-Hexachlorocyclohexane (HCH) (delta-BHC) |
| HCH, delta-(Surrogate) | Surrogate: delta-HCH |
| HCH, gamma- | gamma-Hexachlorocyclohexane (HCH) (gamma-BHC) (Lindane) |
| HCH, gamma-(Surrogate) | Surrogate: gamma-Hexachlorocyclohexane (HCH) (gamma-BHC) (Lindane) |
| HCH-13C6, alpha-(IsoDilAnalogue) | Isotope Dilution Analogue: alpha-Hexachlorocyclohexane-13C6 (HCH) (alpha-BHC) |
| HCH-13C6, beta-(IsoDilAnalogues) | Isotope Dilution Analogue: beta-Hexachlorocyclohexane-13C6 (HCH) (beta-BHC) |
| HCH-13C6, delta-(IsoDilAnalogue) | Isotope Dilution Analogue: delta-Hexachlorocyclohexane-13C6 (HCH) (delta-BHC) |
| HCH-13C6, gamma-(IsoDilAnalogue) | Isotope Dilution Analogue: gamma-Hexachlorocyclohexane-13C6 (HCH) (gamma-BHC) (Lindane) |
| Heptachlor | Heptachlor |
| Heptachlor Epoxide | Heptachlor Epoxide |
| Heptachlor Epoxide(Surrogate) | Surrogate: Heptachlor Epoxide |
| Heptachlor Epoxide-13C10(IsoDilAnalogue) | Isotope Dilution Analogue: Heptachlor Epoxide-13C10 |
| Heptachlor(Surrogate) | Surrogate: Heptachlor |
| Heptachlor-13C10(IsoDilAnalogue) | Isotope Dilution Analogue: Heptachlor-13C10 |
| Hexachlorobenzene | Hexachlorobenzene |
| Hexachlorobenzene(Surrogate) | Surrogate: Hexachlorobenzene |
| Hexachlorobenzene-13C6(IsoDilAnalogue) | Isotope Dilution Analogue: Hexachlorobenzene-13C6 |
| Hexachlorobutadiene | Hexachlorobutadiene |
| Hexachlorocyclopentadiene | Hexachlorocyclopentadiene |
| Hexachloroethane | Hexachloroethane |
| Hexahydro-1,3,5-trinitro-1,3,5-triazine | Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) |
| Hexanone, 2- | 2-Hexanone |
| Hexazinone | Hexazinone |
| Hiking Trails | Hiking Trails |
| Holmium | Holmium |
| Homeless Encampment, Distance from Transect | Homeless Encampment, Distance from Transect |
| Homeless Encampment, Distance from Transect Downstream | Homeless Encampment, Distance from Transect Downstream |
| Homeless Encampment, Distance from Transect Upstream | Homeless Encampment, Distance from Transect Upstream |
| Homeless Encampment, Within Transect | Homeless Encampment, Within Transect |
| Hose Piece | Hose Piece |
| Household | Household |
| Household, Other | Household, Other |
| HpCDD, 1,2,3,4,6,7,8- | 1,2,3,4,6,7,8-Heptachlorodibenzo-p-dioxin (HpCDD) |
| HPCDD, 1,2,3,4,6,7,8- (TEQ ND=0) | 1,2,3,4,6,7,8-HPCDD (TEQ ND=0) |
| HPCDD, 1,2,3,4,6,7,8- (TEQ ND=1/2 DL) | 1,2,3,4,6,7,8-HPCDD (TEQ ND=1/2 DL) |
| HpCDD, 1,2,3,4,6,7,8-(Surrogate) | Surrogate: 1,2,3,4,6,7,8-Heptachlorodibenzo-p-dioxin (HpCDD) |
| HpCDD-13C, 1,2,3,4,6,7,8-(Surrogate) | Surrogate: 1,2,3,4,6,7,8-Heptachlorodibenzo-p-dioxin-13C (HpCDD) |
| HpCDD-13C12, 1,2,3,4,6,7,8-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3,4,6,7,8-HpCDD-13C12 |
| HpCDF, 1,2,3,4,6,7,8- | 1,2,3,4,6,7,8-Heptachlorodibenzofuran (HpCDF) |
| HPCDF, 1,2,3,4,6,7,8- (TEQ ND=0) | 1,2,3,4,6,7,8-HPCDF (TEQ ND=0) |
| HPCDF, 1,2,3,4,6,7,8- (TEQ ND=1/2 DL) | 1,2,3,4,6,7,8-HPCDF (TEQ ND=1/2 DL) |
| HpCDF, 1,2,3,4,6,7,8-(Surrogate) | Surrogate: 1,2,3,4,6,7,8-Heptachlorodibenzofuran |
| HpCDF, 1,2,3,4,6,7,8,9-(Surrogate) | Surrogate: 1,2,3,4,6,7,8,9-Heptachlorodibenzofuran |
| HpCDF, 1,2,3,4,7,8,9- | 1,2,3,4,7,8,9-Heptachlorodibenzofuran (HpCDF) |
| HPCDF, 1,2,3,4,7,8,9- (TEQ ND=0) | 1,2,3,4,7,8,9-HPCDF (TEQ ND=0) |
| HPCDF, 1,2,3,4,7,8,9- (TEQ ND=1/2 DL) | 1,2,3,4,7,8,9-HPCDF (TEQ ND=1/2 DL) |
| HpCDF, 1,2,3,4,7,8,9-(Surrogate) | Surrogate: 1,2,3,4,7,8,9-Heptachlorodibenzofuran (HpCDF) |
| HpCDF-13C12, 1,2,3,4,6,7,8-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3,4,6,7,8-HpCDF-13C12 |
| HpCDF-13C12, 1,2,3,4,7,8,9-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3,4,7,8,9-HpCDF-13C12 |
| Human Adenovirus | Human Adenovirus |
| Human Norovirus GI | Human Norovirus GI |
| Human Norovirus GII | Human Norovirus GII |
| Human Waste/Diaper | Human Waste/Diaper |
| HumanHealth | HumanHealth using Trash Protocol |
| HxCDD, 1,2,3,4,7,8- | 1,2,3,4,7,8-Hexachlorodibenzo-p-dioxin (HxCDD) |
| HXCDD, 1,2,3,4,7,8- (TEQ ND=0) | 1,2,3,4,7,8-HXCDD (TEQ ND=0) |
| HXCDD, 1,2,3,4,7,8- (TEQ ND=1/2 DL) | 1,2,3,4,7,8-HXCDD (TEQ ND=1/2 DL) |
| HxCDD, 1,2,3,4,7,8-(Surrogate) | Surrogate: 1,2,3,4,7,8-Hexachlorodibenzo-p-dioxin (HxCDD) |
| HxCDD, 1,2,3,6,7,8- | 1,2,3,6,7,8-Hexachlorodibenzo-p-dioxin (HxCDD) |
| HXCDD, 1,2,3,6,7,8- (TEQ ND=0) | 1,2,3,6,7,8-HXCDD (TEQ ND=0) |
| HXCDD, 1,2,3,6,7,8- (TEQ ND=1/2 DL) | 1,2,3,6,7,8-HXCDD (TEQ ND=1/2 DL) |
| HxCDD, 1,2,3,6,7,8-(Surrogate) | Surrogate: 1,2,3,6,7,8-Hexachlorodibenzo-p-dioxin (HxCDD) |
| HxCDD, 1,2,3,7,8,9- | 1,2,3,7,8,9-Hexachlorodibenzo-p-dioxin (HxCDD) |
| HXCDD, 1,2,3,7,8,9- (TEQ ND=0) | 1,2,3,7,8,9-HXCDD (TEQ ND=0) |
| HXCDD, 1,2,3,7,8,9- (TEQ ND=1/2 DL) | 1,2,3,7,8,9-HXCDD (TEQ ND=1/2 DL) |
| HxCDD-13C, 1,2,3,6,7,8-(Surrogate) | Surrogate: 1,2,3,6,7,8-Hexachlorodibenzo-p-dioxin-13C (HxCDD) |
| HxCDD-13C12, 1,2,3,4,7,8-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3,4,7,8-HxCDD-13C12 |
| HxCDD-13C12, 1,2,3,6,7,8-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3,6,7,8-HxCDD-13C12 |
| HxCDD-13C12, 1,2,3,7,8,9-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3,7,8,9-Hexachlorodibenzo-p-dioxin-13C12 (HxCDD) |
| HxCDF, 1,2,3,4,7,8- | 1,2,3,4,7,8-Hexachlorodibenzofuran (HxCDF) |
| HXCDF, 1,2,3,4,7,8- (TEQ ND=0) | 1,2,3,4,7,8-HXCDF (TEQ ND=0) |
| HXCDF, 1,2,3,4,7,8- (TEQ ND=1/2 DL) | 1,2,3,4,7,8-HXCDF (TEQ ND=1/2 DL) |
| HxCDF, 1,2,3,4,7,8-(Surrogate) | Surrogate: 1,2,3,4,7,8-Hexachlorodibenzofuran (HxCDF) |
| HxCDF, 1,2,3,6,7,8- | 1,2,3,6,7,8-Hexachlorodibenzofuran (HxCDF) |
| HXCDF, 1,2,3,6,7,8- (TEQ ND=0) | 1,2,3,6,7,8-HXCDF (TEQ ND=0) |
| HXCDF, 1,2,3,6,7,8- (TEQ ND=1/2 DL) | 1,2,3,6,7,8-HXCDF (TEQ ND=1/2 DL) |
| HxCDF, 1,2,3,6,7,8-(Surrogate) | Surrogate: 1,2,3,6,7,8-Hexachlorodibenzofuran (HxCDF) |
| HxCDF, 1,2,3,7,8,9- | 1,2,3,7,8,9-Hexachlorodibenzofuran (HxCDF) |
| HXCDF, 1,2,3,7,8,9- (TEQ ND=0) | 1,2,3,7,8,9-HXCDF (TEQ ND=0) |
| HXCDF, 1,2,3,7,8,9- (TEQ ND=1/2 DL) | 1,2,3,7,8,9-HXCDF (TEQ ND=1/2 DL) |
| HxCDF, 1,2,3,7,8,9-(Surrogate) | Surrogate: 1,2,3,7,8,9-Hexachlorodibenzofuran (HxCDF) |
| HxCDF, 2,3,4,6,7,8- | 2,3,4,6,7,8-Hexachlorodibenzofuran (HxCDF) |
| HXCDF, 2,3,4,6,7,8- (TEQ ND=0) | 2,3,4,6,7,8-HXCDF (TEQ ND=0) |
| HXCDF, 2,3,4,6,7,8- (TEQ ND=1/2 DL) | 2,3,4,6,7,8-HXCDF (TEQ ND=1/2 DL) |
| HXCDF, 2,3,4,6,7,8-(Surrogate) | Surrogate: 2,3,4,6,7,8-Hexachlorodibenzofuran (HxCDF) |
| HxCDF-13C12, 1,2,3,4,7,8-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3,4,7,8-HxCDF-13C12 |
| HxCDF-13C12, 1,2,3,6,7,8-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3,6,7,8-HxCDF-13C12 |
| HxCDF-13C12, 1,2,3,7,8,9-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3,7,8,9-HxCDF-13C12 |
| HxCDF-13C12, 2,3,4,6,7,8-(IsoDilAnalogue) | Isotope Dilution Analogue: 2,3,4,6,7,8-HxCDF-13C12 |
| Hydraulic Height | Height from bottom of stream to top of bankfull height or the summation of station water depth and bankfull height |
| Hydrogen Sulfide | Hydrogen Sulfide |
| Hydrolyzable Phosphorus + Orthophosphate as P | Hydrolyzable Phosphorus + Orthophosphate as P |
| Hydroperiod | Hydroperiod of the waterbody |
| Hydroxide | Hydroxide |
| Hydroxyatrazine, 2- | 2-Hydroxyatrazine |
| Hydroxycarbofuran, 3- | 3-Hydroxycarbofuran |
| Hydroxy-ibuprofen, 2- | 2-Hydroxy-ibuprofen |
| Hydroxy-Imidacloprid, 5- | 5-Hydroxy-Imidacloprid |
| Ibuprofen | Ibuprofen |
| Ibuprofen-d3(IsoDilAnalogue) | Isotope Dilution Analogue: Ibuprofen-d3 |
| Imazalil | Imazalil |
| Imazamox | Imazamox |
| Imazapyr | Imazapyr |
| Imazaquin | Imazaquin |
| Imazethapyr | Imazethapyr |
| Imidacloprid | Imidacloprid |
| Imidacloprid olefin | Imidacloprid olefin |
| Imidacloprid urea | Imidacloprid urea |
| Imidacloprid-d4(Surrogate) | Surrogate: Imidacloprid-d4 |
| Incised Height | Incised Height |
| Increment | Increment |
| Indaziflam | Indaziflam |
| Indeno(1,2,3-c,d)pyrene | Indeno(1,2,3-c,d)pyrene |
| Indeno(1,2,3-c,d)pyrene-d12(IsoDilAnalogue) | Isotope Dilution Analogue: Indeno(1,2,3-c,d)pyrene-d12 |
| Indeno(1,2,3-c,d)pyrene-d12(Surrogate) | Surrogate: Indeno(1,2,3-c,d)pyrene-d12 |
| Indoxacarb | Indoxacarb |
| Industrial Plants | Industrial Plants |
| Instream Plant Cover | Instream Plant Cover |
| IntertidalSubstrateCharacteristics_Mud | IntertidalSubstrateCharacteristics_Mud |
| IntertidalSubstrateCharacteristics_Rocky | IntertidalSubstrateCharacteristics_Rocky |
| IntertidalSubstrateCharacteristics_Sand | IntertidalSubstrateCharacteristics_Sand |
| IntertidalSubstrateCharacteristics_Vegetated | IntertidalSubstrateCharacteristics_Vegetated |
| Iopromide | Ioprmide |
| Iopromide-d3(IsoDilAnalogue) | Isotope Dilution Analogue: Iopromide-d3 |
| Ipconazole | Ipconazole |
| IPI | Score for the Index of Physical-habitat Integrity (IPI) |
| IPI_Ev_FlowHab_qa | Quality assurance metric for the evenness of flow habitat types physical-habitat metric, calculated as the percent of expected measurements present in the input data |
| IPI_Ev_FlowHab_score | Scored evenness of flow habitat types physical-habitat metric |
| IPI_H_AqHab_pred | Predicted Shannon diversity of natural instream cover types physical-habitat metric |
| IPI_H_AqHab_qa | Quality assurance metric for the Shannon diversity of natural instream cover types physical-habitat metric, calculated as the percent of expected measurements present in the input data |
| IPI_H_AqHab_score | Scored Shannon diversity of natural instream cover types physical-habitat metric |
| IPI_H_SubNat_qa | Quality assurance metric for the Shannon diversity of natural substrate types physical-habitat metric, calculated as the percent of expected measurements present in the input data |
| IPI_H_SubNat_score | Scored Shannon diversity of natural substrate types physical-habitat metric |
| IPI_IPI_qa | Quality assurance metric for the Index of Physical-habitat Integrity score, calculated as the minimum of other quality assurance metric values |
| IPI_PCT_SAFN_pred | Predicted percent sands and fines streambed substrate physical-habitat metric |
| IPI_PCT_SAFN_qa | Quality assurance metric for the percent sands and fines physical-habitat metric, calculated as the percent of expected measurements present in the input data |
| IPI_PCT_SAFN_score | Scored percent sands and fines streambed substrate physical-habitat metric |
| IPI_XCMG_pred | Predicted riparian cover as sum of three layers physical-habitat metric |
| IPI_XCMG_qa | Quality assurance metric for the riparian cover metric, calculated as the percent of expected measurements present in the input data |
| IPI_XCMG_score | Scored riparian cover as sum of three layers physical-habitat metric |
| Iprodione | Iprodione |
| IQ Test - Fluorescence (EC50) | IQ Test - Fluorescence (EC50) |
| Iron | Iron |
| Irrigation Equipment | Irrigation Equipment |
| Isofenphos | Isofenphos |
| Isofetamid | Isofetamid |
| Isophorone | Isophorone |
| Isopropyl Alcohol | Isopropyl Alcohol (2-propanol) |
| Isopropylbenzene | Isopropylbenzene (Cumene) |
| Isopropyltoluene, p- | p-Isopropyltoluene |
| Isotopes | Isotopes |
| Isoxaben | Isoxaben (Flexidor) (Gallery) |
| Isoxaben(Surrogate) | Surrogate: Isoxaben (Flexidor) (Gallery) |
| Jasmolin-1 | Jasmolin-1 (Jasmolin I) |
| Jasmolin-2 | Jasmolin-2 (Jasmolin II) |
| Kelp holdfast | Kelp holdfast |
| Kelp Stipe/Blade | Kelp Stipe/Blade |
| Kepone | Kepone (Chlordecone) |
| Ketocarbofuran, 3- | 3-Ketocarbofuran |
| Keyboard | Keyboard |
| Kresoxim-methyl | Kresoxim-methyl |
| Lanthanum | Lanthanum |
| Large | Large using Trash Protocol |
| Large/Unmovable, Other | Large/Unmovable, Other |
| Larval abnormality | Larval abnormality |
| Lead | Lead |
| Length | Length |
| Length Downstream | Length Downstream from X location |
| Length Pool | Length Pool |
| Length Reach | Length Reach |
| Length Riffle | Length Riffle |
| Length Root | Length Root |
| Length Shoot | Length Shoot |
| Length Upstream | Length Upstream from X location |
| Length, Segment | Segment Length |
| Leptophos | Leptophos |
| Level Of Trash | Level Of Trash using Trash Protocol |
| Lid | Lid |
| Lighter | Lighter |
| Liming | Liming |
| Lincomycin | Lincomycin |
| Linuron | Linuron |
| Linuron-d6(Surrogate) | Surrogate: Linuron-d6 |
| Lipid | Lipid |
| Lithium | Lithium |
| Littering | Littering using Trash Protocol |
| Live young | Live young (#) |
| Livestock Use | Livestock Use |
| Logging | Logging |
| Lomefloxacin | Lomefloxacin |
| Loss On Ignition | Loss On Ignition |
| LWD >0.8 DLE, Length >15m | LWD >0.8 DLE, Length >15m |
| LWD >0.8m DLE, Length 1.5-5m | LWD >0.8m DLE, Length 1.5-5m |
| LWD >0.8m DLE, Length 5-15m | LWD >0.8m DLE, Length 5-15m |
| LWD 0.1-<0.3m DLE, Length >15m | LWD 0.1-<0.3m DLE, Length >15m |
| LWD 0.1-<0.3m DLE, Length 1.5-5m | LWD 0.1-<0.3m DLE, Length 1.5-5m |
| LWD 0.1-<0.3m DLE, Length 5-15m | LWD 0.1-<0.3m DLE, Length 5-15m |
| LWD 0.3-<0.6m DLE, Length >15 | LWD 0.3-<0.6m DLE, Length >15 |
| LWD 0.3-<0.6m DLE, Length 1.5-5m | LWD 0.3-<0.6m DLE, Length 1.5-5m |
| LWD 0.3-<0.6m DLE, Length 5-15m | LWD 0.3-<0.6m DLE, Length 5-15m |
| LWD 0.6-<0.8m DLE, Length >15m | LWD 0.6-<0.8m DLE, Length >15m |
| LWD 0.6-<0.8m DLE, Length 1.5-5m | LWD 0.6-<0.8m DLE, Length 1.5-5m |
| LWD 0.6-<0.8m DLE, Length 5-15 | LWD 0.6-<0.8m DLE, Length 5-15 |
| LWD A | Large Woody Debris in the A class of corresponding Diameter and Length categories |
| LWD L | Large Woody Debris in the L class of corresponding Diameter and Length categories |
| LWD M | Large Woody Debris in the M class of corresponding Diameter and Length categories |
| LWD S | Large Woody Debris in the S class of corresponding Diameter and Length categories |
| LWD T | Large Woody Debris in the T class of corresponding Diameter and Length categories |
| Lyngbyatoxin-a | Lyngbyatoxin-a |
| Macroalgae Cover, Attached | Presence/Absence of attached macroalgae at a point along a transect |
| Macroalgae Cover, Unattached | Presence/Absence of unattached macroalgae at a point along a transect |
| Macroinvertebrate Habitat Patch Richness Metric | Metric assesses macroinvertebrate habitat patch richness along the channel edge and bank within the assessment area. |
| Macrophyte Cover | Presence/Absence of macrophytes at a point along a transect |
| Magnesium | Magnesium |
| Maintained Lawns | Maintained Lawns |
| Malaoxon | Malaoxon |
| Malathion | Malathion |
| Mancozeb | Mancozeb |
| Mandestrobin | Mandestrobin |
| Mandipropamid | Mandipropamid |
| Manganese | Manganese |
| Marine, Other | Marine, Other |
| Mature | Mature (%) |
| Mature females | Mature females (%) |
| MBAS | MBAS (Methylene Blue Active Substances) |
| MCPA | MCPA (2-Methyl-4-chlorophenoxy)Acetic Acid) (2,4-MCPA) |
| MCPP | MCPP (2-(2-Methyl-4-chlorophenoxy) Propionic Acid) |
| Mean Percent Normal Alive | The observed number of normal larvae divided by the mean number of live embryos inoculated at the beginning of the test |
| Mechanical Pencil | Mechanical Pencil |
| Median Effective Concentration | Median Effective Concentration |
| Median Inhibatory Concentration | Median Inhibatory Concentration |
| Medical Device | Medical Device |
| Meprobamate | Meprobamate |
| Mercury | Mercury |
| Mercury, Methyl | Methyl Mercury |
| Merphos | Merphos (Tributylphosphorotrithioite) |
| Mesh Size | Mesh Size |
| Metal | Metal using Trash Protocol |
| Metal Object | Metal Object |
| Metal Pipe/Bar | Metal Pipe/Bar |
| Metal, Other | Metal, Other |
| Metalaxyl | Metalaxyl |
| Metalaxyl-hydroxymethyl | Metalaxyl-hydroxymethyl |
| Metconazole | Metconazole |
| MeterAveragingInterval | Time period (seconds) upon which the meter reading is averaged internally to attain a result |
| Methadone | Methadone |
| Methamidophos | Methamidophos (O,S-Dimethyl thiophosphate) |
| Methidathion | Methidathion |
| Methiocarb | Methiocarb |
| Methomyl | Methomyl |
| Methoprene | Methoprene |
| Methoxychlor | Methoxychlor |
| Methoxychlor(Surrogate) | Surrogate: Methoxychlor |
| Methoxychlor-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Methoxychlor-13C12 |
| Methoxyfenozide | Methoxyfenozide |
| Methyl (3,4-dichlorophenyl)carbamate | Methyl (3,4-dichlorophenyl)carbamate (Swep) |
| Methyl 3-Amino-2,5-dichlorobenzoate | Methyl 3-Amino-2,5-dichlorobenzoate (Chloramben Methyl) |
| Methyl Perfluorooctane Sulfonamido Acetic Acid, N- | N-Methyl Perfluorooctane Sulfonamido Acetic Acid (Me-PFOSA-AcOH) |
| Methyl Perfluorooctane Sulfonamido Acetic Acid-d3, N-(IsoDilAnalogue) | Isotope Dilution Analogue: N-Methyl Perfluorooctane Sulfonamido Acetic Acid-d3 (N-MeFOSAA) |
| Methyl Tert-butyl Ether | Methyl Tert-butyl Ether (MTBE) |
| Methyl-2-pentanone, 4- | 4-Methyl-2-pentanone (Methyl Isobutyl Ketone) |
| Methylanthracene | Methylanthracene |
| Methylanthracene, 2- | 2-Methylanthracene |
| Methylbenzo(a)pyrene, 7- | 7-Methylbenzo(a)pyrene |
| Methylchlolanthrene, 3- | Methylchlolanthrene, 3- |
| Methylchrysene, 1- | 1-Methylchrysene |
| Methylchrysene, 5/6- | 5-Methylchrysene/6-Methylchrysene |
| Methyldibenzothiophene, 2- | 2-Methyldibenzothiophene |
| Methyldibenzothiophene, 4- | 4-Methyldibenzothiophene |
| Methyldibenzothiophenes, 2/3- | 2-Methyldibenzothiophene/3-Methyldibenzothiophene |
| Methylene Chloride | Methylene Chloride (Dichloromethane) |
| Methylfluoranthene, 2- | 2-Methylfluoranthene |
| Methylfluoranthene, 3- | 3-Methylfluoranthene |
| Methylfluoranthene, 3-/Benzo(a)fluorene | 3-Methylfluoranthene/Benzo(a)fluorene |
| Methylfluorene, 1- | 1-Methylfluorene |
| Methylfluorene, 2- | 2-Methylfluorene |
| Methylnaphthalene, 1- | 1-Methylnaphthalene |
| Methylnaphthalene, 2- | 2-Methylnaphthalene |
| Methylnaphthalene-d10, 2-(IsoDilAnalogue) | Isotope Dilution Analogue: 2-Methylnaphthalene-d10 |
| Methylnaphthalene-d10, 2-(Surrogate) | Surrogate: 2-Methylnaphthalene-d10 |
| Methyl-perfluorooctanesulfonamide, N- | N-Methyl-perfluorooctanesulfonamide |
| Methyl-perfluorooctanesulfonamide-d3, N-(IsoDilAnalogue) | Isotope Dilution Analogue: N-Methyl-perfluorooctanesulfonamide-d3 (N-MeFOSA) |
| Methyl-perfluorooctanesulfonamidoethanol, N- | N-Methyl-perfluorooctanesulfonamidoethanol |
| Methyl-perfluorooctanesulfonamidoethanol-d7, N-(IsoDilAnalogue) | Isotope Dilution Analogue: N-Methyl-perfluorooctanesulfonamidoethanol-d7 (N-MeFOSE) |
| Methylphenanthrene | Methylphenanthrene |
| Methylphenanthrene, 1- | 1-Methylphenanthrene |
| Methylphenanthrene, 2- | 2-Methylphenanthrene |
| Methylphenanthrene, 3- | 3-Methylphenanthrene |
| Methylphenanthrene, 3/4- | 3/4-Methylphenanthrene |
| Methylphenanthrene, 9/4- | 9/4-Methylphenanthrene |
| Methylphenol, 2- | 2-Methylphenol |
| Methylphenol, 3- | 3-Methylphenol |
| Methylphenol, 3/4- | 3-Methylphenol/4-Methylphenol |
| Methylphenol, 4- | 4-Methylphenol |
| Metolachlor | Metolachlor |
| Metolachlor, S- | S-Metolachlor |
| Metolachlor-13C6(Surrogate) | Surrogate: Metolachlor-13C6 |
| Metribuzin | Metribuzin |
| Metsulfuron Methyl | Metsulfuron Methyl |
| Mevinphos | Mevinphos (Phosdrin) |
| Mexacarbate | Mexacarbate |
| Miconazole | Miconazole |
| Microalgae Thickness | Thickness of microalgae (if present) at a point along a transect |
| Microcystin-LA | Microcystin-LA (MCY-LA) |
| Microcystin-LF | Microcystin-LF (MCY-LF) |
| Microcystin-LR | Microcystin-LR (MCY-LR) |
| Microcystin-LW | Microcystin-LW (MCY-LW) |
| Microcystin-LY | Microcystin-LY (MCY-LY) |
| Microcystin-RR | Microcystin-RR (MCY-RR) |
| Microcystins, Total | Total Microcystins |
| Microcystin-YR | Microcystin-YR (MCY-YR) |
| Milk Carton | Milk Carton |
| Mines, Quaries | Mines, Quaries |
| Mirex | Mirex |
| Mirex(Surrogate) | Surrogate: Mirex |
| Mirex-13C10(IsoDilAnalogue) | Isotope Dilution Analogue: Mirex-13C10 |
| Miscellaneous | Miscellaneous using Trash Protocol |
| Miscellaneous, Other | Miscellaneous, Other |
| Moisture | Moisture |
| Molinate | Molinate (Ordram) |
| Molybdenum | Molybdenum |
| Molybdenum, Acid Labile | Acid Labile Molybdenum |
| Monobutyltin as Sn | Monobutyltin as Sn (MBT) |
| Monocrotophos | Monocrotophos |
| Monuron | Monuron |
| Monuron(Surrogate) | Surrogate: Monuron |
| Mortality/Abnormality | Mortality/Abnormality (%) |
| Mortality/Normality | Mortality/Normality (%) |
| Motor Oil | Motor Oil |
| Mutagenicity | Mutagenicity |
| Myclobutanil | Myclobutanil |
| Nail/Screw/Bolt | Nail/Screw/Bolt |
| Naled | Naled (Dibrom) |
| Naphthalene | Naphthalene |
| Naphthalene-d8(IsoDilAnalogue) | Isotope Dilution Analogue: Naphthalene-d8 |
| Naphthalene-d8(Surrogate) | Surrogate: Naphthalene-d8 |
| Naphthalenes, C1- | C1-Naphthalenes |
| Naphthalenes, C2- | C2-Naphthalenes |
| Naphthalenes, C3- | C3-Naphthalenes |
| Naphthalenes, C4- | C4-Naphthalenes |
| Naphthobenzothiophene | Naphthobenzothiophene |
| Naphthobenzothiophene, C1- | C1-Naphthobenzothiophene |
| Naphthobenzothiophene, C2- | C2-Naphthobenzothiophene |
| Naphthobenzothiophene, C3- | C3-Naphthobenzothiophene |
| Napropamide | Napropamide |
| Naproxen | Naproxen |
| Naproxen-d3(IsoDilAnalogue) | Isotope Dilution Analogue: Naproxen-d3 |
| Natural, cotton/wool | Natural, cotton/wool |
| Neburon | Neburon |
| Neodymium | Neodymium |
| Nest | Nest (%) |
| Nickel | Nickel |
| Nicosulfuron | Nicosulfuron |
| NID as CTAS | 4-Nitro-Inden-1-One (NID) as Cobalt Thiocyanate Active Substances (CTAS) |
| Niobium | Niobium |
| Nitrapyrin | Nitrapyrin |
| Nitrate + Nitrite as N | Nitrate + Nitrite as N |
| Nitrate as N | Nitrate as N |
| Nitrate as NO3 | Nitrate as Nitrate |
| Nitrite as N | Nitrite as N |
| Nitroaniline, 2- | 2-Nitroaniline |
| Nitroaniline, 3- | 3-Nitroaniline |
| Nitroaniline, 4- | 4-Nitroaniline |
| Nitrobenzene | Nitrobenzene |
| Nitrobenzene-d5(Surrogate) | Surrogate: Nitrobenzene-d5 |
| Nitrogen Oxide | Nitrogen Oxide |
| Nitrogen, Inorganic | Inorganic Nitrogen as N |
| Nitrogen, Organic | Organic Nitrogen as N |
| Nitrogen, Total | Total Nitrogen |
| Nitrogen, Total Kjeldahl | Total Kjeldahl Nitrogen (TKN) |
| Nitrogen-15/Nitrogen-14 Ratio | Nitrogen-15/Nitrogen-14 Ratio (Delta 15N nitrate isotope) |
| Nitrophenol, 2- | 2-Nitrophenol |
| Nitrophenol, 4- | 4-Nitrophenol |
| Nitrosodimethylamine, N- | N-Nitrosodimethylamine |
| Nitrosodi-n-propylamine, N- | N-Nitrosodi-n-propylamine |
| Nitrosodiphenylamine, N- | N-Nitrosodiphenylamine |
| No Debris Collected | No Debris Collected |
| No Debris Present | No Debris Present |
| Nodularin | Nodularin |
| NoItems | Number of Items using Trash Protocol |
| Nonachlor, cis- | cis-Nonachlor |
| Nonachlor, cis-(Surrogate) | Surrogate: cis-Nonachlor |
| Nonachlor, trans- | trans-Nonachlor |
| Nonachlor, trans-(Surrogate) | Surrogate: trans-Nonachlor |
| Nonachlor-13C10, cis-(IsoDilAnalogue) | Isotope Dilution Analogue: cis-Nonachlor-13C10 |
| Nonachlor-13C10, trans-(IsoDilAnalogue) | Isotope Dilution Analogue: trans-Nonachlor-13C10 |
| None | Used for non-treated samples |
| Nonylphenol | Nonylphenol |
| Nonylphenol Diethoxylate, 4- | 4-Nonylphenol Diethoxylate |
| Nonylphenol Diethoxylate, 4-(Surrogate) | Surrogate: 4-Nonylphenol Diethoxylate |
| Nonylphenol Monoethoxylate, 4- | 4-Nonylphenol Monoethoxylate |
| Nonylphenol, 4-n- | 4-n-Nonylphenol |
| Nonylphenol, tech- | tech-Nonylphenol (Branched p-nonylphenol) |
| Nonylphenol-d4, 4-(Surrogate) | Surrogate: 4-Nonylphenol-d4 |
| Nonylphenolethoxylate | Nonylphenolethoxylate |
| Norfloxacin | Norfloxacin |
| Norflurazon | Norflurazon (3(2H)-Pyridazinone, 4-chloro-5-(methylamino)-2-[3-(trifluoromethyl)phenyl]-) (Telok) |
| Norgestimate | Norgestimate |
| Normal Development | Normal Development (%) |
| Novaluron | Novaluron |
| NutrientSpike | Combination of multiple nutrients; see tox test comments for specific analytes and concentrations |
| O,O,O-Triethyl phosphorothioate | O,O,O-Triethyl phosphorothioate |
| ObservedChannelFlowLevel | ObservedChannelFlowLevel |
| ObservedFlow | ObservedFlow |
| OCDD, 1,2,3,4,6,7,8,9- | 1,2,3,4,6,7,8,9-Octachlordibenzo-p-dioxin (OCDD) |
| OCDD, 1,2,3,4,6,7,8,9- (TEQ ND=0) | 1,2,3,4,6,7,8,9-OCDD (TEQ ND=0) |
| OCDD, 1,2,3,4,6,7,8,9- (TEQ ND=1/2 DL) | 1,2,3,4,6,7,8,9-OCDD (TEQ ND=1/2 DL) |
| OCDD, 1,2,3,4,6,7,8,9-(Surrogate) | Surrogate: 1,2,3,4,6,7,8,9-Octachlordibenzo-p-dioxin (OCDD) |
| OCDD-13C, 1,2,3,4,6,7,8,9-(Surrogate) | Surrogate: 1,2,3,4,6,7,8,9-Octachlordibenzo-p-dioxin-13C (OCDD) |
| OCDD-13C12, 1,2,3,4,6,7,8,9-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3,4,6,7,8,9-OCDD-13C12 |
| OCDF, 1,2,3,4,6,7,8,9- | 1,2,3,4,6,7,8,9-Octachlordibenzofuran (OCDF) |
| OCDF, 1,2,3,4,6,7,8,9- (TEQ ND=0) | 1,2,3,4,6,7,8,9-OCDF (TEQ ND=0) |
| OCDF, 1,2,3,4,6,7,8,9- (TEQ ND=1/2 DL) | 1,2,3,4,6,7,8,9- OCDF (TEQ ND=1/2 DL) |
| OCDF, 1,2,3,4,6,7,8,9-(Surrogate) | Surrogate: 1,2,3,4,6,7,8,9-Octachlordibenzofuran (OCDF) |
| Octacosane, n- | n-Octacosane |
| Octylphenol diethoxylate, tert-4- | 4-tert-Octylphenol diethoxylate (OP2EO) |
| Odor | Odor |
| Odor Intensity | Odor Intensity - Specific to EMAP BA (characterizes intensity of odor) |
| Offspring | Offspring (#) |
| Ofloxacin | Ofloxacin |
| Oil, Gas Wells | Oil, Gas Wells |
| OilandGrease; FOG-HEM | Oil and Grease; Fats, Oils and Grease N-Hexane Extractable Material (Polar Material) |
| OilandGrease; HEM | Oil and Grease, N-Hexane Extractable Material |
| OilandGrease; SGT-HEM | Oil and Grease, Silica Gel Treated N-Hexane Extractable Material (Non-Polar Material Not Adsorbed by Silica Gel) |
| Okadaic Acid | Okadaic Acid |
| Orchards | Orchards |
| Ormetoprim | Ormetoprim |
| OrthoPhosphate as P | Reactive Phosphorous (PO4) |
| Oryzalin | Oryzalin (Rycelan) (Ryzelan) (Surflan) |
| Osmoregulation | Osmoregulation |
| o-Terphenyl(Surrogate) | Surrogate: o-Terphenyl |
| OtherPresence | OtherPresence |
| Outfall Accessibility | Outfall Accessibility |
| Outfall Structural Cond | Structural condition of the outfall |
| Outfall, Distance from Transect | Outfall, Distance from Transect |
| Outfall, Within Transect | Outfall, Within Transect |
| OverlandRunoffLast24hrs | Influence of overland runoff during last 24 hours |
| Oxacillin | Oxacillin |
| Oxadiazon | Oxadiazon |
| Oxamyl | Oxamyl |
| Oxathiapiprolin | Oxathiapiprolin |
| Oxidation-Reduction Potential | Oxidation-Reduction Potential (OPR) |
| Oxolinic Acid | Oxolinic Acid |
| Oxybenzone | Oxybenzone |
| Oxychlordane | Oxychlordane |
| Oxychlordane(Surrogate) | Surrogate: Oxychlordane |
| Oxychlordane-13C10(IsoDilAnalogue) | Isotope Dilution Analogue: Oxychlordane-13C10 |
| Oxychlordane-13C10(Surrogate) | Surrogate: Oxychlordane-13C10 |
| Oxyfluorfen | Oxyfluorfen (Goal) |
| Oxygen, Dissolved | Dissolved Oxygen (DO) |
| Oxygen, Saturation | Oxygen, Saturation |
| Oxygen-18/Oxygen-16 Ratio | Oxygen-18/Oxygen-16 Ratio (Delta 18O nitrate isotope) |
| Oxytetracycline | Oxytetracycline |
| Paclobutrazol | Paclobutrazol |
| Paper/Cardboard | Paper/Cardboard |
| PAR | Photosynthetically Active Radiation (PAR) |
| Paraquat | Paraquat |
| Paraquat Dichloride | Paraquat Dichloride |
| Parathion, Ethyl | Ethyl Parathion (Parathion) |
| Parathion, Methyl | Methyl Parathion |
| Parathion, Total | Total Parathion |
| Parks, Campgrounds | Parks, Campgrounds |
| Particulate Organic Carbon | Particulate Organic Carbon (POC) |
| Pasture | Pasture |
| PBDE 007 | Polybrominated Diphenyl Ether (PBDE) 7 |
| PBDE 008 | Polybrominated Diphenyl Ether (PBDE) 8 |
| PBDE 008/11 | Polybrominated Diphenyl Ether (PBDE) 8/11 |
| PBDE 010 | Polybrominated Diphenyl Ether (PBDE) 10 |
| PBDE 011 | Polybrominated Diphenyl Ether (PBDE) 11 |
| PBDE 012 | Polybrominated Diphenyl Ether (PBDE) 12 |
| PBDE 012/13 | Polybrominated Diphenyl Ether (PBDE) 12/13 |
| PBDE 013 | Polybrominated Diphenyl Ether (PBDE) 13 |
| PBDE 015 | Polybrominated Diphenyl Ether (PBDE) 15 |
| PBDE 015(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 15 |
| PBDE 017 | Polybrominated Diphenyl Ether (PBDE) 17 |
| PBDE 017/25 | Polybrominated Diphenyl Ether (PBDE) 17/25 |
| PBDE 025 | Polybrominated Diphenyl Ether (PBDE) 25 |
| PBDE 028 | Polybrominated Diphenyl Ether (PBDE) 28 |
| PBDE 028(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 28 |
| PBDE 028/33 | Polybrominated Diphenyl Ether (PBDE) 28/33 |
| PBDE 028-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 028-13C12 |
| PBDE 030 | Polybrominated Diphenyl Ether (PBDE) 30 |
| PBDE 032 | Polybrominated Diphenyl Ether (PBDE) 32 |
| PBDE 033 | Polybrominated Diphenyl Ether (PBDE) 33 |
| PBDE 035 | Polybrominated Diphenyl Ether (PBDE) 35 |
| PBDE 037 | Polybrominated Diphenyl Ether (PBDE) 37 |
| PBDE 047 | Polybrominated Diphenyl Ether (PBDE) 47 |
| PBDE 047(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 47 |
| PBDE 047-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 047-13C12 |
| PBDE 049 | Polybrominated Diphenyl Ether (PBDE) 49 |
| PBDE 051 | Polybrominated Diphenyl Ether (PBDE) 51 |
| PBDE 066 | Polybrominated Diphenyl Ether (PBDE) 66 |
| PBDE 071 | Polybrominated Diphenyl Ether (PBDE) 71 |
| PBDE 075 | Polybrominated Diphenyl Ether (PBDE) 75 |
| PBDE 077 | Polybrominated Diphenyl Ether (PBDE) 77 |
| PBDE 077(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 77 |
| PBDE 079 | Polybrominated Diphenyl Ether (PBDE) 79 |
| PBDE 085 | Polybrominated Diphenyl Ether (PBDE) 85 |
| PBDE 099 | Polybrominated Diphenyl Ether (PBDE) 99 |
| PBDE 099(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 99 |
| PBDE 099-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 099-13C12 |
| PBDE 100 | Polybrominated Diphenyl Ether (PBDE) 100 |
| PBDE 100(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 100 |
| PBDE 100-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 100-13C12 |
| PBDE 100-L(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 100-Labeled |
| PBDE 105 | Polybrominated Diphenyl Ether (PBDE) 105 |
| PBDE 116 | Polybrominated Diphenyl Ether (PBDE) 116 |
| PBDE 119 | Polybrominated Diphenyl Ether (PBDE) 119 |
| PBDE 119/120 | Polybrominated Diphenyl Ether (PBDE) 119/120 |
| PBDE 120 | Polybrominated Diphenyl Ether (PBDE) 120 |
| PBDE 126 | Polybrominated Diphenyl Ether (PBDE) 126 |
| PBDE 126(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 126 |
| PBDE 128 | Polybrominated Diphenyl Ether (PBDE) 128 |
| PBDE 138 | Polybrominated Diphenyl Ether (PBDE) 138 |
| PBDE 138(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 138 |
| PBDE 138/166 | Polybrominated Diphenyl Ether (PBDE) 138/166 |
| PBDE 139(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 139 |
| PBDE 139-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 139-13C12 |
| PBDE 140 | Polybrominated Diphenyl Ether (PBDE) 140 |
| PBDE 153 | Polybrominated Diphenyl Ether (PBDE) 153 |
| PBDE 153(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 153 |
| PBDE 153-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 153-13C12 |
| PBDE 154 | Polybrominated Diphenyl Ether (PBDE) 154 |
| PBDE 154(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 154 |
| PBDE 154-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 154-13C12 |
| PBDE 155 | Polybrominated Diphenyl Ether (PBDE) 155 |
| PBDE 166 | Polybrominated Diphenyl Ether (PBDE) 166 |
| PBDE 172(Surrogate) | Surrogate: PBDE 172
Surrogate: PBDE 172 |
| PBDE 179 | Polybrominated Diphenyl Ether (PBDE) 179 |
| PBDE 181 | Polybrominated Diphenyl Ether (PBDE) 181 |
| PBDE 183 | Polybrominated Diphenyl Ether (PBDE) 183 |
| PBDE 183(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 183 |
| PBDE 183-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 183-13C12 |
| PBDE 184 | Polybrominated Diphenyl Ether (PBDE) 184 |
| PBDE 188 | Polybrominated Diphenyl Ether (PBDE) 188 |
| PBDE 190 | Polybrominated Diphenyl Ether (PBDE) 190 |
| PBDE 197(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 197 |
| PBDE 200 | Polybrominated Diphenyl Ether (PBDE) 200 |
| PBDE 200/203 | Polybrominated Diphenyl Ether (PBDE) 200/203 |
| PBDE 201 | Polybrominated Diphenyl Ether (PBDE) 201 |
| PBDE 202 | Polybrominated Diphenyl Ether (PBDE) 202 |
| PBDE 203 | Polybrominated Diphenyl Ether (PBDE) 203 |
| PBDE 206 | Polybrominated Diphenyl Ether (PBDE) 206 |
| PBDE 207 | Polybrominated Diphenyl Ether (PBDE) 207 |
| PBDE 208 | Polybrominated Diphenyl Ether (PBDE) 208 |
| PBDE 209 | Polybrominated Diphenyl Ether (PBDE) 209 |
| PBDE 209(Surrogate) | Surrogate: Polybrominated Diphenyl Ether (PBDE) 209 |
| PBDE 209-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: Polybrominated Diphenyl Ether (PBDE) 209-13C12 |
| PCB 001 | PCB 1 Congener |
| PCB 001(Surrogate) | Surrogate: PCB 1 Congener |
| PCB 001-13C(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 001-13C |
| PCB 001-13C(surrogate) | Surrogate: PCB 001-13C Congener |
| PCB 001-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 001-13C12 |
| PCB 002 | PCB 2 Congener |
| PCB 003 | PCB 3 Congener |
| PCB 003(Surrogate) | Surrogate: PCB 3 Congener |
| PCB 003-13C(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 003-13C |
| PCB 003-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 003-13C12 |
| PCB 004 | PCB 4 Congener |
| PCB 004(Surrogate) | Surrogate: PCB 4 Congener |
| PCB 004/10 | PCB 4/10 Congener |
| PCB 004-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 004-13C12 |
| PCB 005 | PCB 5 Congener |
| PCB 005/8 | PCB 5/8 Congener |
| PCB 006 | PCB 6 Congener |
| PCB 007 | PCB 7 Congener |
| PCB 007/9 | PCB 7/9 Congener |
| PCB 008 | PCB 8 Congener |
| PCB 008(Surrogate) | Surrogate: PCB 8 Congener |
| PCB 009 | PCB 9 Congener |
| PCB 009-13C(Surrogate) | Surrogate: PCB 009-13C Congener |
| PCB 009-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 9-13C12 |
| PCB 010 | PCB 10 Congener |
| PCB 011 | PCB 11 Congener |
| PCB 011-13C(Surrogate) | Surrogate: PCB 011-13C Congener |
| PCB 012 | PCB 12 Congener |
| PCB 012/13 | PCB 12/13 Congener |
| PCB 013 | PCB 13 Congener |
| PCB 014 | PCB 14 Congener |
| PCB 015 | PCB 15 Congener |
| PCB 015(Surrogate) | Surrogate: PCB 15 Congener |
| PCB 015-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 015-13C12 |
| PCB 016 | PCB 16 Congener |
| PCB 016/32 | PCB 16/32 Congener |
| PCB 017 | PCB 17 Congener |
| PCB 018 | PCB 18 Congener |
| PCB 018/30 | PCB 18/30 Congener |
| PCB 019 | PCB 19 Congener |
| PCB 019(Surrogate) | Surrogate: PCB 19 Congener |
| PCB 019-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 019-13C12 |
| PCB 020 | PCB 20 Congener |
| PCB 020/21/33 | PCB 020/21/33 Congener |
| PCB 020/28 | PCB 20/28 Congener |
| PCB 021 | PCB 21 Congener |
| PCB 021/33 | PCB 21/33 Congener |
| PCB 022 | PCB 22 Congener |
| PCB 023 | PCB 23 Congener |
| PCB 024 | PCB 24 Congener |
| PCB 024/27 | PCB 24/27 Congener |
| PCB 025 | PCB 25 Congener |
| PCB 026 | PCB 26 Congener |
| PCB 026/29 | PCB 26/29 Congener |
| PCB 027 | PCB 27 Congener |
| PCB 028 | PCB 28 Congener |
| PCB 028(Surrogate) | Surrogate: PCB 28 Congener |
| PCB 028/31 | PCB 28/31 Congener |
| PCB 028-13C(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 028-13C |
| PCB 028-13C(Surrogate) | Surrogate: PCB 028-13C Congener |
| PCB 028-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 028-13C12 |
| PCB 029 | PCB 29 Congener |
| PCB 030 | PCB 30 Congener |
| PCB 030(Surrogate) | Surrogate: PCB 30 Congener |
| PCB 031 | PCB 31 Congener |
| PCB 031(Surrogate) | Surrogate: PCB 31 Congener |
| PCB 031-13C(Surrogate) | Surrogate: PCB 31-13C Congener |
| PCB 031-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 031-13C12 |
| PCB 032 | PCB 32 Congener |
| PCB 032-13C(Surrogate) | Surrogate: PCB 32-13C Congener |
| PCB 032-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 32-13C12 |
| PCB 033 | PCB 33 Congener |
| PCB 034 | PCB 34 Congener |
| PCB 035 | PCB 35 Congener |
| PCB 036 | PCB 36 Congener |
| PCB 037 | PCB 37 Congener |
| PCB 037(Surrogate) | Surrogate: PCB 37 Congener |
| PCB 037-13C(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 037-13C |
| PCB 037-13C(surrogate) | Surrogate: PCB 037-13C Congener |
| PCB 037-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 037-13C12 |
| PCB 038 | PCB 38 Congener |
| PCB 039 | PCB 39 Congener |
| PCB 040 | PCB 40 Congener |
| PCB 040/41 | PCB 40/41 Congener |
| PCB 040/41/71 | PCB 40/41/71 Congener |
| PCB 040/71 | PCB 40/71 Congener |
| PCB 041 | PCB 41 Congener |
| PCB 041/64/71/72 | PCB 041/64/71/72 Congener |
| PCB 041/71/40 | PCB 41/71/40 Congener |
| PCB 042 | PCB 42 Congener |
| PCB 042/59 | PCB 042/59 Congener |
| PCB 043 | PCB 43 Congener |
| PCB 043/49 | PCB 43/49 Congener |
| PCB 043/73 | PCB 43/73 Congener |
| PCB 044 | PCB 44 Congener |
| PCB 044/47 | PCB 44/47 Congener |
| PCB 044/47/65 | PCB 44/47/65 |
| PCB 044/65 | PCB 44/65 Congener |
| PCB 045 | PCB 45 Congener |
| PCB 045/51 | PCB 45/51 Congener |
| PCB 046 | PCB 46 Congener |
| PCB 047 | PCB 47 Congener |
| PCB 047-13C(Surrogate) | Surrogate: PCB 47-13C Congener |
| PCB 047-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 47-13C12 |
| PCB 048 | PCB 48 Congener |
| PCB 048/75 | PCB 048/75 Congener |
| PCB 049 | PCB 49 Congener |
| PCB 049/69 | PCB 49/69 Congener |
| PCB 050 | PCB 50 Congener |
| PCB 050/53 | PCB 50/53 Congener |
| PCB 051 | PCB 51 Congener |
| PCB 052 | PCB 52 Congener |
| PCB 052/69 | PCB 52/69 Congener |
| PCB 052-13C(Surrogate) | Surrogate: PCB 052-13C Congener |
| PCB 052-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 52-13C12 |
| PCB 053 | PCB 53 Congener |
| PCB 054 | PCB 54 Congener |
| PCB 054(Surrogate) | Surrogate: PCB 54 Congener |
| PCB 054-13C(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 054-13C |
| PCB 054-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 054-13C12 |
| PCB 055 | PCB 55 Congener |
| PCB 056 | PCB 56 Congener |
| PCB 056/60 | PCB 56/60 Congener |
| PCB 057 | PCB 57 Congener |
| PCB 058 | PCB 58 Congener |
| PCB 059 | PCB 59 Congener |
| PCB 059/62 | PCB 59/62 Congener |
| PCB 059/62/75 | PCB 59/62/75 Congener |
| PCB 059/75 | PCB 59/75 Congener |
| PCB 060 | PCB 60 Congener |
| PCB 061 | PCB 61 Congener |
| PCB 061/70 | PCB 61/70 Congener |
| PCB 061/70/74/76 | PCB 61/70/74/76 Congener |
| PCB 061/74 | PCB 61/74 Congener |
| PCB 061/76 | PCB 61/76 Congener |
| PCB 062 | PCB 62 Congener |
| PCB 063 | PCB 63 Congener |
| PCB 064 | PCB 64 Congener |
| PCB 065 | PCB 65 Congener |
| PCB 065(Surrogate) | Surrogate: PCB 65 Congener |
| PCB 066 | PCB 66 Congener |
| PCB 066/76 | PCB 66/76 Congener |
| PCB 067 | PCB 67 Congener |
| PCB 068 | PCB 68 Congener |
| PCB 069 | PCB 69 Congener |
| PCB 070 | PCB 70 Congener |
| PCB 070/61/74/76 | PCB 70/61/74/76 Congener |
| PCB 070/74 | PCB 070/74 |
| PCB 070/76 | PCB 070/76 |
| PCB 070-13C(Surrogate) | Surrogate: PCB 70-13C Congener |
| PCB 070-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 70-13C12 |
| PCB 071 | PCB 71 Congener |
| PCB 072 | PCB 72 Congener |
| PCB 073 | PCB 73 Congener |
| PCB 074 | PCB 74 Congener |
| PCB 075 | PCB 75 Congener |
| PCB 076 | PCB 76 Congener |
| PCB 077 | PCB 77 Congener |
| PCB 077 (TEQ ND=0) | PCB 077 (TEQ ND=0) |
| PCB 077 (TEQ ND=1/2 DL) | PCB 077 (TEQ ND=1/2 DL) |
| PCB 077 (TEQ ND=DL) | PCB 077 (TEQ ND=DL) |
| PCB 077(Surrogate) | Surrogate: PCB 77 Congener |
| PCB 077-13C(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 077-13C |
| PCB 077-13C(Surrogate) | Surrogate: PCB 77-13C Congener |
| PCB 077-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 077-13C12 |
| PCB 078 | PCB 78 Congener |
| PCB 079 | PCB 79 Congener |
| PCB 079-13C(Surrogate) | Surrogate: PCB 79-13C Congener |
| PCB 079-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 79-13C12 |
| PCB 080 | PCB 80 Congener |
| PCB 080-13C(Surrogate) | Surrogate: PCB 80-13C Congener |
| PCB 080-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 80-13C12 |
| PCB 081 | PCB 81 Congener |
| PCB 081 (TEQ ND=0) | PCB 081 (TEQ ND=0) |
| PCB 081 (TEQ ND=1/2 DL) | PCB 081 (TEQ ND=1/2 DL) |
| PCB 081 (TEQ ND=DL) | PCB 081 (TEQ ND=DL) |
| PCB 081(Surrogate) | Surrogate: PCB 81 Congener |
| PCB 081-13C(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 081-13C |
| PCB 081-13C(surrogate) | Surrogate: PCB 081-13C Congener |
| PCB 081-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 081-13C12 |
| PCB 082 | PCB 82 Congener |
| PCB 083 | PCB 83 Congener |
| PCB 083/99 | PCB 83/99 Congener |
| PCB 084 | PCB 84 Congener |
| PCB 084/92 | PCB 084/92 Congener |
| PCB 085 | PCB 85 Congener |
| PCB 085/110/115/116/117 | PCB 85/110/115/116/117 Congener |
| PCB 085/116 | PCB 85/116 Congener |
| PCB 085/116/117 | PCB 85/116/117 Congener |
| PCB 085/117 | PCB 85/117 Congener |
| PCB 086 | PCB 86 Congener |
| PCB 086/108 | PCB 86/108 Congener |
| PCB 086/119 | PCB 86/119 Congener |
| PCB 086/125 | PCB 86/125 Congener |
| PCB 086/87 | PCB 86/87 Congener |
| PCB 086/87/97/109/119/125 | PCB 86/87/97/109/119/125 Congener |
| PCB 086/97 | PCB 86/97 Congener |
| PCB 087 | PCB 87 Congener |
| PCB 087/108 | PCB 087/108 |
| PCB 087/117/125 | PCB 87/117/125 Congener |
| PCB 087/119 | PCB 087/119 |
| PCB 087/125 | PCB 087/125 |
| PCB 087/97 | PCB 087/97 |
| PCB 088 | PCB 88 Congener |
| PCB 088/91 | PCB 88/91 Congener |
| PCB 089 | PCB 89 Congener |
| PCB 090 | PCB 90 Congener |
| PCB 090/101 | PCB 90/101 Congener |
| PCB 090/101/113 | PCB 90/101/113 Congener |
| PCB 090/113 | PCB 90/113 Congener |
| PCB 091 | PCB 91 Congener |
| PCB 092 | PCB 92 Congener |
| PCB 093 | PCB 93 Congener |
| PCB 093/100 | PCB 93/100 Congener |
| PCB 093/102 | PCB 93/102 Congener |
| PCB 093/95 | PCB 93/95 Congener |
| PCB 093/95/100 | PCB 93/95/100 Congener |
| PCB 093/95/98/100/102 | PCB 93/95/98/100/102 Congener |
| PCB 093/98 | PCB 93/98 Congener |
| PCB 093/98/100/102 | PCB 93/98/100/102 Congener |
| PCB 094 | PCB 94 Congener |
| PCB 095 | PCB 95 Congener |
| PCB 095(Surrogate) | Surrogate: PCB 95 Congener |
| PCB 095/100 | PCB 095/100 |
| PCB 095/102 | PCB 095/102 |
| PCB 095/98 | PCB 095/98 |
| PCB 095/98/102 | PCB 95/98/102 Congener |
| PCB 095-13C(Surrogate) | Surrogate: PCB 095-13C Congener |
| PCB 095-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 095-13C12 |
| PCB 096 | PCB 96 Congener |
| PCB 097 | PCB 97 Congener |
| PCB 097-13C(Surrogate) | Surrogate: PCB 97-13C Congener |
| PCB 097-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 97-13C12 |
| PCB 098 | PCB 98 Congener |
| PCB 098/102 | PCB 98/102 Congener |
| PCB 099 | PCB 99 Congener |
| PCB 100 | PCB 100 Congener |
| PCB 101 | PCB 101 Congener |
| PCB 101(Surrogate) | Surrogate: PCB 101 Congener |
| PCB 101/113 | PCB 101/113 |
| PCB 101-13C(Surrogate) | Surrogate: PCB 101-13C Congener |
| PCB 101-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 101-13C12 |
| PCB 102 | PCB 102 Congener |
| PCB 103 | PCB 103 Congener |
| PCB 104 | PCB 104 Congener |
| PCB 104(Surrogate) | Surrogate: PCB 104 Congener |
| PCB 104-13C(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 104-13C |
| PCB 104-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 104-13C12 |
| PCB 105 | PCB 105 Congener |
| PCB 105 (TEQ ND=0) | PCB 105 (TEQ ND=0) |
| PCB 105 (TEQ ND=1/2 DL) | PCB 105 (TEQ ND=1/2 DL) |
| PCB 105 (TEQ ND=DL) | PCB 105 (TEQ ND=DL) |
| PCB 105(Surrogate) | Surrogate: PCB 105 Congener |
| PCB 105-13C(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 105-13C |
| PCB 105-13C(Surrogate) | Surrogate: PCB 105-13C Congener |
| PCB 105-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 105-13C12 |
| PCB 106 | PCB 106 Congener |
| PCB 106/118 | PCB 106/118 Congener |
| PCB 107 | PCB 107 Congener |
| PCB 107/109 | PCB 107/109 Congener |
| PCB 107/124 | PCB 107/124 Congener |
| PCB 108 | PCB 108 Congener |
| PCB 108/112 | PCB 108/112 Congener |
| PCB 108/124 | PCB 108/124 Congener |
| PCB 109 | PCB 109 Congener |
| PCB 110 | PCB 110 Congener |
| PCB 110/115 | PCB 110/115 Congener |
| PCB 110/151 | PCB 110/151 Congener |
| PCB 111 | PCB 111 Congener |
| PCB 111(Surrogate) | Surrogate: PCB 111 Congener |
| PCB 111/115 | PCB 111/115 Congener |
| PCB 111-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 111-13C12 |
| PCB 112 | PCB 112 Congener |
| PCB 112(Surrogate) | Surrogate: PCB 112 Congener |
| PCB 113 | PCB 113 Congener |
| PCB 114 | PCB 114 Congener |
| PCB 114 (TEQ ND=0) | PCB 114 (TEQ ND=0) |
| PCB 114 (TEQ ND=1/2 DL) | PCB 114 (TEQ ND=1/2 DL) |
| PCB 114 (TEQ ND=DL) | PCB 114 (TEQ ND=DL) |
| PCB 114(Surrogate) | Surrogate: PCB 114 Congener |
| PCB 114-13C(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 114-13C |
| PCB 114-13C(surrogate) | Surrogate: PCB 114-13C Congener |
| PCB 114-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 114-13C12 |
| PCB 115 | PCB 115 Congener |
| PCB 116 | PCB 116 Congener |
| PCB 117 | PCB 117 Congener |
| PCB 118 | PCB 118 Congener |
| PCB 118 (TEQ ND=0) | PCB 118 (TEQ ND=0) |
| PCB 118 (TEQ ND=1/2 DL) | PCB 118 (TEQ ND=1/2 DL) |
| PCB 118 (TEQ ND=DL) | PCB 118 (TEQ ND=DL) |
| PCB 118(Surrogate) | Surrogate: PCB 118 Congener |
| PCB 118-13C(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 118-13C |
| PCB 118-13C(Surrogate) | Surrogate: PCB 118-13C Congener |
| PCB 118-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 118-13C12 |
| PCB 119 | PCB 119 Congener |
| PCB 120 | PCB 120 Congener |
| PCB 121 | PCB 121 Congener |
| PCB 122 | PCB 122 Congener |
| PCB 123 | PCB 123 Congener |
| PCB 123 (TEQ ND=0) | PCB 123 (TEQ ND=0) |
| PCB 123 (TEQ ND=1/2 DL) | PCB 123 (TEQ ND=1/2 DL) |
| PCB 123 (TEQ ND=DL) | PCB 123 (TEQ ND=DL) |
| PCB 123(Surrogate) | Surrogate: PCB 123 Congener |
| PCB 123-13C(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 123-13C |
| PCB 123-13C(Surrogate) | Surrogate: PCB 123-13C Congener |
| PCB 123-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 123-13C12 |
| PCB 124 | PCB 124 Congener |
| PCB 125 | PCB 125 Congener |
| PCB 126 | PCB 126 Congener |
| PCB 126 (TEQ ND=0) | PCB 126 (TEQ ND=0) |
| PCB 126 (TEQ ND=1/2 DL) | PCB 126 (TEQ ND=1/2 DL) |
| PCB 126 (TEQ ND=DL) | PCB 126 (TEQ ND=DL) |
| PCB 126(Surrogate) | Surrogate: PCB 126 Congener |
| PCB 126-13C(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 126-13C |
| PCB 126-13C(Surrogate) | Surrogate: PCB 126-13C Congener |
| PCB 126-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 126-13C12 |
| PCB 127 | PCB 127 Congener |
| PCB 127-13C(Surrogate) | Surrogate: PCB 127-13C Congener |
| PCB 128 | PCB 128 Congener |
| PCB 128/162 | PCB 128/162 Congener |
| PCB 128/166 | PCB 128/166 |
| PCB 128/167 | PCB 128/167 Congener |
| PCB 129 | PCB 129 Congener |
| PCB 129/138 | PCB 129/138 Congener |
| PCB 129/138/163 | PCB 129/138/163 Congener |
| PCB 129/160 | PCB 129/160 Congener |
| PCB 129/163 | PCB 129/163 Congener |
| PCB 129/166 | PCB 129/166 Congener |
| PCB 130 | PCB 130 Congener |
| PCB 131 | PCB 131 Congener |
| PCB 131/133 | PCB 131/133 |
| PCB 132 | PCB 132 Congener |
| PCB 132/153 | PCB 132/153 |
| PCB 132/161 | PCB 132/161 Congener |
| PCB 132/168 | PCB 132/168 Congener |
| PCB 133 | PCB 133 Congener |
| PCB 134 | PCB 134 Congener |
| PCB 134/143 | PCB 134/143 Congener |
| PCB 135 | PCB 135 Congener |
| PCB 135/151 | PCB 135/151 Congener |
| PCB 135/151/154 | PCB 135/151/154 Congener
PCB 135/151/154 |
| PCB 135/154 | PCB 135/154 Congener |
| PCB 136 | PCB 136 Congener |
| PCB 137 | PCB 137 Congener |
| PCB 137/164 | PCB 137/164 Congener |
| PCB 138 | PCB 138 Congener |
| PCB 138/158 | PCB 138/158 Congener |
| PCB 138/160 | PCB 138/160 |
| PCB 138/163 | PCB 138/163 |
| PCB 138/163/164 | PCB 138/163/164 Congener |
| PCB 138-13C(Surrogate) | Surrogate: PCB 138-13C Congener |
| PCB 138-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 138-13C12 |
| PCB 139 | PCB 139 Congener |
| PCB 139/140 | PCB 139/140 Congener |
| PCB 139/149 | PCB 139/149 Congener |
| PCB 140 | PCB 140 Congener |
| PCB 141 | PCB 141 Congener |
| PCB 141-13C(Surrogate) | Surrogate: PCB 141-13C Congener |
| PCB 141-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 141-13C12 |
| PCB 142 | PCB 142 Congener |
| PCB 143 | PCB 143 Congener |
| PCB 144 | PCB 144 Congener |
| PCB 145 | PCB 145 Congener |
| PCB 146 | PCB 146 Congener |
| PCB 146/165 | PCB 146/165 Congener |
| PCB 147 | PCB 147 Congener |
| PCB 147/149 | PCB 147/149 Congener |
| PCB 148 | PCB 148 Congener |
| PCB 149 | PCB 149 Congener |
| PCB 150 | PCB 150 Congener |
| PCB 151 | PCB 151 Congener |
| PCB 151/154 | PCB 151/154 |
| PCB 152 | PCB 152 Congener |
| PCB 153 | PCB 153 Congener |
| PCB 153(Surrogate) | Surrogate: PCB 153 Congener |
| PCB 153/168 | PCB 153/168 Congener |
| PCB 153-13C(Surrogate) | Surrogate: PCB 153-13C Congener |
| PCB 153-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 153-13C12 |
| PCB 154 | PCB 154 Congener |
| PCB 155 | PCB 155 Congener |
| PCB 155(Surrogate) | Surrogate: PCB 155 Congener |
| PCB 155-13C(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 155-13C |
| PCB 155-13C(Surrogate) | Surrogate: PCB 155-13C Congener |
| PCB 155-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 155-13C12 |
| PCB 156 | PCB 156 Congener |
| PCB 156 (TEQ ND=0) | PCB 156 (TEQ ND=0) |
| PCB 156 (TEQ ND=1/2 DL) | PCB 156 (TEQ ND=1/2 DL) |
| PCB 156 (TEQ ND=DL) | PCB 156 (TEQ ND=DL) |
| PCB 156(Surrogate) | Surrogate: PCB 156 Congener |
| PCB 156/157 | PCB 156/157 Congener |
| PCB 156/157 (TEQ ND=0) | PCB 156/157 (TEQ ND=0) |
| PCB 156/157 (TEQ ND=1/2 DL) | PCB 156/157 (TEQ ND=1/2 DL) |
| PCB 156/157 (TEQ ND=DL) | PCB 156/157 (TEQ ND=DL) |
| PCB 156/157(Surrogate) | Surrogate: PCB 156/157 |
| PCB 156-13C(Surrogate) | Surrogate: PCB 156-13C Congener |
| PCB 156-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 156-13C12 |
| PCB 156-13C12/157-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 156-13C12/157-13C12 |
| PCB 157 | PCB 157 Congener |
| PCB 157 (TEQ ND=0) | PCB 157 (TEQ ND=0) |
| PCB 157 (TEQ ND=1/2 DL) | PCB 157 (TEQ ND=1/2 DL) |
| PCB 157 (TEQ ND=DL) | PCB 157 (TEQ ND=DL) |
| PCB 157(Surrogate) | Surrogate: PCB 157 Congener |
| PCB 157-13C(surrogate) | Surrogate: PCB 157-13C Congener |
| PCB 157-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 157-13C12 |
| PCB 158 | PCB 158 Congener |
| PCB 158/160 | PCB 158/160 Congener |
| PCB 159 | PCB 159 Congener |
| PCB 159(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 159 |
| PCB 159(Surrogate) | Surrogate: PCB 159 Congener |
| PCB 159-13C(Surrogate) | Surrogate: PCB 159-13C Congener |
| PCB 159-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 159-13C12 |
| PCB 160 | PCB 160 Congener |
| PCB 161 | PCB 161 Congener |
| PCB 162 | PCB 162 Congener |
| PCB 163 | PCB 163 Congener |
| PCB 164 | PCB 164 Congener |
| PCB 165 | PCB 165 Congener |
| PCB 166 | PCB 166 Congener |
| PCB 167 | PCB 167 Congener |
| PCB 167 (TEQ ND=0) | PCB 167 (TEQ ND=0) |
| PCB 167 (TEQ ND=1/2 DL) | PCB 167 (TEQ ND=1/2 DL) |
| PCB 167 (TEQ ND=DL) | PCB 167 (TEQ ND=DL) |
| PCB 167(Surrogate) | Surrogate: PCB 167 Congener |
| PCB 167-13C(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 167-13C |
| PCB 167-13C(surrogate) | Surrogate: PCB 167-13C Congener |
| PCB 167-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 167-13C12 |
| PCB 168 | PCB 168 Congener |
| PCB 169 | PCB 169 Congener |
| PCB 169 (TEQ ND=0) | PCB 169 (TEQ ND=0) |
| PCB 169 (TEQ ND=1/2 DL) | PCB 169 (TEQ ND=1/2 DL) |
| PCB 169 (TEQ ND=DL) | PCB 169 (TEQ ND=DL) |
| PCB 169(Surrogate) | Surrogate: PCB 169 Congener |
| PCB 169-13C(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 169-13C |
| PCB 169-13C(Surrogate) | Surrogate: PCB 169-13C Congener |
| PCB 169-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 169-13C12 |
| PCB 170 | PCB 170 Congener |
| PCB 170(Surrogate) | Surrogate: PCB 170 Congener |
| PCB 170-13C(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 170-13C |
| PCB 170-13C(Surrogate) | Surrogate: PCB 170-13C Congener |
| PCB 170-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 170-13C12 |
| PCB 171 | PCB 171 Congener |
| PCB 171/173 | PCB 171/173 Congener |
| PCB 172 | PCB 172 Congener |
| PCB 173 | PCB 173 Congener |
| PCB 174 | PCB 174 Congener |
| PCB 175 | PCB 175 Congener |
| PCB 176 | PCB 176 Congener |
| PCB 177 | PCB 177 Congener |
| PCB 178 | PCB 178 Congener |
| PCB 178(Surrogate) | Surrogate: PCB 178 Congener |
| PCB 178-13C(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 178-13C |
| PCB 178-13C(Surrogate) | Surrogate: PCB 178-13C Congener |
| PCB 178-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 178-13C12 |
| PCB 179 | PCB 179 Congener |
| PCB 180 | PCB 180 Congener |
| PCB 180(Surrogate) | Surrogate: PCB 180 Congener |
| PCB 180/193 | PCB 180/193 Congener |
| PCB 180-13C(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 180-13C |
| PCB 180-13C(Surrogate) | Surrogate: PCB 180-13C Congener |
| PCB 180-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 180-13C12 |
| PCB 181 | PCB 181 Congener |
| PCB 182 | PCB 182 Congener |
| PCB 182/187 | PCB 182/187 Congener |
| PCB 183 | PCB 183 Congener |
| PCB 183/185 | PCB 183/185 Congener |
| PCB 184 | PCB 174 Congener |
| PCB 185 | PCB 185 Congener |
| PCB 186 | PCB 176 Congener |
| PCB 187 | PCB 187 Congener |
| PCB 188 | PCB 188 Congener |
| PCB 188(Surrogate) | Surrogate: PCB 188 Congener |
| PCB 188-13C(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 188-13C |
| PCB 188-13C(Surrogate) | Surrogate: PCB 188-13C Congener |
| PCB 188-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 188-13C12 |
| PCB 189 | PCB 189 Congener |
| PCB 189 (TEQ ND=0) | PCB 189 (TEQ ND=0) |
| PCB 189 (TEQ ND=1/2 DL) | PCB 189 (TEQ ND=1/2 DL) |
| PCB 189 (TEQ ND=DL) | PCB 189 (TEQ ND=DL) |
| PCB 189(Surrogate) | Surrogate: PCB 189 Congener |
| PCB 189-13C(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 189-13C |
| PCB 189-13C(surrogate) | Surrogate: PCB 189-13C Congener |
| PCB 189-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 189-13C12 |
| PCB 190 | PCB 190 Congener |
| PCB 191 | PCB 191 Congener |
| PCB 192 | PCB 192 Congener |
| PCB 193 | PCB 193 Congener |
| PCB 194 | PCB 194 Congener |
| PCB 194-13C(Surrogate) | Surrogate: PCB 194-13C Congener |
| PCB 194-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 194-13C12 |
| PCB 195 | PCB 195 Congener |
| PCB 196 | PCB 196 Congener |
| PCB 196/203 | PCB 196/203 Congener |
| PCB 197 | PCB 197 Congener |
| PCB 197/200 | PCB 197/200 Congener |
| PCB 198 | PCB 198 Congener |
| PCB 198(Surrogate) | Surrogate: PCB 198 Congener |
| PCB 198/199 | PCB 198/199 Congener |
| PCB 199 | PCB 199 Congener |
| PCB 199/200 | PCB 199/200 Congener |
| PCB 200 | PCB 200 Congener |
| PCB 201 | PCB 201 Congener |
| PCB 202 | PCB 202 Congener |
| PCB 202(Surrogate) | Surrogate: PCB 202 Congener |
| PCB 202-13C(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 202-13C |
| PCB 202-13C(Surrogate) | Surrogate: PCB 202-13C Congener |
| PCB 202-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 202-13C12 |
| PCB 203 | PCB 203 Congener |
| PCB 204 | PCB 204 Congener |
| PCB 205 | PCB 205 Congener |
| PCB 205(Surrogate) | Surrogate: PCB 205 Congener |
| PCB 205-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 205-13C12 |
| PCB 206 | PCB 206 Congener |
| PCB 206(Surrogate) | Surrogate: PCB 206 Congener |
| PCB 206-13C(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 206-13C |
| PCB 206-13C(surrogate) | Surrogate: PCB 206-13C Congener |
| PCB 206-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 206-13C12 |
| PCB 207 | PCB 207 Congener |
| PCB 207(Surrogate) | Surrogate: PCB 207 Congener |
| PCB 208 | PCB 208 Congener |
| PCB 208(Surrogate) | Surrogate: PCB 208 Congener |
| PCB 208-13C(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 208-13C |
| PCB 208-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 208-13C12 |
| PCB 209 | PCB 209 Congener (Decachlorobiphenyl) (DCB) |
| PCB 209(Surrogate) | Surrogate: PCB 209 Congener (Decachlorobiphenyl) (DCB) |
| PCB 209(Surrogate)DB-608 | Surrogate: PCB 209 run on DB-608 (Decachlorobiphenyl) (DCB) |
| PCB 209(Surrogate)HP-5 | Surrogate: PCB 209 run on HP-5 (Decachlorobiphenyl) (DCB) |
| PCB 209-13C(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 209-13C |
| PCB 209-13C(surrogate) | Surrogate: PCB 209-13C Congener |
| PCB 209-13C12(IsoDilAnalogue) | Isotope Dilution Analogue: PCB 209-13C12 |
| PCB 209-L(Surrogate) | Surrogate: PCB 209 Congener (Decachlorobiphenyl) (DCB)-Labeled not defined |
| PCB AROCLOR 1016 | PCB Aroclor 1016 |
| PCB AROCLOR 1221 | PCB Aroclor 1221 |
| PCB AROCLOR 1232 | PCB Aroclor 1232 |
| PCB AROCLOR 1242 | PCB Aroclor 1242 |
| PCB AROCLOR 1248 | PCB Aroclor 1248 |
| PCB AROCLOR 1254 | PCB Aroclor 1254 |
| PCB AROCLOR 1260 | PCB Aroclor 1260 |
| PCB AROCLOR 1262 | PCB Aroclor 1262 |
| PCB TOTAL (TEQ ND=0) | PCB TOTAL (TEQ ND=0) |
| PCB TOTAL (TEQ ND=1/2 DL) | PCB TOTAL (TEQ ND=1/2 DL) |
| PCB TOTAL (TEQ ND=DL) | PCB TOTAL (TEQ ND=DL) |
| PCT AROCLOR 5432 | Polychlorinated Terphenyl AROCLOR 5432 |
| PCT AROCLOR 5442 | Polychlorinated Terphenyl AROCLOR 5442 |
| PCT AROCLOR 5460 | Polychlorinated Terphenyl AROCLOR 5460 |
| PCT_DR | Percent dry channel |
| PCT_FAST | Percent fast-water habitat of reach |
| PCT_POOL | Percent pool habitat of reach |
| PCT_RC | Percent concrete or asphalt streambed substrate physical-habitat metric |
| PCT_SAFN | Percent sands and fines streambed substrate physical-habitat metric |
| PCT_SLOW | Percent slow-water habitat of reach |
| Pebble | Pebble |
| Pebulate | Pebulate (PEBC) |
| PeCDD, 1,2,3,7,8- | 1,2,3,7,8-Pentachlorodibenzo-p-dioxin (PeCDD) |
| PECDD, 1,2,3,7,8- (TEQ ND=0) | 1,2,3,7,8-PECDD (TEQ ND=0) |
| PECDD, 1,2,3,7,8- (TEQ ND=1/2 DL) | 1,2,3,7,8-PECDD (TEQ ND=1/2 DL) |
| PeCDD, 1,2,3,7,8-(Surrogate) | Surrogate: 1,2,3,7,8-Pentachlorodibenzo-p-dioxin (PeCDD) |
| PeCDD-13C, 1,2,3,7,8-(Surrogate) | Surrogate: 1,2,3,7,8-Pentachlorodibenzo-p-dioxin-13C (PeCDD) |
| PeCDD-13C12, 1,2,3,7,8-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3,7,8-PeCDD-13C12 |
| PeCDF, 1,2,3,7,8- | 1,2,3,7,8-Pentachlorodibenzofuran (PeCDF) |
| PECDF, 1,2,3,7,8- (TEQ ND=0) | 1,2,3,7,8-PECDF (TEQ ND=0) |
| PECDF, 1,2,3,7,8- (TEQ ND=1/2 DL) | 1,2,3,7,8-PECDF (TEQ ND=1/2 DL) |
| PeCDF, 1,2,3,7,8-(Surrogate) | Surrogate: 1,2,3,7,8-Pentachlorodibenzofuran (PeCDF) |
| PeCDF, 2,3,4,7,8- | 2,3,4,7,8-Pentachlorodibenzofuran (PeCDF) |
| PECDF, 2,3,4,7,8- (TEQ ND=0) | 2,3,4,7,8-PECDF (TEQ ND=0) |
| PECDF, 2,3,4,7,8- (TEQ ND=1/2 DL) | 2,3,4,7,8-PECDF (TEQ ND=1/2 DL) |
| PeCDF, 2,3,4,7,8-(Surrogate) | Surrogate: 2,3,4,7,8-Pentachlorodibenzofuran (PeCDF) |
| PeCDF-13C12, 1,2,3,7,8-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3,7,8-PeCDF-13C12 |
| PeCDF-13C12, 2,3,4,7,8-(IsoDilAnalogue) | Isotope Dilution Analogue: 2,3,4,7,8-PeCDF-13C12 |
| Pen/Marker | Pen/Marker |
| Pendimethalin | Pendimethalin (Prowl) |
| Penicillin G | Penicillin G |
| Penicillin V | Penicillin V |
| Penoxsulam | Penoxsulam |
| Pentachloroanisole | Pentachloroanisole |
| Pentachlorobenzene | Pentachlorobenzene |
| Pentachlorobenzene-13C6(IsoDilAnalogue) | Isotope Dilution Analogue: Pentachlorobenzene-13C6 |
| Pentachloronitrobenzene | Pentachloronitrobenzene (PCNB) |
| Pentachlorophenol | Pentachlorophenol |
| Penthiopyrad | Penthiopyrad |
| Percent normal pluteus stage | Percent normal pluteus stage |
| Perchlorate | Perchlorate |
| Perfluoro(2-ethoxyethane)sulfonic acid | Perfluoro(2-ethoxyethane)sulfonic acid (PFEESA) |
| Perfluoro-2-Propoxypropanoic Acid | Perfluoro-2-Propoxypropanoic Acid |
| Perfluoro-2-Propoxypropanoic Acid-13C3(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluoro-2-Propoxypropanoic Acid-13C3 (HFPO-DA) |
| Perfluoro-3,6-dioxaheptanoate | Perfluoro-3,6-dioxaheptanoate (Nonafluoro-3,6-dioxaheptanoic acid) (NFDHA) |
| Perfluoro-3-methoxypropanoate | Perfluoro-3-methoxypropanoate (Perfluoro-3-methoxypropanoic acid) (PFMPA) |
| Perfluoro-4-methoxybutanoate | Perfluoro-4-methoxybutanoate (Perfluoro-4-methoxybutanoic acid) (PFMBA) |
| Perfluorobutanesulfonate | Perfluorobutanesulfonate |
| Perfluorobutanesulfonate-13C3(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorobutanesulfonate-13C3 (PFBS) |
| Perfluorobutanoate | Perfluorobutanoic Acid (PFBTA), (PFBA) |
| Perfluorobutanoate(Surrogate) | Surrogate: Perfluorobutanoic Acid (PFBTA), (PFBA) |
| Perfluorobutanoate-13C4(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorobutanoate-13C4 (PFBTA) (PFBA) |
| Perfluorodecanesulfonate | Perfluorodecanesulfonate |
| Perfluorodecanoate | Perfluorodecanoic Acid (PFDA) |
| Perfluorodecanoate(Surrogate) | Surrogate: Perfluorodecanoic Acid (PFDA) |
| Perfluorodecanoate-13C6(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorodecanoate-13C6 (PFDA) |
| Perfluorododecanesulfonate | Perfluorododecanesulfonate |
| Perfluorododecanoate | Perfluorododecanoic Acid (PFDoA) |
| Perfluorododecanoate(Surrogate) | Surrogate: Perfluorododecanoic Acid (PFDoA) |
| Perfluorododecanoate-13C2(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorododecanoate-13C2 (PFDoA) |
| Perfluoroheptanesulfonate | Perfluoroheptanesulfonate |
| Perfluoroheptanoate | Perfluoroheptanoic Acid (PFHpA) |
| Perfluoroheptanoate-13C4(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluoroheptanoate-13C4 (PFHpA) |
| Perfluorohexanesulfonate | Perfluorohexanesulfonate |
| Perfluorohexanesulfonate-13C3(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorohexanesulfonate-13C3 (PFHxS) |
| Perfluorohexanesulfonate-18O2(Surrogate) | Surrogate: Perfluorohexanesulfonate-18O2 |
| Perfluorohexanoate | Perfluorohexanoic Acid (PFHxA) |
| Perfluorohexanoate(Surrogate) | Surrogate: Perfluorohexanoic Acid (PFHxA) |
| Perfluorohexanoate-13C5(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorohexanoate-13C5 (PFHxA) |
| Perfluorononanesulfonate | Perfluorononanesulfonate |
| Perfluorononanoate | Perfluorononanoic Acid (PFNA) |
| Perfluorononanoate(Surrogate) | Surrogate: Perfluorononanoic Acid (PFNA) |
| Perfluorononanoate-13C9(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorononanoate-13C9 (PFNA) |
| Perfluorooctanesulfonamide | Perfluorooctanesulfonamide |
| Perfluorooctanesulfonamide-13C8(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorooctanesulfonamide-13C8 (PFOSA) |
| Perfluorooctanesulfonate | Perfluorooctanesulfonate |
| Perfluorooctanesulfonate 080(Surrogate) | Surrogate: Perfluorooctanesulfonate 080 (PFOS) |
| Perfluorooctanesulfonate-13C8(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorooctanesulfonate-13C8 (PFOS) |
| Perfluorooctanesulfonic acid (PFOS) | Perfluorooctanesulfonic acid (PFOS) |
| Perfluorooctanesulfonic acid-13C8(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorooctanesulfonic acid-13C8 (PFOS) |
| Perfluorooctanoate | Perfluorooctanoic Acid (PFOA) |
| Perfluorooctanoate(Surrogate) | Surrogate: Perfluorooctanoic Acid (PFOA) |
| Perfluorooctanoate-13C8(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorooctanoate-13C8 (PFOA) |
| Perfluorooctanoate-13C8(Surrogate) | Surrogate: Perfluorooctanoate-13C8 |
| Perfluorooctanoic acid (PFOA) | Perfluorooctanoic acid (PFOA) |
| Perfluorooctanoic acid-13C2(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorooctanoic acid-13C2 (PFOA) |
| Perfluoropentanesulfonate | Perfluoropentanesulfonate |
| Perfluoropentanoate | Perfluoropentanoic Acid (PFPeA) |
| Perfluoropentanoate-13C5(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluoropentanoate-13C5 (PFPA) (PFPeA) |
| Perfluorotetradecanoate | Perfluorotetradecanoate |
| Perfluorotetradecanoate-13C2(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorotetradecanoate-13C2 (PFTeDA) (PFTA) |
| Perfluorotridecanoate | Perfluorotridecanoate |
| Perfluorotridecanoate-13C2(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluorotridecanoate-13C2 (PFTrDA) |
| Perfluoroundecanoate | Perfluoroundecanoic Acid (PFUnA) |
| Perfluoroundecanoate-13C7(IsoDilAnalogue) | Isotope Dilution Analogue: Perfluoroundecanoate-13C7 (PFUnDA) (PFUdA) |
| Permethrin, cis- | cis-Permethrin, formerly peak 1 |
| Permethrin, cis-(Surrogate) | Surrogate: cis-Permethrin |
| Permethrin, Total | Total Permethrin, sum peaks cis and trans (formerly 1 & 2) |
| Permethrin, trans- | trans-Permethrin formerly peak 2 |
| Permethrin-13C6, cis-(IsoDilAnalogue) | Isotope Dilution Analogue: cis-Permethrin-13C6 |
| Permethrin-13C6, cis-(Surrogate) | Surrogate: cis-Permethrin-13C6 |
| Permethrin-13C6, trans-(IsoDilAnalogue) | Isotope Dilution Analogue: trans-Permethrin-13C6 |
| Perthane | Perthane |
| Perylene | Perylene |
| Perylene-d12(IsoDilAnalogue) | Isotope Dilution Analogue: Perylene-d12 |
| Perylene-d12(Surrogate) | Surrogate: Perylene-d12 |
| pH | pH |
| Phenanthrene | Phenanthrene |
| Phenanthrene/Anthracene, C1- | C1-Phenanthrene/Anthracene |
| Phenanthrene/Anthracene, C2- | C2-Phenanthrene/Anthracene |
| Phenanthrene/Anthracene, C3- | C3-Phenanthrene/Anthracene |
| Phenanthrene/Anthracene, C4- | C4-Phenanthrene/Anthracene |
| Phenanthrene-d10(IsoDilAnalogue) | Isotope Dilution Analogue: Phenanthrene-d10 |
| Phenanthrene-d10(Surrogate) | Surrogate: Phenanthrene-d10 |
| Phenol | Phenol |
| Phenol-d5(Surrogate) | Surrogate: Phenol-d5 |
| Phenol-d6(Surrogate) | Surrogate: Phenol-d6 |
| Phenolics, Total | Total Phenolics, classification of phenols |
| Phenothrin | Phenothrin |
| Phenytoin | Phenytoin |
| Pheophytin a | Pheophytin a |
| Phone | Phone |
| Phorate | Phorate |
| Phosalone | Phosalone |
| Phosmet | Phosmet |
| Phosphamidon | Phosphamidon |
| Phosphate as P | Phosphate as P |
| Phosphorus as P | Phosphorus as P |
| Picarbutrazox | Picarbutrazox |
| Picloram | Picloram |
| Picoxystrobin | Picoxystrobin |
| PictureCode | Picture code idenifier |
| Pipe, PVC | Pipe, PVC |
| Piperonyl Butoxide | Piperonyl Butoxide |
| Pipes, Drains | Pipes, Drains |
| Pirimiphos Methyl | Pirimiphos Methyl |
| Plastic | Plastic using Trash Protocol |
| Plastic MicroDebris, > 4.75 mm | Plastic MicroDebris, > 4.75 mm |
| Plastic MicroDebris, 0.355 mm | Plastic MicroDebris, 0.355 mm |
| Plastic MicroDebris, 0.500 mm | Plastic MicroDebris, 0.500 mm |
| Plastic MicroDebris, 1.0 mm | Plastic MicroDebris, 1.0 mm |
| Plastic MicroDebris, 2.0 mm | Plastic MicroDebris, 2.0 mm |
| Plastic MicroDebris, 4.75 mm | Plastic MicroDebris, 4.75 mm |
| Plastic MicroDebris, Black | Plastic MicroDebris, Black |
| Plastic MicroDebris, Blue | Plastic MicroDebris, Blue |
| Plastic MicroDebris, Clear | Plastic MicroDebris, Clear |
| Plastic MicroDebris, Green | Plastic MicroDebris, Green |
| Plastic MicroDebris, Grey | Plastic MicroDebris, Grey |
| Plastic MicroDebris, Orange | Plastic MicroDebris, Orange |
| Plastic MicroDebris, Peach | Plastic MicroDebris, Peach |
| Plastic MicroDebris, Pink | Plastic MicroDebris, Pink |
| Plastic MicroDebris, Red | Plastic MicroDebris, Red |
| Plastic MicroDebris, Tan | Plastic MicroDebris, Tan |
| Plastic MicroDebris, White | Plastic MicroDebris, White |
| Plastic MicroDebris, Yellow | Plastic MicroDebris, Yellow |
| Plastic, Other | Plastic, Other |
| Plate, Waxed Paper | Plate, Waxed Paper |
| Ponded | Ponded water that either evaporates and/or infiltrates and does not flow to a surface receiving water |
| Pool | Pool |
| Pool Form | Pool Form |
| Position | Position along transect where sample collected |
| Potassium | Potassium |
| Potential Non-Stormwater Source | Potential Non-Stormwater Source |
| Poultry | Poultry |
| Power Plants | Power Plants |
| Prallethrin | Prallethrin |
| Praziquantel | Praziquantel |
| Precipitation | Precipitation |
| PrecipitationLast24hrs | PrecipitationLast24hrs |
| Precipitationlast72hrs | Precipitation within the last 72 hours |
| Primidone | Primidone |
| Primitive Parks, Camping | Primitive Parks, Camping |
| Procymidone | Procymidone |
| Prodiamine | Prodiamine |
| Profenofos | Profenofos |
| Profluralin | Profluralin |
| Progesterone | Progesterone |
| Progesterone-d9(IsoDilAnalogue) | Isotope Dilution Analogue: Progesterone-d9 |
| Promecarb | Promecarb (3-methyl-5-(1-methylethyl)phenyl methylcarbamate) |
| Prometon | Prometon |
| Prometryn | Prometryn |
| Pronamide | Pronamide (Propyzamide) |
| Propachlor | Propachlor |
| Propanil | Propanil |
| Propargite | Propargite |
| Propazine | Propazine |
| Propham | Propham |
| Propiconazole | Propiconazole |
| Proportion | Proportion |
| Propoxur | Propoxur |
| Propylbenzene, n- | n-Propylbenzene |
| Propyzamide | Propyzamide |
| p-Terphenyl-d14(Surrogate) | Surrogate: p-Terphenyl-d14 |
| Public Access | Public Access |
| Pydiflumetofen | Pydiflumetofen |
| Pymetrozin | Pymetrozin |
| Pyraclostrobin | Pyraclostrobin |
| Pyrene | Pyrene |
| Pyrene-d10(Surrogate) | Surrogate: Pyrene-d10 |
| Pyrethrin-1 | Pyrethrin-1 |
| Pyrethrin-2 | Pyrethrin-2 (Pyrethrin II) |
| Pyridaben | Pyridaben |
| Pyridine | Pyridine |
| Pyrimethanil | Pyrimethanil |
| Pyriproxyfen | Pyriproxyfen |
| Quinoline | Quinoline |
| Quinoxyfen | Quinoxyfen |
| Radium-226 | Radium-226 |
| Radium-228 | Radium-228 |
| Rapid | Rapid |
| Rebar | Rebar |
| Reburial | Reburial |
| Relative Luminescence | Relative Luminescence |
| Reproduction | Reproduction |
| Residences | Residences |
| Residential Dumping | Residential Dumping |
| Resmethrin | Resmethrin |
| Retene | Retene |
| Ribbon, Non-plastic | Ribbon, Non-plastic |
| Ribbon, Packaging | Ribbon, Packaging |
| Richness | Richness |
| Riffle | Riffle |
| Riffle/Run Bank Stability | Riffle/Run Bank Stability (used for EMAP RBP 20-score habitat characterization) |
| Riffle/Run Channel Alteration | Riffle/Run Channel Alteration |
| Riffle/Run Channel Flow Status | Riffle/Run Channel Flow Status |
| Riffle/Run Embeddedness | Riffle/Run Embeddedness |
| Riffle/Run Epifaunal Substrate | Riffle/Run Epifaunal Substrate |
| Riffle/Run Frequency | Riffle/Run Frequency |
| Riffle/Run Riparian Zone Width | Riffle/Run Riparian Zone Width |
| Riffle/Run Sediment Deposition | Riffle/Run Sediment Deposition |
| Riffle/Run Vegetative Protection | Riffle/Run Vegetative Protection |
| Riffle/Run Velocity/Depth Regime | Riffle/Run Velocity/Depth Regime scale data |
| Rimsulfuron | Rimsulfuron |
| Riparian Bridges/Abutments | Riparian Bridges/Abutments |
| Riparian Buildings | Riparian Buildings |
| Riparian Canopy Big Trees | EMAP BA Specific - Riparian Canopy Big Trees (Trunk > 0.3m DBH) |
| Riparian Canopy Small Trees | EMAP BA Specific - Riparian Canopy Small Trees (Trunk < 0.3 m DBH) |
| Riparian Canopy Veg Type | Riparian Canopy Vegetation Type |
| Riparian Corridor Shading | Percent of stream's water surface upstream of sample location estimated to be shaded if the sun was directly over the stream |
| Riparian Cover Metric | Metric assesses total vegetation cover in the riparian and channel zones (excluding low-flow) and includes any kind of tree, bush, shrub, or helophyte. |
| Riparian GroundCover Barren | Riparian Ground Cover Barren, Bare Dirt or Duff |
| Riparian GroundCover NonWoody Plants | Riparian Ground Cover Non-woody Herbs, Grasses & Forbes |
| Riparian GroundCover Woody Shrubs | Riparian Ground Cover Woody Shrubs & Saplings |
| Riparian Landfill/Trash | Riparian Landfill/Trash |
| Riparian Logging | Riparian Logging Operations |
| Riparian Lower Canopy All Vegetation | Riparian Lower Canopy All Vegetation (merge of Riparian Understory Non-Woody Plants and Riparian Understory Woody Shrubs in EMAP BA) |
| Riparian Mining | Riparian Mining Activity |
| Riparian Orchards/Vineyards | Riparian Orchards/Vineyards |
| Riparian Park/Lawn | Riparian Park/Lawn |
| Riparian Pasture/Range | Riparian Pasture/Range/Hay field |
| Riparian Pavement | Riparian Pavement/Cleared Lot |
| Riparian Pipes | Riparian Piles (Inlet/Outlet) |
| Riparian Powerline | Human disturbance measure for powerlines |
| Riparian Road | Riparian Road/Railroad |
| Riparian Row Crops | Riparian Row Crops |
| Riparian Sub Condition/Vert Connectivity Metric | Metric assesses riparian substratum condition influencing natural infiltration capacity and vertical connectivity affecting alluvial permeability, subsurface flows and groundwater connectivity. |
| Riparian Trail | Human disturbance measure for trails |
| Riparian Understory NonWoody Plants | EMAP BA specific - Riparian Understory Non-woody Herbs, Grasses & Forbes |
| Riparian Understory Veg Type | Riparian Understory Vegetation Type |
| Riparian Understory Woody Shrubs | EMAP BA Specific - Riparian Understory Woody Shrubs & Saplings |
| Riparian Upper Canopy All Trees | Riparian Upper Canopy All Trees (merge of Riparian Canopy Big Trees and Small Trees in EMAP BA) |
| Riparian Upper Canopy Deciduous | Riparian Upper Canopy Deciduous |
| Riparian Upper Canopy Evergreen | Riparian Upper Canopy Evergreen |
| Riparian Vegetation Management | Riparian Vegetation Management |
| Riparian Vegetation Width Metric | Metric assesses the average width of the defined riparian zone along the assessment area. |
| Riparian Wall/Dike | Riparian Wall/Dike/Revetment/Riprap/Dam |
| RipRAM Index | Riparian Rapid Assessment Method (RAM) for California index score based on the average score of eight component metrics. |
| RisingGroundwater | Rising groundwater (i.e., a spring) that is the source of water in a receiving water and may contribute (or even define) the receiving water quality |
| Roads | Roads |
| Rope, Polypropylene | Rope, Polypropylene |
| Rope/Tie | Rope/Tie |
| Roxithromycin | Roxithromycin |
| Rubber Materials (Non-Specific) | Rubber Materials (Non-Specific) |
| Rubber Piece | Rubber Piece |
| Run | Run |
| Safrotin | Safrotin |
| Salicylic Acid | Salicylic Acid |
| Salicylic Acid-d4(IsoDilAnalogue) | Isotope Dilution Analogue: Salicylic Acid-d4 |
| Salinity | Salinity |
| Salmonella | Salmonella |
| Salmonella-invA | Salmonella-invA |
| Salmonella-ttr | Salmonella-ttr |
| SampleVolume | Volume of water collected in the field |
| SamplingCrew | Sampling Crew |
| Sand | Sand |
| Sand + Fine | Sand + Fine |
| Sarafloxacin | Sarafloxacin |
| Saxitoxins | Saxitoxins |
| Scandium | Scandium |
| Seagrass | Seagrass |
| SeaState | SeaState |
| Secbumeton | Secbumeton |
| Secchi Depth | Measurement of clarity based on the depth at which the Secchi disk can be differentiated |
| Sedaxane | Sedaxane |
| Sediment reworking rate | Sediment reworking rate |
| Selenate as Se | Selenate as Se (Se VI) |
| Selenite as Se | Selenite as Se (Se IV) |
| Selenium | Selenium |
| SEM | SEM (Simultaneously Extracted Metals) |
| Sethoxydim | Sethoxydim |
| Settleable Solids | Settleable Solids |
| Sewage Treatment | Sewage Treatment |
| Shade | Amount of shade within the algae sampling area (1 m2) |
| Shoe | Shoe |
| Shopping Cart | Shopping Cart |
| Side Channel | Side Channel present |
| Siduron | Siduron |
| Silica as SiO2 | Silica as SiO2 |
| Silicate as Si | Silicate as Si (Si(OH)4) |
| Silicon | Silicon
|
| Silt | Silt |
| Silt + Clay | Silt + Clay |
| Silver | Silver |
| Simazine | Simazine |
| Simazine(Surrogate) | Surrogate: Simazine |
| Simetryn | Simetryn |
| Sinuosity | Ratio of the curvilinear length along a stream and the Euclidean (straight line) distance between two points along the stream |
| Site Length | Site Length |
| Site Width | Site Width |
| SkyCode | SkyCode |
| Slope | Slope |
| SOD | Sediment Oxygen Demand (SOD) |
| Sodium | Sodium |
| Soft Plastic Piece, non-specific | Soft Plastic Piece, non-specific |
| Soft Sediment | Soft Sediment; indicates presence/absence of soft/small sediment at the point where depth is measured |
| Soot | Soot/Black Carbon |
| SpecificConductivity | Specific Conductivity |
| Sports Ball | Sports Ball |
| Spray Paint Can | Spray Paint Can |
| StationWaterDepth | Depth of waterbody where sample was collected |
| StationWaterDepth_Avg | Estimated average depth of the waterbody at the time of sampling |
| StationWaterDepth_Max | Estimated maximum depth of the waterbody at the time of sampling |
| Stick/Branch/Driftwood | Stick/Branch/Driftwood |
| Straw | Straw |
| Stream Confinement | Confinement based upon the valley width in relation to average bankfull width which the riverine system can migrate without encountering a hillside, terrace or other feature |
| Stream Gradient | Steepness of the stream |
| StreamBankCharacteristics_Concrete | StreamBankCharacteristics_Concrete |
| StreamBankCharacteristics_Earthen | StreamBankCharacteristics_Earthen |
| StreamBankCharacteristics_RipRap | StreamBankCharacteristics_RipRap |
| StreamBankCharacteristics_Sloped | StreamBankCharacteristics_Sloped |
| StreamBankCharacteristics_Vegetated | StreamBankCharacteristics_Vegetated |
| StreamBankCharacteristics_Vertical | StreamBankCharacteristics_Vertical |
| StreamBedCharacteristics_Concrete | StreamBedCharacteristics_Concrete |
| StreamBedCharacteristics_Earthen | StreamBedCharacteristics_Earthen |
| StreamBedCharacteristics_Rock | StreamBedCharacteristics_Rock |
| StreamBedCharacteristics_SubPlants | StreamBedCharacteristics_SubPlants |
| StreamMixing | Classification of stream mixing by stratification, well-mixed or poorly mixed |
| Stretch | refers to stretch measurement in gillnet |
| Strontium | Strontium |
| Strontium-87/Strontium-86 Ratio | Strontium-87/Strontium-86 Ratio |
| Strontium-90 | Strontium-90 |
| Styrene | Styrene |
| Styrofoam Pellet | Styrofoam Pellet |
| SubreachesFished | Subreaches fished within a given waterbody |
| Substrate Modifier | Substrate Modifier |
| Substrate Size Class | Substrate Size Class |
| Sucralose | Sucralose |
| Sulfachloropyridazine | Sulfachloropyridazine |
| Sulfadiazine | Sulfadiazine |
| Sulfadimethoxine | Sulfadimethoxine |
| Sulfallate | Sulfallate (CDEC) |
| Sulfamerazine | Sulfamerazine |
| Sulfamethazine | Sulfamethazine |
| Sulfamethazine-13C6(Surrogate) | Surrogate: Sulfamethazine-13C6 |
| Sulfamethizole | Sulfamethizole |
| Sulfamethoxazole | Sulfamethoxazole |
| Sulfamethoxazole-13C6(Surrogate) | Surrogate: Sulfamethoxazole-13C6 |
| Sulfanilamide | Sulfanilamide |
| Sulfate | Sulfate |
| Sulfathiazole | Sulfathiazole |
| Sulfide, Total | Total Sulfide |
| Sulfometuron Methyl | Sulfometuron Methyl |
| Sulfotep | Sulfotepp |
| Sulfoxaflor | Sulfoxaflor |
| Sulfur | Sulfur |
| Sum of DDTs (RWQCB3) | Sum of DDD, DDE, and DDT (RWQCB3) |
| Sum of HPAHs (Integral) | Sum of HPAHs (Integral) |
| Sum of LPAHs (Integral) | Sum of LPAHs (Integral) |
| Surface Films | Surface Films |
| SurfaceAreaOfMax | Estimate of the current surface area size as a fraction of the total surface area the waterbody would have at high water stage |
| SurfacewaterConnect | Discharge from an outfall that does or does not flow to and have hydrologic continuity with a surface receiving water and has or does not have the potential to contribute to the quality of the surface receiving water quality |
| Survival | Survival (%) |
| Suspended Sediment Concentration | Suspended Sediment Concentration (SSC) |
| Suspended Sediment Discharge | Suspended Sediment Discharge |
| Swim Normally | Swim Normally (Num/Rep) |
| Syringe/Pipette | Syringe/Pipette |
| Tantalum | Tantalum |
| Tape | Tape |
| Tarp | Tarp |
| TCDD, 2,3,7,8- | 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) |
| TCDD, 2,3,7,8- (TEQ ND=0) | 2,3,7,8-TCDD (TEQ ND=0) |
| TCDD, 2,3,7,8- (TEQ ND=1/2 DL) | 2,3,7,8-TCDD (TEQ ND=1/2 DL) |
| TCDD, 2,3,7,8-(Surrogate) | Surrogate: 2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) |
| TCDD-13C, 2,3,7,8-(Surrogate) | Surrogate: 2,3,7,8-Tetrachlorodibenzo-p-dioxin-13C (TCDD) |
| TCDD-13C12, 2,3,7,8-(IsoDilAnalogue) | Isotope Dilution Analogue: 2,3,7,8-TCDD-13C12 |
| TCDD-13C6, 1,2,3,4-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3,4-TCDD-13C6 |
| TCDD-13C6, 1,2,3,4-(Surrogate) | Surrogate: 1,2,3,4-Tetrachlorodibenzo-p-dioxin-13C6 (TCDD) |
| TCDD-37Cl, 2,3,7,8-(Surrogate) | Surrogate: 2,3,7,8-Tetrachlorodibenzo-p-dioxin-37Cl (TCDD) |
| TCDD-37Cl14, 2,3,7,8-(IsoDilAnalogue) | Isotope Dilution Analogue: 2,3,7,8-TCDD-37Cl14 |
| TCDF, 2,3,7,8- | 2,3,7,8-Tetrachlorodibenzofuran (TCDF) |
| TCDF, 2,3,7,8- (TEQ ND=0) | 2,3,7,8-TCDF (TEQ ND=0) |
| TCDF, 2,3,7,8- (TEQ ND=1/2 DL) | 2,3,7,8-TCDF (TEQ ND=1/2 DL) |
| TCDF, 2,3,7,8-(Surrogate) | Surrogate: 2,3,7,8-Tetrachlorodibenzofuran (TCDF) |
| TCDF-13C12, 2,3,7,8-(IsoDilAnalogue) | Isotope Dilution Analogue: 2,3,7,8-TCDF-13C12 |
| TCDF-2C, 2,3,7,8- | 2,3,7,8-TCDF-2C |
| TCDF-2C, 2,3,7,8-(Surrogate) | Surrogate: 2,3,7,8-Tetrachlorodibenzofuran-2C (TCDF) |
| Tebuconazole | Tebuconazole (Folicur) |
| Tebuconazole-13C3(Surrogate) | Surrogate: Tebuconazole-13C3 |
| Tebuconazole-tert-Butylhydroxy | Tebuconazole-tert-Butylhydroxy |
| Tebufenozide | Tebufenozide |
| Tebupirimfos | Tebupirimfos |
| Tebupirimfos oxon | Tebupirimfos oxon |
| Tebuthiuron | Tebuthiuron |
| Tebuthiuron(Surrogate) | Surrogate: Tebuthiuron |
| Tedion | Tedion (Tetradifon) |
| Tefluthrin | Tefluthrin |
| Television | Television |
| Temephos | Temephos |
| Temperature | Temperature |
| Terbacil | Terbacil |
| Terbufos | Terbufos |
| Terbuthylazine | Terbuthylazine |
| Terbutryn | Terbutryn |
| Terphenyl-d14 | Terphenyl-d14 |
| Terphenyl-d14(Surrogate) | Surrogate: Terphenyl-d14 |
| Tert-amyl Methyl Ether | Tert-amyl Methyl Ether |
| Tert-butyl Alcohol | Tert-butyl Alcohol |
| Testosterone | Testosterone |
| Testosterone-d3(IsoDilAnalogue) | Isotope Dilution Analogue: Testosterone-d3 |
| Tetrabutyltin as Sn | Tetrabutyltin as Sn |
| Tetrachlorobenzene, 1,2,3,4- | 1,2,3,4-Tetrachlorobenzene |
| Tetrachlorobenzene, 1,2,3,4-(Surrogate) | Surrogate: 1,2,3,4-Tetrachlorobenzene |
| Tetrachlorobenzene, 1,2,3,5/1,2,4,5- | 1,2,3,5/1,2,4,5-Tetrachlorobenzene |
| Tetrachlorobenzene-13C6,1,2,3,4-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3,4-Tetrachlorobenzene-13C6 |
| Tetrachloroethane, 1,1,1,2- | 1,1,1,2-Tetrachloroethane |
| Tetrachloroethane, 1,1,2,2- | 1,1,2,2-Tetrachloroethane |
| Tetrachloroethylene | Tetrachloroethylene, Tetrachloroethene |
| Tetrachloro-m-xylene | Tetrachlorometaxylene (TCMX) |
| Tetrachloro-m-xylene(Surrogate) | Surrogate: Tetrachloro-m-xylene (TCMX) |
| Tetrachlorophenol, 2,3,4,5- | 2,3,4,5-Tetrachlorophenol |
| Tetrachlorophenol, 2,3,4,6- | 2,3,4,6-Tetrachlorophenol |
| Tetrachlorophenol, 2,3,5,6- | 2,3,5,6-Tetrachlorophenol |
| Tetrachlorvinphos | Tetrachlorvinphos (Stirofos) |
| Tetraconazole | Tetraconazole (1-[2-(2,4-Dichlorophenyl)-3-(1,1,2,2-tetrafluoroethoxy)propyl]- 1H-1,2,4-triazole)
Tetraconazole (1-[2-(2,4-Dichlorophenyl)-3-(1,1,2,2-tetrafluoroethoxy)propyl]- 1H-1,2,4-triazole) |
| Tetracosane, n- | n-Tetracosane |
| Tetracosane, n-(Surrogate) | Surrogate: n-Tetracosane |
| Tetracycline | Tetracycline |
| Tetradifon | Tetradifon |
| Tetraethyl Pyrophosphate | Tetraethyl Pyrophosphate (TEPP) |
| Tetramethrin | Tetramethrin |
| Tetramethylnaphthalene, 1,4,6,7- | 1,4,6,7-Tetramethylnaphthalene |
| Tetryl | Tetryl |
| T-Fluvalinate | T-Fluvalinate |
| Thallium | Thallium |
| Thiabendazole | Thiabendazole |
| Thiabendazole-d6(Surrogate) | Surrogate: Thiabendazole-d6 |
| Thiacloprid | Thiacloprid |
| Thiamethoxam | Thiamethoxam |
| Thiamethoxam Degradate (CGA-355190) | Thiamethoxam Degradate (CGA-355190) |
| Thiamethoxam Degradate (NOA-407475) | Thiamethoxam Degradate (NOA-407475) |
| Thiamethoxam-d3(Surrogate) | Surrogate: Thiamethoxam-d3 |
| Thiazopyr | Thiazopyr |
| Thiobencarb | Thiobencarb (Benthiocarb) (Bolero) |
| Thiobencarb(Surrogate) | Surrogate: Thiobencarb (Benthiocarb) (Bolero) |
| Thionazin | Thionazin (Thionzin) |
| Thiram | Thiram |
| Thorium | Thorium |
| Tidal Height | Tidal Height |
| Tidal State | Tidal State |
| TidalDirection | TidalDirection |
| Time | Time |
| Time to maturity | Time to maturity (days) |
| Time, Fishing | Time spent fishing within a given waterbody |
| Time, Shock | Time spent electroshocking within a given waterbody |
| TimeToSpinTest | Time the velocity meter spins during QA/QC calibration checks |
| Tin | Tin |
| Tire | Tire |
| Titanium | Titanium |
| Tokuthion | Tokuthion (Prothiofos) |
| Tolfenpyrad | Tolfenpyrad |
| Toluene | Toluene |
| Toluene-d8(Surrogate) | Surrogate: Toluene-d8 |
| Toothbrush | Toothbrush |
| Torrent 01 | Torrent 01 - Recently devegetated corridor two or more times the width of the low flow channel |
| Torrent 02 | Torrent 02 - Substrate cobbles or large gravel particles are not imbricated |
| Torrent 03 | Torrent 03 - Channel has little evidence of pool-riffle structure |
| Torrent 04 | Torrent 04 - Stream channel is scoured down to bedrock |
| Torrent 05 | Torrent 05 - Gravel and cobble berms above bankfull level |
| Torrent 06 | Torrent 06 - Massive deposits downstream of reach |
| Torrent 07 | Torrent 07 - Riparian trees have fresh bark scars |
| Torrent 08 | Torrent 08 - Riparian trees have fallen into channel as a result of scouring near their roots |
| Torrent 09 | Torrent 09 - Massive deposits of sediment, logs and debris within reach |
| Torrent 10 | Torrent 10 - Newly erroded deposits show evidence that the deposits are matrix supported |
| Torrent 11 | Torrent 11 - No evidence of torrent scouring or torrent deposits |
| Total Anions | Total Anions |
| Total Cations | Total Cations |
| Total Cell Count | Total Cell Count |
| Total Chlordanes | Total Chlordanes |
| Total DDDs | Total DDDs |
| Total DDEs | Total DDEs |
| Total DDTs | Total DDTs |
| Total Debris, >2.5 cm | Total Debris >2.5 cm |
| Total Debris, 2.5 cm - 5 mm | Total Debris 2.5 cm - 5 mm |
| Total Dichlorobiphenyls | Total Dichlorobiphenyls |
| Total Dioxins-Furans (TEQ ND=0) | Total Dioxins-Furans (TEQ ND=0 DL) |
| Total Dioxins-Furans (TEQ ND=1/2 DL) | Total Dioxins-Furans (TEQ ND=1/2 DL) |
| Total Di-PCB | Total Di-PCB |
| Total Dissolved Solids | Total Dissolved Solids |
| Total HCHs | Total HCHs |
| Total Heptachlorobiphenyls | Total Heptachlorobiphenyls |
| Total Hepta-Dioxins | Total Hepta-Dioxins |
| Total Hepta-Furans | Total Hepta-Furans |
| Total Hepta-PCB | Total Hepta-PCB |
| Total Hexachlorobiphenyls | Total Hexachlorobiphenyls |
| Total Hexa-Dioxins | Total Hexa-Dioxins |
| Total Hexa-Furans | Total Hexa-Furans |
| Total Hexa-PCB | Total Hexa-PCB |
| Total Inorganic Carbon | Total Inorganic Carbon (TIC) |
| Total Monochlorobiphenyls | Total Monochlorobiphenyls |
| Total Mono-PCB | Total Mono-PCB |
| Total Nonachlorobiphenyls | Total Nonachlorobiphenyls |
| Total Nona-PCB | Total Nona-PCB |
| Total Normal | Total Normal |
| Total Octachlorobiphenyls | Total Octachlorobiphenyls |
| Total Octa-PCB | Total Octa-PCB |
| Total Organic Carbon | Total Organic Carbon (TOC) |
| Total Organic Matter | Includes all the elements (hydrogen, oxygen, nitrogen, etc) that are components of organic compounds, not just carbon. |
| Total PAHs | Total PAHs |
| Total PCBs | Total PCBs |
| Total Pentachlorobiphenyls | Total Pentachlorobiphenyls |
| Total Penta-Dioxins | Total Penta-Dioxins |
| Total Penta-Furans | Total Penta-Furans |
| Total Penta-PCB | Total Penta-PCB |
| Total Pyrethrins | Total Pyrethrins |
| Total Solids | Total Solids |
| Total Suspended Solids | Total Suspended Solids |
| Total TEQ (WHO 2005; ND=0) | Total TEQ (WHO 2005; ND=0) |
| Total TEQ (WHO 2005; ND=1/2DL) | Total TEQ (WHO 2005; ND=1/2DL) |
| Total Tetrachlorobiphenyls | Total Tetrachlorobiphenyls |
| Total Tetra-Dioxins | Total Tetra-Dioxins |
| Total Tetra-Furans | Total Tetra-Furans |
| Total Tetra-PCB | Total Tetra-PCB |
| Total Trichlorobiphenyls | Total Trichlorobiphenyls |
| Total Tri-PCB | Total Tri-PCB |
| TotalPieces | Total Pieces of Trash using Trash Protocol |
| Toxaphene | Toxaphene |
| Toxic | Toxic using Trash Protocol |
| Toxic, Other | Toxic, Other |
| Toy | Toy |
| TPH as Diesel C10-C22 | TPH as Diesel C10-C22 |
| TPH as Diesel C10-C24 | TPH as Diesel C10-C24 |
| TPH as Diesel C10-C25 | TPH as Diesel C10-C25 |
| TPH as Diesel C10-C28 | TPH as Diesel C10-C28 |
| TPH as Diesel C12-C24 | TPH as Diesel C12-C24 |
| TPH as Diesel C13-C22 | TPH as Diesel C13-C22 |
| TPH as Diesel C13-C28 | TPH as Diesel C13-C28 |
| TPH as Gasoline | TPH as Gasoline |
| TPH as Gasoline C3-C13 | TPH as Gasoline C3-C13 |
| TPH as Gasoline C4-C12 | TPH as Gasoline C4-C12 |
| TPH as Gasoline C6-C10 | TPH as Gasoline C6-C10 |
| TPH as Gasoline C6-C12 | TPH as Gasoline C6-C12 |
| TPH as Heavy Fuel Oils C22-C36 | TPH as Heavy Fuel Oils C22-C36 |
| TPH as JP8 C7-C18 | TPH as JP8 C7-C18 |
| TPH as Motor Oil C21-C32 | TPH as Motor Oil C21-C32 |
| TPH as Motor Oil C23-C36 | TPH as Motor Oil C23-C36 |
| TPH as Motor Oil C23-C40 | TPH as Motor Oil C23-C40 |
| TPH as Motor Oil C24-C36 | TPH as Motor Oil C24-C36 |
| TPH as Motor Oil C24-C40 | TPH as Motor Oil C24-C40 |
| TPH as Motor Oil C25-C36 | TPH as Motor Oil C25-C36 |
| TPH as Motor Oil C29-C40 | TPH as Motor Oil C29-C40 |
| TPH as Oil C29-C44 | TPH as Oil C29-C44 |
| Tralomethrin | Tralomethrin |
| TransectsSampled | Number of transects sampled to attain sample material |
| Transmittance | Transmittance |
| Transparency | Transparency |
| Trash at >96" Drain | Trash at >96" Drain |
| Trash at 12" Drain | Trash at 12" Drain |
| Trash at 18" Drain | Trash at 18" Drain |
| Trash at 24" Drain | Trash at 24" Drain |
| Trash at 30" Drain | Trash at 30" Drain |
| Trash at 36" Drain | Trash at 36" Drain |
| Trash at 48" Drain | Trash at 48" Drain |
| Trash at 60" Drain | Trash at 60" Drain |
| Trash, Litter | Trash, Litter |
| TrashAssessment | RWQCB Trash Assessment |
| Tree_Diameter | Diameter at breast height of the largest potential legacy tree visible from the location |
| Tree_Distance | Distance from the wetted edge to the largest potential legacy tree visible from the location |
| Tree_Height | Height of the largest potential legacy tree visible from the location |
| Tree_TaxonomicCategoryCode | Taxonomic Category Code of the largest potential legacy tree visible from the location |
| Triacontane, n-(Surrogate) | Surrogate: n-Triacontane |
| Triadimefon | Triadimefon |
| Triadimenol | Triadimenol |
| Triallate | Triallate |
| Tribromophenol, 2,4,6- | 2,4,6-Tribromophenol |
| Tribromophenol, 2,4,6-(Surrogate) | Surrogate: 2,4,6-Tribromophenol |
| Tributyl Phosphorotrithioate, S,S,S- | S,S,S-Tributyl Phosphorotrithioate (Def) (Butifos) (Merphos) |
| Tributylphosphate | Tributylphosphate (TBP) |
| Tributylphosphate(Surrogate) | Surrogate: Tributylphosphate (Butyl Phosphate) |
| Tributyltin as Sn | Tributyltin as Sn (TBT) |
| Tributyltin as Sn-d27(Surrogate) | Surrogate: Tributyltin as Sn-d27 |
| Trichlorfon | Trichlorfon |
| Trichloro-1,2,2-trifluoroethane, 1,1,2- | 1,1,2-Trichloro-1,2,2-trifluoroethane |
| Trichloro-2-pyridinyl)oxy)acetic Acid, ((3,5,6- | ((3,5,6-Trichloro-2-pyridinyl)oxy)acetic Acid (Triclopyr) |
| Trichlorobenzene, 1,2,3- | 1,2,3-Trichlorobenzene |
| Trichlorobenzene, 1,2,3-(Surrogate) | Surrogate: 1,2,3-Trichlorobenzene |
| Trichlorobenzene, 1,2,4- | 1,2,4-Trichlorobenzene |
| Trichlorobenzene, 1,3,5- | 1,3,5-Trichlorobenzene |
| Trichlorobenzene-13C6, 1,2,3-(IsoDilAnalogue) | Isotope Dilution Analogue: 1,2,3-Trichlorobenzene-13C6 |
| Trichloroethane, 1,1,1- | 1,1,1-Trichloroethane |
| Trichloroethane, 1,1,2- | 1,1,2-Trichloroethane |
| Trichloroethylene | Trichloroethylene (Trichloroethene) |
| Trichlorofluoromethane | Trichlorofluoromethane |
| Trichloronate | Trichloronate |
| Trichlorophenol, 2,4,5- | 2,4,5-Trichlorophenol |
| Trichlorophenol, 2,4,6- | 2,4,6-Trichlorophenol |
| Trichlorophenoxy)propionic Acid, 2-(2,4,5- | 2-(2,4,5-Trichlorophenoxy)propionic Acid (2,4,5-TP) (Silvex) (Fenoprop) |
| Trichlorophenoxyacetic Acid, 2,4,5- | 2,4,5-Trichlorophenoxyacetic Acid (2,4,5-T) |
| Trichlorophenoxyacetic Acid, 2,4,5-(Surrogate) | Surrogate: 2,4,5-Trichlorophenoxyacetic Acid (2,4,5-T) |
| Trichloropropane, 1,2,3- | 1,2,3-Tricloropropane |
| Triclocarban | Triclocarban |
| Triclocarban-13C6(Surrogate) | Surrogate: Triclocarban-13C6 |
| Triclopyr | Triclopyr |
| Triclosan | Triclosan |
| Triclosan-d3(IsoDilAnalogue) | Isotope Dilution Analogue: Triclosan-d3 |
| Tricyclazole | Tricyclazole (5-methyl-1,2,4-triazolo[3,4-b]benzothiazole) |
| Tridimephon | Triadimefon |
| Trifloxystrobin | Trifloxystrobin |
| Triflumizole | Triflumizole |
| Trifluorotolunene, a,a,a-(Surrogate) | Surrogate: a,a,a-Trifluorotoluene |
| Trifluralin | Trifluralin |
| Trifluralin-d14(Surrogate) | Surrogate: Trifluralin-d14 |
| Trihalomethanes, Total | Total Trihalomethanes |
| Trimethoprim | Trimethoprim |
| Trimethoprim-13C3(Surrogate) | Surrogate: Trimethoprim-13C3 |
| Trimethylbenzene, 1,2,4- | 1,2,4-Trimethylbenzene |
| Trimethylbenzene, 1,3,5- | 1,3,5-Trimethylbenzene |
| Trimethylnaphthalene, 1,6,7- | 1,6,7-Trimethylnaphthalene |
| Trimethylnaphthalene, 2,3,5- | 2,3,5-Trimethylnaphthalene |
| Trimethylnaphthalene, 2,3,6- | 2,3,6-Trimethylnaphthalene |
| Trimethylphenanthrene, 1,2,6- | 1,2,6-Trimethylphenanthrene |
| Trimethylphenol, 2,4,6-(Surrogate) | Surrogate: 2,4,6-Trimethylphenol |
| Trinitrotoluene, 2,4,6- | 2,4,6-Trinitrotoluene (TNT) |
| Tripentyltin(Surrogate) | Surrogate: Tripentyltin |
| Triphenyl Phosphate | Triphenyl Phosphate |
| Triphenyl phosphate(Surrogate) | Surrogate: Triphenyl Phosphate |
| Tris(1,3-dichloroisopropyl)phosphate | Tris(1,3-dichloroisopropyl)phosphate (TDCPP) |
| Tris(1-chloro-2-propyl)phosphate | Tris(1-chloro-2-propyl)phosphate (TCPP, multiple isomers) |
| Tris(2-chloroethyl)phosphate | Tris(2-chloroethyl)phosphate (TCEP) |
| Triticonazole | Triticonazole |
| Tritium | Tritium |
| Tritium 2scu | Tritium 2-sigma Combined Uncertainty |
| TrophicStatus | General classification of trophic status based on observed algae and herbaceous plant levels |
| TRPH | Total Recoverable Petroleum Hydrocarbons (TRPH) |
| Turbidity | Turbidity |
| Tylosin | Tylosin |
| Undercut Distance | Undercut Distance |
| UplandSlope | Slope of bank or upland area |
| Uranium | Uranium |
| Urea | Urea |
| Utensil | Utensil |
| Valifenalate | Valifenalate |
| Valley Width | Valley Width |
| Vanadium | Vanadium |
| VectorControl_Bs | Vector Control through Bs (Bacillus sphaericus) within waterbody |
| VectorControl_Bti | Vector Control through Bti (Bacillus Thuringensis Israelensis) within waterbody |
| VectorControl_Methoprene | Vector Control through Methoprene within waterbody |
| VectorControl_Mosquitofish | Vector Control through Mosquitofish within waterbody |
| VectorControl_Oil | Vector Control through Oil within waterbody |
| Veg_Emergent | Percent cover of emergent vegetation within a given area |
| Veg_Open | Percent cover of open space within a given area |
| Veg_SubmergedAlgae | Percent cover of submerged algae within a given area |
| Veg_SubmergedOther | Percent cover of submerged other (non-algae) within a given area |
| Veg_SurfaceAlgae | Percent cover of surface algae within a given area |
| Veg_SurfaceOther | Percent cover of surface other (non-algae) within a given area |
| Vegetation Cover Bank | Percent of both bank surfaces upstream of sample location estimated to be covered by vegetation (plants & roots at water's edge) |
| Vegetation Cover Instream | Percent of stream's water surface upstream of sample location estimated to be covered by aquatic vegetation |
| Vegetation Cover Quality Metric | Metric assesses the quality of vegetation cover in the riparian and channel zones |
| Vegetation Cover Structure Metric | Metric assesses structural complexity of the riparian environment in the riparian and channel zones (excluding low-flow) and includes any kind of tree, bush, shrub, or helophyte. Grasses are excluded. |
| Velocity | Velocity |
| Vinclozolin | Vinclozolin |
| Vinyl Chloride | Vinyl Chloride |
| Virginiamycin | Virginiamycin |
| Volume | Volume |
| W1_HALL_SWAMP | Riparian human disturbance index, all types, proximity-weighted sum |
| Wadeability | Wadeability |
| Warfarin-d5(Surrogate) | Warfarin-d5(Surrogate) |
| Waste, Food | Waste, Food |
| Waste, Pet | Waste, Pet |
| Waste, Yard | Waste, Yard |
| Water level below Reference Point | Distance from reference point to water surface |
| Water Level Fluctuations | Water Level Fluctuations |
| Water Withdrawal | Water Withdrawal |
| Waterbody Appeal | Waterbody Appeal |
| Waterbody Disturbance | Waterbody Disturbance |
| WaterbodyOrigin | Origin of the waterbody |
| WaterClarity | WaterClarity |
| Wave Height | Wave Height |
| WaveAction | Wind Movement of Water on Surface |
| Weight | Weight |
| Weight using UV light | Weight using UV light (%) |
| WetlandClass | Class or type of wetland |
| WetlandFunction_FloodControl | Function of the wetland for flood control use |
| WetlandFunction_HumanUse | Function of the wetland for human use |
| WetlandFunction_Stormwater | Function of the wetland for stormwater use |
| WetlandFunction_Wildlife | Function of the wetland for wildlife use |
| Wetted Width | Wetted Width |
| Width | Width |
| WindDirection | WindDirection |
| WindIntensity | Intensity of wind at the time of sampling |
| WindSpeed | WindSpeed |
| Wire | Wire |
| Wood Debris | Wood Debris |
| Wrapper, Food | Wrapper, Food |
| Wrapper, Other | Wrapper, Other |
| Wrapper, Plastic Straw | Wrapper, Plastic Straw |
| XBKF_W | Mean bankfull width of reach |
| XCDENMID | Mean percent mid-channel canopy density |
| XCMG | Riparian cover as sum of three layers physical-habitat metric |
| XCMGW | Mean riparian woody cover as sum of three layers |
| XFC_NAT_SWAMP | Mean sum of natural instream cover types |
| XSLOPE | Mean slope (water surface gradient) of reach |
| Xylene, m/p- | m-Xylene/p-Xylene |
| Xylene, o- | o-Xylene |
| Xylene, p- | p-Xylene |
| Xylenes, Total | Total Xylenes |
| Young/female | Young/female (#) |
| Ytterbium | Ytterbium |
| Yttrium | Yttrium |
| Z-Bifenthrin-d5, (rac-cis)-(Surrogate) | Surrogate: (rac-cis)-Z-Bifenthrin-d5 |
| Zinc | Zinc |
| Ziram | Ziram |
| Zoxamide | Zoxamide |